changeset 1:8b26adf64adc draft default tip

V2.0.5
author weilong-guo
date Tue, 05 Nov 2013 01:55:39 -0500
parents e6df770c0e58
children
files ._BSseeker2 BSseeker2/.DS_Store BSseeker2/._.DS_Store BSseeker2/._AUTHORS BSseeker2/._FilterReads.py BSseeker2/._README.md BSseeker2/._RELEASE_NOTES BSseeker2/._bs_align BSseeker2/._bs_index BSseeker2/._bs_seeker2-align.py BSseeker2/._bs_seeker2-build.py BSseeker2/._bs_seeker2-call_methylation.py BSseeker2/._bs_utils BSseeker2/._galaxy BSseeker2/.git/COMMIT_EDITMSG BSseeker2/.git/HEAD BSseeker2/.git/config BSseeker2/.git/description BSseeker2/.git/hooks/applypatch-msg.sample BSseeker2/.git/hooks/commit-msg.sample BSseeker2/.git/hooks/post-update.sample BSseeker2/.git/hooks/pre-applypatch.sample BSseeker2/.git/hooks/pre-commit.sample BSseeker2/.git/hooks/pre-push.sample BSseeker2/.git/hooks/pre-rebase.sample BSseeker2/.git/hooks/prepare-commit-msg.sample BSseeker2/.git/hooks/update.sample BSseeker2/.git/index BSseeker2/.git/info/exclude BSseeker2/.git/logs/HEAD BSseeker2/.git/logs/refs/heads/master BSseeker2/.git/logs/refs/remotes/origin/HEAD BSseeker2/.git/logs/refs/remotes/origin/master BSseeker2/.git/objects/00/617de95ccde6a4587513924dd8c377c282372a BSseeker2/.git/objects/02/23d68962616c5035b8f8a49d09eb9fea3bd4d6 BSseeker2/.git/objects/02/bff5729f69b469b4ec5a1c6df7d83a0c3f84df BSseeker2/.git/objects/02/f21118110bf12e3995381d0b5388ecc39f396b BSseeker2/.git/objects/04/bd24805dff9825629951311783935221cb83bf BSseeker2/.git/objects/08/a0832c5412197e32227afc7d6258f33e30c5b7 BSseeker2/.git/objects/0a/043f3a26f2ffb733bf9d53aa494fc82a50f3b8 BSseeker2/.git/objects/0b/a9fcc6f7d8306fdd778b555380015a7e13df2b BSseeker2/.git/objects/0c/7195e7ec701f0acea6d3068335b72f44ef6606 BSseeker2/.git/objects/0c/877f0900535fbee6909dc1591e8ad0eac29c52 BSseeker2/.git/objects/10/9a8400e787d00b1f566e9dd58f6a5301ae0b81 BSseeker2/.git/objects/11/35d4173810162c03f791537225d87a45b02f88 BSseeker2/.git/objects/13/73f3c499ff4b6fb8ddff39e8859fa5326d0098 BSseeker2/.git/objects/15/910301bc200b6f069dd75caa81101064c2fccf BSseeker2/.git/objects/17/109affd07fb12192968a793a7f362231132b24 BSseeker2/.git/objects/18/3503abbe78455abef73ad3e1a9c7615414b8a8 BSseeker2/.git/objects/19/bf07adb9f50b72bc4fa40ffe059f17c84826fd BSseeker2/.git/objects/1d/6a5d7a3f6280296c748b5746af2cf97a242a77 BSseeker2/.git/objects/1d/953d2c1096b42550676cf3c89852b5e2effa91 BSseeker2/.git/objects/1f/6bef43eec7df888917650e5866ab1cc751fd72 BSseeker2/.git/objects/1f/b3a026502e7eb0b3e9a214424e7469c558fde1 BSseeker2/.git/objects/20/3e3ea9ba50c325d53e45f6d31686b6b23bba41 BSseeker2/.git/objects/21/3194f9375d7c8c529a79af57ab482b32dafedf BSseeker2/.git/objects/21/bcf8cb4839f97e7a7074ffe2e0c9ae3055a3bc BSseeker2/.git/objects/24/fdfe57e71c2911fcd8603b85bcb8d8d4a6cbfd BSseeker2/.git/objects/29/092499eb76b2cb0ba9bca7f3ccf47105ee9ed9 BSseeker2/.git/objects/2b/7d900407635a6b75f21da06a1a139c68faec52 BSseeker2/.git/objects/2b/8c5b6fc86f2b12850ed17edbb1b53ab1cbd519 BSseeker2/.git/objects/2c/a16a8e6d59595ac5dafdbc161d0a6ee1feedd3 BSseeker2/.git/objects/2e/4fe35304a449115376c544fd24867f234c28e2 BSseeker2/.git/objects/2e/55629272ae40f146735bb1291638fd4c7d9955 BSseeker2/.git/objects/2e/c327624b0f8354842644929bdb34965e4dbaa4 BSseeker2/.git/objects/2f/442ab3a8839eba3367928f43c03a1690b57367 BSseeker2/.git/objects/2f/53aeee4fc5ee9dd458b8846c3b19385a3e3965 BSseeker2/.git/objects/32/2151f525a03b44f1baf8efa95b7a4b71ca9b6f BSseeker2/.git/objects/32/ab8243c9645f8083e7d11713e5f76dfb33b191 BSseeker2/.git/objects/33/68604160305d798b0aa8a101857b39a16aab92 BSseeker2/.git/objects/34/dfdab6463a8270332c510b91e669a40e7bde95 BSseeker2/.git/objects/35/44b8bb1e5666d100f7652fc63b985187990e49 BSseeker2/.git/objects/36/3573c4a1889f8a89136bea77502da4e4caf31d BSseeker2/.git/objects/36/e0c12ffea02da8b86f0eb70d13eb4bd1c5e52f BSseeker2/.git/objects/37/15a507ba242e7ffee322e83bb88495bffdfa84 BSseeker2/.git/objects/38/858de2e6dacf0ebf77379a9cb7a1f9115d1f58 BSseeker2/.git/objects/39/508bee8506ce06feead7599a53ffd09cc89198 BSseeker2/.git/objects/39/d7071eae44ec7b52c624a4b24c7c67101f1b68 BSseeker2/.git/objects/3a/fc1efb6bad2ca078808ac2df9006ca3ff82a8c BSseeker2/.git/objects/3b/4abe03399682b05bdffc0b5601127cbcf59234 BSseeker2/.git/objects/3b/f7e94c85fcc3d67cebd0e19a84bfc00aa8605f BSseeker2/.git/objects/3c/14c7a6fc9fd01ef7ffc3bc3b16153e20fda931 BSseeker2/.git/objects/3c/274ddc1164d826c6e9dddb7faf80d5d31f894c BSseeker2/.git/objects/3e/976df32e78806e4ff93a8e75059abdd0ea7181 BSseeker2/.git/objects/3e/f678dd2144fe82b422f173440c6f31a3430286 BSseeker2/.git/objects/3f/cc7ab24c5c00cb2cfa7da07cb73427f00a6a93 BSseeker2/.git/objects/3f/cd4fd599b9ec2a2ebf8da4875fdee78051e7cd