|
0
|
1 <tool id="bs_seeker_wrapper" name="BS-Seeker2" version="2.0.0">
|
|
|
2 <requirements><requirement type='package'>bs_seeker2</requirement></requirements>
|
|
|
3 <description>Versatile aligner for bisulfite sequencing data</description>
|
|
|
4 <command interpreter="python">
|
|
|
5 bs_seeker2_wrapper.py
|
|
|
6 ### define exec path
|
|
|
7 ### --exec-path "/u/home/galaxy/galaxy/GalaxyTools/bin"
|
|
|
8 ### [Please change the following path to your local directory]
|
|
|
9 --exec-path "/Users/weilong/Documents/program/BSseeker2"
|
|
|
10 ### output
|
|
|
11 --align--output $align_output
|
|
|
12 --call_methylation--wig $call_methylation_wig
|
|
|
13 --call_methylation--CGmap $call_methylation_CGmap
|
|
|
14 --call_methylation--ATCGmap $call_methylation_ATCGmap
|
|
|
15 --call_methylation--txt
|
|
|
16
|
|
|
17 #if $singlePaired.sPaired == "paired"
|
|
|
18 --align--input_1 $input1
|
|
|
19 --align--input_2 $singlePaired.input2
|
|
|
20 #end if
|
|
|
21
|
|
|
22
|
|
|
23 ### aligner
|
|
|
24 --align--aligner ${choosealigner.aligner}
|
|
|
25
|
|
|
26 ### Index from history or built-in
|
|
|
27 #if $choosealigner.rrbsFragments.refGenomeSource.genomeSource == "history"
|
|
|
28 --build--file ${choosealigner.rrbsFragments.refGenomeSource.ownFile}
|
|
|
29 --build--aligner ${choosealigner.aligner}
|
|
|
30 --align-g ${choosealigner.rrbsFragments.refGenomeSource.ownFile}
|
|
|
31 --align--db ${choosealigner.rrbsFragments.refGenomeSource.ownFile}
|
|
|
32 #else if $choosealigner.rrbsFragments.refGenomeSource.genomeSource == "indexed"
|
|
|
33 --align--db ${choosealigner.rrbsFragments.refGenomeSource.index.fields.path}
|
|
|
34 --align-g ${choosealigner.rrbsFragments.refGenomeSource.index.fields.path}/${choosealigner.rrbsFragments.refGenomeSource.index.fields.dbkey}.fa
|
|
|
35
|
|
|
36 #end if
|
|
|
37
|
|
|
38 ### RRBS or WGBS
|
|
|
39 #if $choosealigner.rrbsFragments.Fragmented == "Yes"
|
|
|
40 #if $choosealigner.rrbsFragments.refGenomeSource.genomeSource == "history"
|
|
|
41 --build--rrbs
|
|
|
42 --build--low ${choosealigner.rrbsFragments.lowerBound}
|
|
|
43 --build--up ${choosealigner.rrbsFragments.upperBound}
|
|
|
44 #end if
|
|
|
45 --align--rrbs
|
|
|
46 --align--low ${choosealigner.rrbsFragments.lowerBound}
|
|
|
47 --align--up ${choosealigner.rrbsFragments.upperBound}
|
|
|
48 #end if
|
|
|
49
|
|
|
50
|
|
|
51
|
|
|
52 ### Inputs
|
|
|
53 #if $singlePaired.sPaired == "single"
|
|
|
54 --align-i $input1
|
|
|
55 #end if
|
|
|
56
|
|
|
57 ### Library type
|
|
|
58 --align-t $tag
|
|
|
59
|
|
|
60 ### other general options
|
|
|
61 #if $sParams.sSettingsType == "preSet"
|
|
|
62 --align--start_base 1
|
|
|
63 --align--end_base 200
|
|
|
64 --align--mis 4
|
|
|
65 #end if
|
|
|
66
|
|
|
67 ### adapter information
|
|
|
68 #if $adapterInfo.useAdapter == "Yes"
|
|
|
69 --align--adapter ${adapterInfo.adapter_file}
|
|
|
70 #end if
|
|
|
71
|
|
|
72 #if $sParams.sSettingsType == "full"
|
|
|
73 --align--start_base ${sParams.start_base}
|
|
|
74 --align--end_base ${sParams.end_base}
|
|
|
75 --align--mis ${sParams.num_mismatch}
|
|
|
76 #end if
|
|
|
77
|
|
|
78 </command>
|
|
|
79 <inputs>
|
|
|
80 <param format="fastq,fasta,qseq" name="input1" type="data" label="Input your read file" help="reads file in fastq, qseq or fasta format" />
|
|
|
81 <conditional name="singlePaired">
|
|
|
82 <param name="sPaired" type="select" label="Is this library mate-paired?">
|
|
|
83 <option value="single">Single-end</option>
|
|
|
84 <option value="paired">Paired-end</option>
|
|
|
85 </param>
|
|
|
86 <when value="paired">
|
|
|
87 <param format="fastq,fasta,qseq" name="input2" type="data" label="Input your read file 2" help="reads in fastq, qseq or fasta format" />
|
|
|
88 <param name="min_ins_distance" type="integer" value="-1" label=" Minimum insert size for valid paired-end alignments" />
|
|
|
