Mercurial > repos > vipints > fml_gff3togtf
view gff_to_gbk.xml @ 8:d4f9b7beb52f
cleaning the repository - GUI make it hard
author | vipints <vipin@cbio.mskcc.org> |
---|---|
date | Thu, 23 Apr 2015 17:51:14 -0400 |
parents | 6e589f267c14 |
children |
line wrap: on
line source
<tool id="fml_gff2gbk" name="GFF-to-GBK" version="2.0.0"> <description>converter</description> <command interpreter="python">gff_to_gbk.py $inf_gff $inf_fas $gbk_format </command> <inputs> <param format="gff,gff3" name="inf_gff" type="data" label="Convert this query" help="Genome annotation in GFF file format."/> <param format="fa,fasta" name="inf_fas" type="data" label="Genome Sequence" help="Genome sequence in FASTA format."/> </inputs> <outputs> <data format="genbank" name="gbk_format" label="${tool.name} on ${on_string}: Converted"/> </outputs> <tests> <test> <param name="inf_gff" value="s_cerevisiae_SCU49845.gff3" /> <param name="inf_fas" value="s_cerevisiae_SCU49845.fasta" /> <output name="gbk_format" file="s_cerevisiae_SCU49845.gbk" /> </test> </tests> <help> **What it does** This tool converts annotations in GFF to GenBank_ format (scroll down for format description). .. _GenBank: http://www.ncbi.nlm.nih.gov/genbank/ ------ **Example** - The following data in GFF:: ##gff-version 3 # sequence-region NM_001202705 1 2406 NM_001202705 GenBank chromosome 1 2406 . + 1 ID=NM_001202705;Alias=2;Dbxref=taxon:3702;Name=NM_001202705;Note=Arabidopsis thaliana thiamine biosynthesis protein ThiC (THIC) mRNA%2C complete cds.,REVIEWED REFSEQ; NM_001202705 GenBank gene 1 2406 . + 1 ID=AT2G29630;Dbxref=GeneID:817513,TAIR:AT2G29630;Name=THIC;locus_tag=AT2G29630 NM_001202705 GenBank mRNA 192 2126 . + 1 ID=AT2G29630.t01;Parent=AT2G29630 NM_001202705 GenBank CDS 192 2126 . + 1 ID=AT2G29630.p01;Parent=AT2G29630.t01;Dbxref=GI:334184567,GeneID:817513,TAIR:AT2G29630;Name=THIC;Note=thiaminC (THIC)%3B CONTAINS InterPro DOMAIN;rotein_id=NP_001189634.1; NM_001202705 GenBank exon 192 2126 . + 1 Parent=AT2G29630.t01 ##FASTA >NM_001202705 AAGCCTTTCGCTTTAGGCTGCATTGGGCCGTGACAATATTCAGACGATTCAGGAGGTTCG TTCCTTTTTTAAAGGACCCTAATCACTCTGAGTACCACTGACTCACTCAGTGTGCGCGAT - Will be converted to GenBank format:: LOCUS NM_001202705 2406 bp mRNA linear PLN 28-MAY-2011 DEFINITION Arabidopsis thaliana thiamine biosynthesis protein ThiC (THIC) mRNA, complete cds. ACCESSION NM_001202705 VERSION NM_001202705.1 GI:334184566......... FEATURES Location/Qualifiers source 1..2406 /organism="Arabidopsis thaliana" /mol_type="mRNA" /db_xref="taxon:3702"........ gene 1..2406 /gene="THIC" /locus_tag="AT2G29630" /gene_synonym="PY; PYRIMIDINE REQUIRING; T27A16.27;........ ORIGIN 1 aagcctttcg ctttaggctg cattgggccg tgacaatatt cagacgattc aggaggttcg 61 ttcctttttt aaaggaccct aatcactctg agtaccactg actcactcag tgtgcgcgat 121 tcatttcaaa aacgagccag cctcttcttc cttcgtctac tagatcagat ccaaagcttc 181 ctcttccagc tatggctgct tcagtacact gtaccttgat gtccgtcgta tgcaacaaca // ------ **About formats** **GFF** Generic Feature Format is a format for describing genes and other features associated with DNA, RNA and Protein sequences. GFF lines have nine tab-separated fields:: 1. seqid - Must be a chromosome or scaffold or contig. 2. source - The program that generated this feature. 3. type - The name of this type of feature. Some examples of standard feature types are "gene", "CDS", "protein", "mRNA", and "exon". 4. start - The starting position of the feature in the sequence. The first base is numbered 1. 5. stop - The ending position of the feature (inclusive). 6. score - A score between 0 and 1000. If there is no score value, enter ".". 7. strand - Valid entries include '+', '-', or '.' (for don't know/care). 8. phase - If the feature is a coding exon, frame should be a number between 0-2 that represents the reading frame of the first base. If the feature is not a coding exon, the value should be '.'. 9. attributes - All lines with the same group are linked together into a single item. **GenBank format** Consists of an annotation section and a sequence section. Sample record_ .. _record: http://www.ncbi.nlm.nih.gov/Sitemap/samplerecord.html -------- **Copyright** 2010-2014 Max Planck Society, University of Tübingen & Memorial Sloan Kettering Cancer Center Sreedharan VT, Schultheiss SJ, Jean G, Kahles A, Bohnert R, Drewe P, Mudrakarta P, Görnitz N, Zeller G, Rätsch G. Oqtans: the RNA-seq workbench in the cloud for complete and reproducible quantitative transcriptome analysis. Bioinformatics 10.1093/bioinformatics/btt731 (2014) </help> </tool>