BSseeker2/.git/objects/41/2eeda78dc9de1186c2e0e1526764af82ab3431 BSseeker2/.git/objects/41/ae40d93e4224bc6438f6ef14c15a2846138065 BSseeker2/.git/objects/41/c210ea7e3658ae2eb5d2da7be475da7d548894 BSseeker2/.git/objects/41/f0f93dc10a62d752d9ee5eb43effcd2dbe19fe BSseeker2/.git/objects/41/fc8bda8be2cb62409902674879a6ca93d84cc0 BSseeker2/.git/objects/43/5a4593e613fc1025f92891a8f08ac771ae1398 BSseeker2/.git/objects/46/87efc5d890418714cba363381cd4b311932fea BSseeker2/.git/objects/46/ebbc533f9479de561eefbf9feba9ce603e996c BSseeker2/.git/objects/49/738c43a9d49817fac7d108233edfa40af27bdb BSseeker2/.git/objects/4a/0fe7b0dfa14e5b4b62b5ead7a624f7361fee12 BSseeker2/.git/objects/4a/f64fdf97c823621c4259e7319c6484cbcbc8a5 BSseeker2/.git/objects/4c/b483bc8f85c2254f2f4adbddb13ca48d9d3048 BSseeker2/.git/objects/4d/9abcd6467711a66114b3115856cf2e1642b18f BSseeker2/.git/objects/4e/6d15d27856015a2bf2fd6e403759db1e9269d6 BSseeker2/.git/objects/4e/cf1ddb295944cf8b4b45aafeed8c19bd0f3b06 BSseeker2/.git/objects/50/cfd7aeafd7d1d2300fda58c59e2d329c26d798 BSseeker2/.git/objects/51/0ec79f82b6b5a087fd18a04fe11944f7aede94 BSseeker2/.git/objects/52/37b06ffa3a3f772f087c79e58746e1008813e9 BSseeker2/.git/objects/53/817ffe5f20347c0b6e705b574b2c6a95a93941 BSseeker2/.git/objects/56/5f548bc9a4ffcad63323481e8b03cb78a84b0a BSseeker2/.git/objects/57/01e9b44c000d76e00d423a26ac97a7caa0b988 BSseeker2/.git/objects/57/4651a64fded0bcebcd52eacd9397255b092ce4 BSseeker2/.git/objects/58/de749ac6ebe90f32db2c89cdd72507669695e2 BSseeker2/.git/objects/5c/0b7c08daea2343ab693b528c9714c68a539262 BSseeker2/.git/objects/5d/403497d5eefe3066c6cdfaeba14bc75c0b2939 BSseeker2/.git/objects/5d/63362d11c856e70be08fcf8c50eff99213c22d BSseeker2/.git/objects/5e/a242b9c8a60dcc9a4b9ac62e30c3260d11f697 BSseeker2/.git/objects/5e/bd21a16d61827ba9ee2b0353fbf6c8c8e88bca BSseeker2/.git/objects/5f/fa6c0f3f3d1b78e2899cc1ad9636affb5f2330 BSseeker2/.git/objects/62/17bbbf10fa50677a32ed961a0480ddf81dd833 BSseeker2/.git/objects/63/73d2e7c31f55f649b36f57ff12caafb94d8ca4 BSseeker2/.git/objects/64/88851c562de8e409fc4b2504e2a0f6f5796b06 BSseeker2/.git/objects/66/a096e1255b77248f631a5789db0d26e5009952 BSseeker2/.git/objects/66/c7e68f8a8e3653085c6259d202f9c740938a41 BSseeker2/.git/objects/66/d73645d397e073ef3f6591cc8e20889f863441 BSseeker2/.git/objects/68/aefe44af07a6434b8d1289b3b51ec01e2d1d18 BSseeker2/.git/objects/68/bbb4104520295cd1bba6d38dc4c8ef557578e1 BSseeker2/.git/objects/6a/eb6fc0a2180cd14c59d772e05c4c3139f37f2e BSseeker2/.git/objects/6a/f6e8c4f3e98fbe0a3668cc0bd49b400f78c2b7 BSseeker2/.git/objects/6b/b6ae1a79da1e04586d6f3273b012fc995bf33f BSseeker2/.git/objects/6c/a474f44b26d591aab232bb4f543094f60662fa BSseeker2/.git/objects/6d/252c627030a29eff9cc938f74c0be27ec853f0 BSseeker2/.git/objects/6d/84df45d981b431b64262b0f9fc1cb4fca7d424 BSseeker2/.git/objects/6e/4b91491dbf503844b132902207b10bb675a073 BSseeker2/.git/objects/6e/5dc58b1699ff1e665477c08becaf9435b42677 BSseeker2/.git/objects/71/5f8471c2dc3e60e99dfc042aed1b46bb9cc095 BSseeker2/.git/objects/71/860c94d65f6a776e5d62cdbb682d096bd7ced1 BSseeker2/.git/objects/71/af4f4bcb6d83a044fe02aff92802eb493274c4 BSseeker2/.git/objects/72/e59cf052f86f276e4667b637357f2e57e999e1 BSseeker2/.git/objects/74/0ea86532d893a100102756643fa0bbcac034a8 BSseeker2/.git/objects/74/11c2b2e56b60e4f412a81af1b7607d83ff0617 BSseeker2/.git/objects/75/2b598979416c079bebe57d9dee4fc00d816a5d BSseeker2/.git/objects/76/64a927ba6f12b023f6cd72dc407e616c5b85e5 BSseeker2/.git/objects/77/2dab1d09e09848fe92a238fc1413ac86b78e49 BSseeker2/.git/objects/77/5412491f6a25e65dfc8220fbb80afdee92e19d BSseeker2/.git/objects/78/f0cc2d5679fac527ded2d199b7723d2858a609 BSseeker2/.git/objects/7b/ded3bdfd5c7cde1ac7a66a94e83d4352632d5b BSseeker2/.git/objects/7c/2f8e591b0355cf96ad95f887ce43c9ad9b6ccb BSseeker2/.git/objects/7c/61cced8cd621d9b25c26438f9bb2270e9bdad2 BSseeker2/.git/objects/7c/ca75230355b000206fa058bb095903f55aa063 BSseeker2/.git/objects/7d/70d64ee9046b29c7a3bd6b8bf6f87813ab3bc6 BSseeker2/.git/objects/7e/5487ac62878708fcf58fcdb0fcd13acfc37b2f BSseeker2/.git/objects/7e/64ec5f40ce0bd0a35f104af23729323714b648 BSseeker2/.git/objects/82/3880bb2ebba5ae6bd1c7de7dfc4ce03935155b BSseeker2/.git/objects/82/ccc4a40d249856388e2a34e02f4ec42dce1b5f BSseeker2/.git/objects/83/93a0ab5e551d7c5221a1aee43d915a31a6bbd7 BSseeker2/.git/objects/84/06d09075408fde885ddfe8c4e183a75e0b959e BSseeker2/.git/objects/84/a6806795f21378c36629e61282f8bbaa95d9dc BSseeker2/.git/objects/84/c267bfba017386e573583b5190da45d513d274 BSseeker2/.git/objects/84/c8795a8d3adf0ee8bb820608886f1e833d70f3 BSseeker2/.git/objects/85/1f792a7fa3077c4a3b2053e7ece53db1e1b5d1 