89 <param name="max_ins_distance" type="integer" value="400" label="Maximum insert size for valid paired-end alignments" />
|
|
|
90 </when>
|
|
|
91 </conditional>
|
|
|
92 <param name="tag" type="select" label="Type of libraries">
|
|
|
93 <option value="N">directional libraries</option>
|
|
|
94 <option value="Y">undirectional libraries</option>
|
|
|
95 </param>
|
|
|
96 <conditional name="choosealigner">
|
|
|
97 <param name="aligner" type="select" label="Short reads aligner">
|
|
|
98 <option value="bowtie">bowtie</option>
|
|
|
99 <option value="bowtie2">bowtie2</option>
|
|
|
100 </param>
|
|
|
101 <when value="bowtie">
|
|
|
102 <conditional name="rrbsFragments">
|
|
|
103 <param name="Fragmented" type="select" label="RRBS-seq reads" help="">
|
|
|
104 <option value="No">No</option>
|
|
|
105 <option value="Yes">Yes</option>
|
|
|
106 </param>
|
|
|
107 <when value="Yes">
|
|
|
108 <param name="lowerBound" type="integer" value="40" label="The lower bound for RRBS fragments" help="Default: 40" />
|
|
|
109 <param name="upperBound" type="integer" value="500" label="The upper bound for RRBS fragments" help="Default: 500" />
|
|
|
110 <conditional name="refGenomeSource">
|
|
|
111 <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="">
|
|
|
112 <option value="indexed">Use a built-in index</option>
|
|
|
113 <option value="history">Use one from the history</option>
|
|
|
114 </param>
|
|
|
115 <when value="indexed">
|
|
|
116 <param name="index" type="select" label="Select a reference genome (RRBS, bowtie)">
|
|
|
117 <options from_data_table="bs_seeker2_indexes_RRBS_bowtie">
|
|
|
118 <filter type="sort_by" column="2"/>
|
|
|
119 <validator type="no_options" message="No indexes are available for the selected input dataset"/>
|
|
|
120 </options>
|
|
|
121 </param>
|
|
|
122 </when>
|
|
|
123 <when value="history">
|
|
|
124 <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" />
|
|
|
125 </when>
|
|
|
126 </conditional>
|
|
|
127 </when>
|
|
|
128 <when value="No">
|
|
|
129 <conditional name="refGenomeSource">
|
|
|
130 <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="">
|
|
|
131 <option value="indexed">Use a built-in index</option>
|
|
|
132 <option value="history">Use one from the history</option>
|
|
|
133 </param>
|
|
|
134 <when value="indexed">
|
|
|
135 <param name="index" type="select" label="Select a reference genome (WGBS, bowtie)">
|
|
|
136 <options from_data_table="bs_seeker2_indexes_WGBS_bowtie">
|
|
|
137 <filter type="sort_by" column="2"/>
|
|
|
138 <validator type="no_options" message="No indexes are available for the selected input dataset"/>
|
|
|
139 </options>
|
|
|
140 </param>
|
|
|
141 </when>
|
|
|
142 <when value="history">
|
|
|
143 <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" />
|
|
|
144 </when>
|
|
|
145 </conditional>
|
|
|
146 </when>
|
|
|
147 </conditional>
|
|
|
148 </when>
|
|
|
149
|
|
|
150 <when value="bowtie2">
|
|
|
151 <conditional name="rrbsFragments">
|
|
|
152 <param name="Fragmented" type="select" label="RRBS-seq reads" help="">
|
|
|
153 <option value="No">No</option>
|
|
|
154 <option value="Yes">Yes</option>
|
|
|
155 </param>
|
|
|
156 <when value="Yes">
|
|
|
157 <param name="lowerBound" type="integer" value="40" label="The lower bound for RRBS fragments" help="Default: 40" />
|
|
|
158 <param name="upperBound" type="integer" value="500" label="The upper bound for RRBS fragments" help="Default: 500" />
|
|
|
159 <conditional name="refGenomeSource">
|
|
|
160 <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="">
|
|
|
161 <option value="indexed">Use a built-in index</option>
|
|
|
162 <option value="history">Use one from the history</option>
|
|
|
163 </param>
|
|
|
164 <when value="indexed">
|
|
|
165 <param name="index" type="select" label="Select a reference genome (RRBS, bowtie2)">
|
|
|
166 <options from_data_table="bs_seeker2_indexes_RRBS_bowtie2">
|
|
|