BSseeker2/.git/objects/85/a936d6dab3f3c5585bcab2eee7b18bbc7d7fd8 BSseeker2/.git/objects/86/5761b47a7c85b4d343beeb7c9c3ed640601ebf BSseeker2/.git/objects/86/fd03bf2e7dda2de53aa0a7292173a5bf2b4bc7 BSseeker2/.git/objects/87/6457ba39990e75afb27c7243da61fdd85bfdf3 BSseeker2/.git/objects/88/496377d81be7202c5a385ed7e5df52778c9f9d BSseeker2/.git/objects/8b/159869b8124569a96b7e4e841ea3658a75db57 BSseeker2/.git/objects/8d/30a2f0de740bd1cbe9346cf486bb360881e7b0 BSseeker2/.git/objects/8f/0dc7039482a4fed3a0f4ee6c0dae8e61f38d91 BSseeker2/.git/objects/8f/586f3d54f92f4c295f1090fc15e61d3788c4fd BSseeker2/.git/objects/8f/640235eeddfaf50d208e68adf6e08ff96348fb BSseeker2/.git/objects/8f/b12719f1dba55da26896e09c090e385f6f1fe6 BSseeker2/.git/objects/91/2dad6a9bcc2294cd04131ab7f06ffce58435c5 BSseeker2/.git/objects/91/2ef7d6168979afb5b56ed40120b4c620809da7 BSseeker2/.git/objects/92/1edcff26ba7b7f7a2d6f2cedece007e8006c9d BSseeker2/.git/objects/94/29632a76fafb840eeddf179810a2e8cfc18b44 BSseeker2/.git/objects/94/a9ed024d3859793618152ea559a168bbcbb5e2 BSseeker2/.git/objects/95/1e8892050fa8255989993946a403d42dba05a2 BSseeker2/.git/objects/97/02043009a1c30882ee8efd386919b9775419c8 BSseeker2/.git/objects/97/2d65097162fdbd73a19797366806e2b72c0861 BSseeker2/.git/objects/97/bb6dd7f2cf43da4acb857b2d048ec87cb996e1 BSseeker2/.git/objects/99/9c2eacdd1b0da3bd211cbfa7e83183e3ae1ab0 BSseeker2/.git/objects/99/e2633f8338b3c1f44cf3d1e2fa7ed5e3ce73ed BSseeker2/.git/objects/9a/5920e30c012e1eba7a20047f4f85a48ecab04c BSseeker2/.git/objects/9c/2b8bf5a1046ca6f8fdc87146c8600a4c0b863b BSseeker2/.git/objects/9c/390872015d7873ebd00a98d32bbc5913414730 BSseeker2/.git/objects/9d/2bc37995bb4a9434575616e95201c82fd08e02 BSseeker2/.git/objects/9d/dd63485ec0ed6f3a7b0bd65593580ad8e18b41 BSseeker2/.git/objects/9e/dfef5327bb169e27dac0a8541df3e116e13e53 BSseeker2/.git/objects/a3/dc53707171c1390211069269899dd310e00210 BSseeker2/.git/objects/a4/01ac91383e16c013d76a4db4f4fc8a7bfe38b4 BSseeker2/.git/objects/a4/bfd08fca2bffe134f8499cd0b89002bcb8fd1c BSseeker2/.git/objects/a9/4159479577e1278a51348d1b2e7e29c5dc24f0 BSseeker2/.git/objects/ac/61e2ad7235c9b954450e267b95134404f60521 BSseeker2/.git/objects/ac/9fbd06659e06888188b5640e990f10720d0112 BSseeker2/.git/objects/ae/8a4ec09c62f840326244374ad5a5bfdf226bd6 BSseeker2/.git/objects/b4/84357be80aac412aa1f7ccb9e45290a22303d8 BSseeker2/.git/objects/b4/cbc789c9cded56c331d9c262444d0cbe58e3ff BSseeker2/.git/objects/b5/758231ef4f42621409676e9e6450a3a5885e5b BSseeker2/.git/objects/b6/26f4a52659a967b6132ad32a2e9071e6a1b004 BSseeker2/.git/objects/b7/171c2f1b920b16ac41198a6b0af1dc2c2c9e78 BSseeker2/.git/objects/b7/1b2be06f002551f619fca2db129a4284a32cd0 BSseeker2/.git/objects/b7/7b6e04c2f0d6cf0ff5662b8150b4cccacfeaf4 BSseeker2/.git/objects/b8/cf58db75eaf9a015a04eb734d756b1fb6c9df1 BSseeker2/.git/objects/b9/1997bb3d05bfaa2d85ca71ac327cd03f4fb644 BSseeker2/.git/objects/b9/8d98f275842e593aea9330a37de9e0fbcae1d5 BSseeker2/.git/objects/ba/0a63e17eb6f573cccbbd1d33cf149a3a66f306 BSseeker2/.git/objects/bb/9c3276c3158ae9eda8a517bb7f5f2561eafe1c BSseeker2/.git/objects/bc/1f424a3b8c4947e3bf03cd2af76a3c1446144e BSseeker2/.git/objects/bc/a097526f847079098d7dfa48905c6a446b721c BSseeker2/.git/objects/be/1d4b99985233fa05ce96c76feba716fc040686 BSseeker2/.git/objects/be/f543ff7089d4909c2386d8ceed3cae32e7a7fd BSseeker2/.git/objects/bf/0578826f7cc94414b5132218481f4b3b97821a BSseeker2/.git/objects/c0/55d46bb9f3cb38f09ec5e4cff4130dd8671898 BSseeker2/.git/objects/c1/817fa1138e147fefc7c95af925ec76cc97fe23 BSseeker2/.git/objects/c2/44909e51bfc35b939e9db343f5502b39ea1dde BSseeker2/.git/objects/c4/35e1564497baba3aa70cea8b03c5173dd767d1 BSseeker2/.git/objects/c6/420c84ecc2892b8de9ef79ac41f561839aa8f5 BSseeker2/.git/objects/c7/08088d803509f61713c367d1ba3139c61e466b BSseeker2/.git/objects/c7/6ec688d38ceaf396c842592f18c0d97f295ea8 BSseeker2/.git/objects/c7/b134d0bd0420393ed72c961d8a2d85de8de6d8 BSseeker2/.git/objects/c8/323117348c23bea8440d5f50a483f544b01b8d BSseeker2/.git/objects/c9/6c477f7ac888f641c2b601920ef741523b94c2 BSseeker2/.git/objects/ca/95bc33a08c4e9bbc99ade9de8ecc875306fdc5 BSseeker2/.git/objects/ce/46247e9f5a37f638a53b8a1ded67a629fae840 BSseeker2/.git/objects/ce/f06629065737ee12b7f273b8b3ed3b4ac8b7e5 BSseeker2/.git/objects/cf/92584d96edb4a3b499fff3d557eea5c34fef2c BSseeker2/.git/objects/d0/58b66d33091deedbd911a4159cc2952784f1df BSseeker2/.git/objects/d1/f7f34453e3025a3867c973b6987c34e0b31b55 BSseeker2/.git/objects/d2/5e5f86e89284405516e24d41d1bb27688e7347 BSseeker2/.git/objects/d3/a7114a0984f878bf7d17774d2ce85e2eb240ba BSseeker2/.git/objects/d4/cae6a4f8fac1506dedaf53fa4279c66f730ce0 BSseeker2/.git/objects/d5/fbd40fdd677155773dc935bff7f4980db345fe BSseeker2/.git/objects/d9/67f3295a240312118ad48a7dff28eff2ae4c28 BSseeker2/.git/objects/da/e85a8d63775a001a4f14c4b5abf233b8b65f67 BSseeker2/.git/objects/dd/bd82ab95d51adc1ce4e1f0094be1885344ecf6 BSseeker2/.git/objects/dd/d8783f63a7b6c3b51a73597fe0d2b7c8f5fa35 BSseeker2/.git/objects/de/51e461a39b764261a5bc6d4e7a014046f677f4 BSseeker2/.git/objects/de/9d33fcba71782f03c7695b87bacb6b0b80e6aa BSseeker2/.git/objects/e0/7397a0fdcb0bb86dcd2c7d9fa3ab121b1717af BSseeker2/.git/objects/e6/9de29bb2d1d6434b8b29ae775ad8c2e48c5391 BSseeker2/.git/objects/e8/f9d7a9ef29943d91dc44ec39f2941cf5d308af BSseeker2/.git/objects/ea/96cb7439184335f7bb1680aa7fdc58f82cdd57 BSseeker2/.git/objects/ea/a930cc269c8b99fd6bd56c518de13ee2e50665 BSseeker2/.git/objects/eb/0e225d8aafcc0a0c58bfe0819a863d78d049fd BSseeker2/.git/objects/eb/7a5764d926f8460d2874ee382c135c0a6cd38e BSseeker2/.git/objects/ec/b9e7d3930b5c5b91693c74df0cdb560580c8fd BSseeker2/.git/objects/ec/d952bec69ea1164d94471964ac7269052c3992 BSseeker2/.git/objects/ee/314b81826a271f96a65ca1b4249a71843ca393 BSseeker2/.git/objects/ee/5f622335ab9431565c0eb9dfbaa7c39249a9bf BSseeker2/.git/objects/ee/b91603db0ff79641cd6fb225b13c627a11781b BSseeker2/.git/objects/ef/532a4f1428f5e19739afae006caf6c0bc705d7 BSseeker2/.git/objects/ef/5c83956056aed85fcbbc2bacd9b544ce3accad BSseeker2/.git/objects/f0/67aeca9b0da754061ab0ccc58a6c2d14b5ac81 BSseeker2/.git/objects/f2/86983cf69da7511f3921cd9a6a8d640e29b9bb BSseeker2/.git/objects/f2/8faa1d516a9da3841ab8e21aecef5abbfb37a3 BSseeker2/.git/objects/f8/2057db16b606422bc239ac5d0218efc63584f3 BSseeker2/.git/objects/f9/585ea347c6c0d42ecb8b9e1cc774fdff81ba04 BSseeker2/.git/objects/fc/38e4d63c666ce2899bc1baa2614d578b3f9d4c BSseeker2/.git/objects/fc/c2e4790d67031d58ee3ca7796bc4825d1077a5 BSseeker2/.git/objects/fd/ca7708027c72c081c0d48d257d84ce5d5a6c24 BSseeker2/.git/objects/fe/3af2b9748dd0594f9caedc5ce446f72d758f56 BSseeker2/.git/objects/ff/e723a1f313914590bb10496b6d418d8a2ea614 BSseeker2/.git/packed-refs BSseeker2/.git/refs/heads/master BSseeker2/.git/refs/remotes/origin/HEAD BSseeker2/.git/refs/remotes/origin/master BSseeker2/.idea/.name BSseeker2/.idea/BSseeker2.iml BSseeker2/.idea/encodings.xml BSseeker2/.idea/misc.xml BSseeker2/.idea/modules.xml BSseeker2/.idea/other.xml BSseeker2/.idea/scopes/scope_settings.xml BSseeker2/.idea/testrunner.xml BSseeker2/.idea/vcs.xml BSseeker2/.idea/workspace.xml BSseeker2/AUTHORS BSseeker2/FilterReads.py BSseeker2/README.md BSseeker2/RELEASE_NOTES BSseeker2/bs_align/.___init__.py BSseeker2/bs_align/._bs_align_utils.py BSseeker2/bs_align/._bs_pair_end.py BSseeker2/bs_align/._bs_rrbs.py BSseeker2/bs_align/._bs_single_end.py BSseeker2/bs_align/._output.py BSseeker2/bs_align/bs_align_utils.py BSseeker2/bs_align/bs_pair_end.py BSseeker2/bs_align/bs_rrbs.py BSseeker2/bs_align/bs_single_end.py BSseeker2/bs_align/output.py BSseeker2/bs_index/.___init__.py BSseeker2/bs_index/._rrbs_build.py BSseeker2/bs_index/._wg_build.py BSseeker2/bs_index/wg_build.py BSseeker2/bs_seeker2-align.py BSseeker2/bs_seeker2-build.py BSseeker2/bs_seeker2-call_methylation.py BSseeker2/bs_utils/.___init__.py BSseeker2/bs_utils/._utils.py BSseeker2/bs_utils/__init__.py BSseeker2/bs_utils/utils.py BSseeker2/galaxy/.___init__.py BSseeker2/galaxy/._bs_seeker2_wrapper.py BSseeker2/galaxy/._bs_seeker2_wrapper.xml BSseeker2/galaxy/__init__.py BSseeker2/galaxy/bs_seeker2_wrapper.py BSseeker2/galaxy/bs_seeker2_wrapper.xml
diffstat 303 files changed, 2663 insertions(+), 1126 deletions(-) [+]
line wrap: on
line diff
Binary file ._BSseeker2 has changed
Binary file BSseeker2/.DS_Store has changed
Binary file BSseeker2/._.DS_Store has changed
Binary file BSseeker2/._AUTHORS has changed
Binary file BSseeker2/._FilterReads.py has changed
Binary file BSseeker2/._README.md has changed
Binary file BSseeker2/._RELEASE_NOTES has changed
Binary file BSseeker2/._bs_align has changed
Binary file BSseeker2/._bs_index has changed
Binary file BSseeker2/._bs_seeker2-align.py has changed
Binary file BSseeker2/._bs_seeker2-build.py has changed
Binary file BSseeker2/._bs_seeker2-call_methylation.py has changed
Binary file BSseeker2/._bs_utils has changed
Binary file BSseeker2/._galaxy has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/COMMIT_EDITMSG	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,1 @@
+V2.0.5
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/HEAD	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,1 @@
+ref: refs/heads/master
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/config	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,13 @@
+[core]
+	repositoryformatversion = 0