167 <filter type="sort_by" column="2"/>
|
|
|
168 <validator type="no_options" message="No indexes are available for the selected input dataset"/>
|
|
|
169 </options>
|
|
|
170 </param>
|
|
|
171 </when>
|
|
|
172 <when value="history">
|
|
|
173 <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" />
|
|
|
174 </when>
|
|
|
175 </conditional>
|
|
|
176 </when>
|
|
|
177 <when value="No">
|
|
|
178 <conditional name="refGenomeSource">
|
|
|
179 <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="">
|
|
|
180 <option value="indexed">Use a built-in index</option>
|
|
|
181 <option value="history">Use one from the history</option>
|
|
|
182 </param>
|
|
|
183 <when value="indexed">
|
|
|
184 <param name="index" type="select" label="Select a reference genome (WGBS, bowtie2)">
|
|
|
185 <options from_data_table="bs_seeker2_indexes_WGBS_bowtie2">
|
|
|
186 <filter type="sort_by" column="2"/>
|
|
|
187 <validator type="no_options" message="No indexes are available for the selected input dataset"/>
|
|
|
188 </options>
|
|
|
189 </param>
|
|
|
190 </when>
|
|
|
191 <when value="history">
|
|
|
192 <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" />
|
|
|
193 </when>
|
|
|
194 </conditional>
|
|
|
195 </when>
|
|
|
196 </conditional>
|
|
|
197 </when>
|
|
|
198 </conditional>
|
|
|
199 <conditional name="adapterInfo">
|
|
|
200 <param name="useAdapter" type="select" label="adapter sequence">
|
|
|
201 <option value="noAdapter">No</option>
|
|
|
202 <option value="withAdapter">Yes</option>
|
|
|
203 </param>
|
|
|
204 <when value="withAdapter">
|
|
|
205 <param format="txt" name="adapter_file" type="data" label="Input file of your adaptor sequences" help="Input text file of your adaptor sequences" />
|
|
|
206 </when>
|
|
|
207 </conditional>
|
|
|
208
|
|
|
209 <conditional name="sParams">
|
|
|
210 <param name="sSettingsType" type="select" label="BS Seeker2 settings to use" help="You can use the default settings or set customer values for the BS Seeker2 parameters.">
|
|
|
211 <option value="preSet">User Defaults</option>
|
|
|
212 <option value="full">Full parameter list</option>
|
|
|
213 </param>
|
|
|
214 <when value="preSet" />
|
|
|
215 <when value="full">
|
|
|
216 <param name="start_base" type="integer" value="1" label="The start base of the read to be mapped" help="" />
|
|
|
217 <param name="end_base" type="integer" value="200" label="The end base of the read to be mapped" help="" />
|
|
|
218
|
|
|
219 <param name="num_mismatch" type="integer" value="4" label="Number of mismatches" help="(INT) Default: 4" />
|
|
|
220 </when>
|
|
|
221 </conditional>
|
|
|
222
|
|
|
223 </inputs>
|
|
|
224
|
|
|
225 <outputs>
|
|
|
226 <data format="bam" name="align_output" label="BAM Alignments"> </data>
|
|
|
227 <data format="wig" name="call_methylation_wig" label="Methylation Levels"> </data>
|
|
|
228 <data format="tabular" name="call_methylation_CGmap" label="CGmap file"> </data>
|
|
|
229 <data format="tabular" name="call_methylation_ATCGmap" label="ATCGmap file"> </data>
|
|
|
230
|
|
|
231 </outputs>
|
|
|
232 <help>
|
|
|
233 **What it does**
|
|
|
234
|
|
|
235 BS-Seeker2 is a seamlessly pipeline for mapping bisulfite sequencing data and generating detailed DNA methylome. BS-Seeker2 improves mappability by using local alignment, and is tailored for RRBS library by building special index, with higher efficiency and accuracy. This is the Galaxy version of BS-Seeker2.
|
|
|
236
|
|
|
237 ------
|
|
|
238
|
|
|
239 **Resources**
|
|
|
240
|
|
|
241 The homepage for BS-Seeker2 is http://pellegrini.mcdb.ucla.edu/BS_Seeker2/.
|
|
|
242
|
|
|
243 For more information of BS-Seeker2, please refer to https://github.com/BSSeeker/BSseeker2.
|
|
|
244
|
|
|
245 ------
|
|
|
246
|
|
|
247 **Example**
|
|
|
248
|
|
|
249 - Adapter file::
|
|
|
250
|
|
|
251 AGATCGGAAGAGCACACGTC
|
|
|
252
|
|
|
253
|
|
|
254 </help>
|
|
|
255 </tool>
|