+	filemode = true
+	bare = false
+	logallrefupdates = true
+	ignorecase = true
+	precomposeunicode = false
+[remote "origin"]
+	url = https://github.com/BSSeeker/BSseeker2.git
+	fetch = +refs/heads/*:refs/remotes/origin/*
+[branch "master"]
+	remote = origin
+	merge = refs/heads/master
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/description	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,1 @@
+Unnamed repository; edit this file 'description' to name the repository.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/hooks/applypatch-msg.sample	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,15 @@
+#!/bin/sh
+#
+# An example hook script to check the commit log message taken by
+# applypatch from an e-mail message.
+#
+# The hook should exit with non-zero status after issuing an
+# appropriate message if it wants to stop the commit.  The hook is
+# allowed to edit the commit message file.
+#
+# To enable this hook, rename this file to "applypatch-msg".
+
+. git-sh-setup
+test -x "$GIT_DIR/hooks/commit-msg" &&
+	exec "$GIT_DIR/hooks/commit-msg" ${1+"$@"}
+:
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/hooks/commit-msg.sample	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,24 @@
+#!/bin/sh
+#
+# An example hook script to check the commit log message.
+# Called by "git commit" with one argument, the name of the file
+# that has the commit message.  The hook should exit with non-zero
+# status after issuing an appropriate message if it wants to stop the
+# commit.  The hook is allowed to edit the commit message file.
+#
+# To enable this hook, rename this file to "commit-msg".
+
+# Uncomment the below to add a Signed-off-by line to the message.
+# Doing this in a hook is a bad idea in general, but the prepare-commit-msg
+# hook is more suited to it.
+#
+# SOB=$(git var GIT_AUTHOR_IDENT | sed -n 's/^\(.*>\).*$/Signed-off-by: \1/p')
+# grep -qs "^$SOB" "$1" || echo "$SOB" >> "$1"
+
+# This example catches duplicate Signed-off-by lines.
+
+test "" = "$(grep '^Signed-off-by: ' "$1" |
+	 sort | uniq -c | sed -e '/^[ 	]*1[ 	]/d')" || {
+	echo >&2 Duplicate Signed-off-by lines.
+	exit 1
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/hooks/post-update.sample	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,8 @@
+#!/bin/sh
+#
+# An example hook script to prepare a packed repository for use over
+# dumb transports.
+#
+# To enable this hook, rename this file to "post-update".
+
+exec git update-server-info
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/hooks/pre-applypatch.sample	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,14 @@
+#!/bin/sh
+#
+# An example hook script to verify what is about to be committed
+# by applypatch from an e-mail message.
+#
+# The hook should exit with non-zero status after issuing an
+# appropriate message if it wants to stop the commit.
+#
+# To enable this hook, rename this file to "pre-applypatch".
+
+. git-sh-setup
+test -x "$GIT_DIR/hooks/pre-commit" &&
+	exec "$GIT_DIR/hooks/pre-commit" ${1+"$@"}
+:
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/hooks/pre-commit.sample	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,50 @@
+#!/bin/sh
+#
+# An example hook script to verify what is about to be committed.
+# Called by "git commit" with no arguments.  The hook should
+# exit with non-zero status after issuing an appropriate message if
+# it wants to stop the commit.
+#
+# To enable this hook, rename this file to "pre-commit".
+
+if git rev-parse --verify HEAD >/dev/null 2>&1
+then
+	against=HEAD
+else
+	# Initial commit: diff against an empty tree object
+	against=4b825dc642cb6eb9a060e54bf8d69288fbee4904
+fi
+
+# If you want to allow non-ascii filenames set this variable to true.
+allownonascii=$(git config hooks.allownonascii)
+
+# Redirect output to stderr.
+exec 1>&2
+
+# Cross platform projects tend to avoid non-ascii filenames; prevent
+# them from being added to the repository. We exploit the fact that the
+# printable range starts at the space character and ends with tilde.
+if [ "$allownonascii" != "true" ] &&
+	# Note that the use of brackets around a tr range is ok here, (it's
+	# even required, for portability to Solaris 10's /usr/bin/tr), since
+	# the square bracket bytes happen to fall in the designated range.
+	test $(git diff --cached --name-only --diff-filter=A -z $against |
+	  LC_ALL=C tr -d '[ -~]\0' | wc -c) != 0
+then
+	echo "Error: Attempt to add a non-ascii file name."
+	echo
+	echo "This can cause problems if you want to work"
+	echo "with people on other platforms."
+	echo
+	echo "To be portable it is advisable to rename the file ..."
+	echo
+	echo "If you know what you are doing you can disable this"
+	echo "check using:"
+	echo
+	echo "  git config hooks.allownonascii true"
+	echo
+	exit 1
+fi
+
+# If there are whitespace errors, print the offending file names and fail.
+exec git diff-index --check --cached $against --
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/hooks/pre-push.sample	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,53 @@
+#!/bin/sh
+
+# An example hook script to verify what is about to be pushed.  Called by "git
+# push" after it has checked the remote status, but before anything has been
+# pushed.  If this script exits with a non-zero status nothing will be pushed.
+#
+# This hook is called with the following parameters:
+#
+# $1 -- Name of the remote to which the push is being done
+# $2 -- URL to which the push is being done
+#
+# If pushing without using a named remote those arguments will be equal.
+#
+# Information about the commits which are being pushed is supplied as lines to
+# the standard input in the form:
+#
+#   <local ref> <local sha1> <remote ref> <remote sha1>
+#
+# This sample shows how to prevent push of commits where the log message starts
+# with "WIP" (work in progress).
+
+remote="$1"
+url="$2"
+
+z40=0000000000000000000000000000000000000000
+
+IFS=' '
+while read local_ref local_sha remote_ref remote_sha
+do
+	if [ "$local_sha" = $z40 ]
+	then
+		# Handle delete
+	else
+		if [ "$remote_sha" = $z40 ]
+		then
+			# New branch, examine all commits
+			range="$local_sha"
+		else
+			# Update to existing branch, examine new commits
+			range="$remote_sha..$local_sha"
+		fi
+
+		# Check for WIP commit
+		commit=`git rev-list -n 1 --grep '^WIP' "$range"`
+		if [ -n "$commit" ]
+		then
+			echo "Found WIP commit in $local_ref, not pushing"
+			exit 1
+		fi
+	fi
+done
+
+exit 0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/hooks/pre-rebase.sample	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,169 @@
+#!/bin/sh
+#
+# Copyright (c) 2006, 2008 Junio C Hamano
+#
+# The "pre-rebase" hook is run just before "git rebase" starts doing
+# its job, and can prevent the command from running by exiting with
+# non-zero status.
+#
+# The hook is called with the following parameters:
+#
+# $1 -- the upstream the series was forked from.
+# $2 -- the branch being rebased (or empty when rebasing the current branch).
+#
+# This sample shows how to prevent topic branches that are already
+# merged to 'next' branch from getting rebased, because allowing it
+# would result in rebasing already published history.
+
+publish=next
+basebranch="$1"
+if test "$#" = 2
+then
+	topic="refs/heads/$2"
+else
+	topic=`git symbolic-ref HEAD` ||
+	exit 0 ;# we do not interrupt rebasing detached HEAD
+fi
+
+case "$topic" in
+refs/heads/??/*)
+	;;
+*)
+	exit 0 ;# we do not interrupt others.
+	;;
+esac
+
+# Now we are dealing with a topic branch being rebased
+# on top of master.  Is it OK to rebase it?
+
+# Does the topic really exist?
+git show-ref -q "$topic" || {
+	echo >&2 "No such branch $topic"
+	exit 1
+}
+
+# Is topic fully merged to master?
+not_in_master=`git rev-list --pretty=oneline ^master "$topic"`
+if test -z "$not_in_master"
+then
+	echo >&2 "$topic is fully merged to master; better remove it."
+	exit 1 ;# we could allow it, but there is no point.
+fi
+
+# Is topic ever merged to next?  If so you should not be rebasing it.
+only_next_1=`git rev-list ^master "^$topic" ${publish} | sort`
+only_next_2=`git rev-list ^master           ${publish} | sort`
+if test "$only_next_1" = "$only_next_2"
+then
+	not_in_topic=`git rev-list "^$topic" master`
+	if test -z "$not_in_topic"
+	then
+		echo >&2 "$topic is already up-to-date with master"
+		exit 1 ;# we could allow it, but there is no point.
+	else
+		exit 0
+	fi
+else
+	not_in_next=`git rev-list --pretty=oneline ^${publish} "$topic"`
+	/usr/bin/perl -e '
+		my $topic = $ARGV[0];
+		my $msg = "* $topic has commits already merged to public branch:\n";
+		my (%not_in_next) = map {
+			/^([0-9a-f]+) /;
+			($1 => 1);
+		} split(/\n/, $ARGV[1]);
+		for my $elem (map {
+				/^([0-9a-f]+) (.*)$/;
+				[$1 => $2];
+			} split(/\n/, $ARGV[2])) {
+			if (!exists $not_in_next{$elem->[0]}) {
+				if ($msg) {
+					print STDERR $msg;
+					undef $msg;
+				}
+				print STDERR " $elem->[1]\n";
+			}
+		}
+	' "$topic" "$not_in_next" "$not_in_master"
+	exit 1
+fi
+
+exit 0
+
+################################################################
+
+This sample hook safeguards topic branches that have been
+published from being rewound.
+
+The workflow assumed here is:
+
+ * Once a topic branch forks from "master", "master" is never
+   merged into it again (either directly or indirectly).
+
+ * Once a topic branch is fully cooked and merged into "master",
+   it is deleted.  If you need to build on top of it to correct
+   earlier mistakes, a new topic branch is created by forking at
+   the tip of the "master".  This is not strictly necessary, but
+   it makes it easier to keep your history simple.
+
+ * Whenever you need to test or publish your changes to topic
+   branches, merge them into "next" branch.
+
+The script, being an example, hardcodes the publish branch name
+to be "next", but it is trivial to make it configurable via
+$GIT_DIR/config mechanism.
+
+With this workflow, you would want to know:
+
+(1) ... if a topic branch has ever been merged to "next".  Young
+    topic branches can have stupid mistakes you would rather
+    clean up before publishing, and things that have not been
+    merged into other branches can be easily rebased without
+    affecting other people.  But once it is published, you would
+    not want to rewind it.
+
+(2) ... if a topic branch has been fully merged to "master".
+    Then you can delete it.  More importantly, you should not
+    build on top of it -- other people may already want to
+    change things related to the topic as patches against your
+    "master", so if you need further changes, it is better to
+    fork the topic (perhaps with the same name) afresh from the
+    tip of "master".
+
+Let's look at this example:
+
+		   o---o---o---o---o---o---o---o---o---o "next"
+		  /       /           /           /
+		 /   a---a---b A     /           /
+		/   /               /           /
+	       /   /   c---c---c---c B         /
+	      /   /   /             \         /
+	     /   /   /   b---b C     \       /
+	    /   /   /   /             \     /
+    ---o---o---o---o---o---o---o---o---o---o---o "master"
+
+
+A, B and C are topic branches.
+
+ * A has one fix since it was merged up to "next".
+
+ * B has finished.  It has been fully merged up to "master" and "next",
+   and is ready to be deleted.
+
+ * C has not merged to "next" at all.
+
+We would want to allow C to be rebased, refuse A, and encourage
+B to be deleted.
+
+To compute (1):
+
+	git rev-list ^master ^topic next
+	git rev-list ^master        next
+
+	if these match, topic has not merged in next at all.
+
+To compute (2):
+
+	git rev-list master..topic
+
+	if this is empty, it is fully merged to "master".
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/hooks/prepare-commit-msg.sample	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,36 @@
+#!/bin/sh
+#
+# An example hook script to prepare the commit log message.
+# Called by "git commit" with the name of the file that has the
+# commit message, followed by the description of the commit
+# message's source.  The hook's purpose is to edit the commit
+# message file.  If the hook fails with a non-zero status,
+# the commit is aborted.
+#
+# To enable this hook, rename this file to "prepare-commit-msg".
+
+# This hook includes three examples.  The first comments out the
+# "Conflicts:" part of a merge commit.
+#
+# The second includes the output of "git diff --name-status -r"
+# into the message, just before the "git status" output.  It is
+# commented because it doesn't cope with --amend or with squashed
+# commits.
+#
+# The third example adds a Signed-off-by line to the message, that can
+# still be edited.  This is rarely a good idea.
+
+case "$2,$3" in
+  merge,)
+    /usr/bin/perl -i.bak -ne 's/^/# /, s/^# #/#/ if /^Conflicts/ .. /#/; print' "$1" ;;
+
+# ,|template,)
+#   /usr/bin/perl -i.bak -pe '
+#      print "\n" . `git diff --cached --name-status -r`
+#	 if /^#/ && $first++ == 0' "$1" ;;
+
+  *) ;;
+esac
+
+# SOB=$(git var GIT_AUTHOR_IDENT | sed -n 's/^\(.*>\).*$/Signed-off-by: \1/p')
+# grep -qs "^$SOB" "$1" || echo "$SOB" >> "$1"
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/hooks/update.sample	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,128 @@
+#!/bin/sh
+#
+# An example hook script to blocks unannotated tags from entering.
+# Called by "git receive-pack" with arguments: refname sha1-old sha1-new
+#
+# To enable this hook, rename this file to "update".
+#
+# Config
+# ------
+# hooks.allowunannotated
+#   This boolean sets whether unannotated tags will be allowed into the
+#   repository.  By default they won't be.
+# hooks.allowdeletetag
+#   This boolean sets whether deleting tags will be allowed in the
+#   repository.  By default they won't be.
+# hooks.allowmodifytag
+#   This boolean sets whether a tag may be modified after creation. By default
+#   it won't be.
+# hooks.allowdeletebranch
+#   This boolean sets whether deleting branches will be allowed in the
+#   repository.  By default they won't be.
+# hooks.denycreatebranch
+#   This boolean sets whether remotely creating branches will be denied
+#   in the repository.  By default this is allowed.
+#
+
+# --- Command line
+refname="$1"
+oldrev="$2"
+newrev="$3"
+
+# --- Safety check
+if [ -z "$GIT_DIR" ]; then
+	echo "Don't run this script from the command line." >&2
+	echo " (if you want, you could supply GIT_DIR then run" >&2
+	echo "  $0 <ref> <oldrev> <newrev>)" >&2
+	exit 1
+fi
+
+if [ -z "$refname" -o -z "$oldrev" -o -z "$newrev" ]; then
+	echo "Usage: $0 <ref> <oldrev> <newrev>" >&2
+	exit 1
+fi
+
+# --- Config
+allowunannotated=$(git config --bool hooks.allowunannotated)
+allowdeletebranch=$(git config --bool hooks.allowdeletebranch)
+denycreatebranch=$(git config --bool hooks.denycreatebranch)
+allowdeletetag=$(git config --bool hooks.allowdeletetag)
+allowmodifytag=$(git config --bool hooks.allowmodifytag)
+
+# check for no description
+projectdesc=$(sed -e '1q' "$GIT_DIR/description")
+case "$projectdesc" in
+"Unnamed repository"* | "")
+	echo "*** Project description file hasn't been set" >&2
+	exit 1
+	;;
+esac
+
+# --- Check types
+# if $newrev is 0000...0000, it's a commit to delete a ref.
+zero="0000000000000000000000000000000000000000"
+if [ "$newrev" = "$zero" ]; then
+	newrev_type=delete
+else
+	newrev_type=$(git cat-file -t $newrev)
+fi
+
+case "$refname","$newrev_type" in
+	refs/tags/*,commit)
+		# un-annotated tag
+		short_refname=${refname##refs/tags/}
+		if [ "$allowunannotated" != "true" ]; then
+			echo "*** The un-annotated tag, $short_refname, is not allowed in this repository" >&2
+			echo "*** Use 'git tag [ -a | -s ]' for tags you want to propagate." >&2
+			exit 1
+		fi
+		;;
+	refs/tags/*,delete)
+		# delete tag
+		if [ "$allowdeletetag" != "true" ]; then
+			echo "*** Deleting a tag is not allowed in this repository" >&2
+			exit 1
+		fi
+		;;
+	refs/tags/*,tag)
+		# annotated tag
+		if [ "$allowmodifytag" != "true" ] && git rev-parse $refname > /dev/null 2>&1
+		then
+			echo "*** Tag '$refname' already exists." >&2
+			echo "*** Modifying a tag is not allowed in this repository." >&2
+			exit 1
+		fi
+		;;
+	refs/heads/*,commit)
+		# branch
+		if [ "$oldrev" = "$zero" -a "$denycreatebranch" = "true" ]; then
+			echo "*** Creating a branch is not allowed in this repository" >&2
+			exit 1
+		fi
+		;;
+	refs/heads/*,delete)
+		# delete branch
+		if [ "$allowdeletebranch" != "true" ]; then
+			echo "*** Deleting a branch is not allowed in this repository" >&2
+			exit 1
+		fi
+		;;
+	refs/remotes/*,commit)
+		# tracking branch
+		;;
+	refs/remotes/*,delete)
+		# delete tracking branch
+		if [ "$allowdeletebranch" != "true" ]; then
+			echo "*** Deleting a tracking branch is not allowed in this repository" >&2
+			exit 1
+		fi
+		;;
+	*)
+		# Anything else (is there anything else?)
+		echo "*** Update hook: unknown type of update to ref $refname of type $newrev_type" >&2
+		exit 1
+		;;
+esac
+
+# --- Finished
+exit 0
Binary file BSseeker2/.git/index has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/info/exclude	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,7 @@
+# git ls-files --others --exclude-from=.git/info/exclude
+# Lines that start with '#' are comments.
+# For a project mostly in C, the following would be a good set of
+# exclude patterns (uncomment them if you want to use them):
+# *.[oa]
+# *~
+.DS_Store
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/logs/HEAD	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,17 @@
+0000000000000000000000000000000000000000 6d252c627030a29eff9cc938f74c0be27ec853f0 Weilong Guo <weilong@Weilongs-MacBook-Pro.local> 1365490332 -0700	clone: from https://github.com/BSSeeker/BSseeker2.git
+6d252c627030a29eff9cc938f74c0be27ec853f0 565f548bc9a4ffcad63323481e8b03cb78a84b0a weilong <guoweilong@gmail.com> 1365495166 -0700	commit: update by Weilong
+565f548bc9a4ffcad63323481e8b03cb78a84b0a 1373f3c499ff4b6fb8ddff39e8859fa5326d0098 weilong <guoweilong@gmail.com> 1366217039 -0700	commit: Add version track;
+1373f3c499ff4b6fb8ddff39e8859fa5326d0098 ffe723a1f313914590bb10496b6d418d8a2ea614 weilong <guoweilong@gmail.com> 1366521472 -0700	commit: RRBS un-directional
+ffe723a1f313914590bb10496b6d418d8a2ea614 203e3ea9ba50c325d53e45f6d31686b6b23bba41 weilong <guoweilong@gmail.com> 1368857623 -0700	commit: Multiple-sites updates
+203e3ea9ba50c325d53e45f6d31686b6b23bba41 6aeb6fc0a2180cd14c59d772e05c4c3139f37f2e weilong <guoweilong@gmail.com> 1368872339 -0700	commit: Clean-up/Galaxy/Test_data
+6aeb6fc0a2180cd14c59d772e05c4c3139f37f2e 4a0fe7b0dfa14e5b4b62b5ead7a624f7361fee12 weilong <guoweilong@gmail.com> 1368872394 -0700	commit: Clean-up/galaxy/test_data
+4a0fe7b0dfa14e5b4b62b5ead7a624f7361fee12 3544b8bb1e5666d100f7652fc63b985187990e49 weilong <guoweilong@gmail.com> 1369030442 -0700	commit: Fix bug on utils.py; Increased version; Add UPDATE
+3544b8bb1e5666d100f7652fc63b985187990e49 39508bee8506ce06feead7599a53ffd09cc89198 weilong <guoweilong@gmail.com> 1369355033 -0700	commit: support diff indexes
+39508bee8506ce06feead7599a53ffd09cc89198 99e2633f8338b3c1f44cf3d1e2fa7ed5e3ce73ed weilong <guoweilong@gmail.com> 1369785459 -0700	commit: Update Readme
+99e2633f8338b3c1f44cf3d1e2fa7ed5e3ce73ed 823880bb2ebba5ae6bd1c7de7dfc4ce03935155b weilong <guoweilong@gmail.com> 1369876356 -0700	commit: fix bug in galaxy; chmod +x *.py
+823880bb2ebba5ae6bd1c7de7dfc4ce03935155b 7664a927ba6f12b023f6cd72dc407e616c5b85e5 weilong <guoweilong@gmail.com> 1370044685 -0700	commit: fix galaxy xml
+7664a927ba6f12b023f6cd72dc407e616c5b85e5 3c14c7a6fc9fd01ef7ffc3bc3b16153e20fda931 weilong <guoweilong@gmail.com> 1371202921 -0700	commit: fix bugs for RRBS tag
+3c14c7a6fc9fd01ef7ffc3bc3b16153e20fda931 58de749ac6ebe90f32db2c89cdd72507669695e2 weilong <guoweilong@gmail.com> 1371366774 -0700	commit: fix bugs for RRBS tag
+58de749ac6ebe90f32db2c89cdd72507669695e2 5ffa6c0f3f3d1b78e2899cc1ad9636affb5f2330 weilong <guoweilong@gmail.com> 1375139287 -0700	commit: v2.0.4
+5ffa6c0f3f3d1b78e2899cc1ad9636affb5f2330 0c877f0900535fbee6909dc1591e8ad0eac29c52 weilong <guoweilong@gmail.com> 1375307754 -0700	commit: fix a bug
+0c877f0900535fbee6909dc1591e8ad0eac29c52 85a936d6dab3f3c5585bcab2eee7b18bbc7d7fd8 weilong <guoweilong@gmail.com> 1383633776 +0800	commit: V2.0.5
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/logs/refs/heads/master	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,17 @@
+0000000000000000000000000000000000000000 6d252c627030a29eff9cc938f74c0be27ec853f0 Weilong Guo <weilong@Weilongs-MacBook-Pro.local> 1365490332 -0700	clone: from https://github.com/BSSeeker/BSseeker2.git
+6d252c627030a29eff9cc938f74c0be27ec853f0 565f548bc9a4ffcad63323481e8b03cb78a84b0a weilong <guoweilong@gmail.com> 1365495166 -0700	commit: update by Weilong
+565f548bc9a4ffcad63323481e8b03cb78a84b0a 1373f3c499ff4b6fb8ddff39e8859fa5326d0098 weilong <guoweilong@gmail.com> 1366217039 -0700	commit: Add version track;
+1373f3c499ff4b6fb8ddff39e8859fa5326d0098 ffe723a1f313914590bb10496b6d418d8a2ea614 weilong <guoweilong@gmail.com> 1366521472 -0700	commit: RRBS un-directional
+ffe723a1f313914590bb10496b6d418d8a2ea614 203e3ea9ba50c325d53e45f6d31686b6b23bba41 weilong <guoweilong@gmail.com> 1368857623 -0700	commit: Multiple-sites updates
+203e3ea9ba50c325d53e45f6d31686b6b23bba41 6aeb6fc0a2180cd14c59d772e05c4c3139f37f2e weilong <guoweilong@gmail.com> 1368872339 -0700	commit: Clean-up/Galaxy/Test_data
+6aeb6fc0a2180cd14c59d772e05c4c3139f37f2e 4a0fe7b0dfa14e5b4b62b5ead7a624f7361fee12 weilong <guoweilong@gmail.com> 1368872394 -0700	commit: Clean-up/galaxy/test_data
+4a0fe7b0dfa14e5b4b62b5ead7a624f7361fee12 3544b8bb1e5666d100f7652fc63b985187990e49 weilong <guoweilong@gmail.com> 1369030442 -0700	commit: Fix bug on utils.py; Increased version; Add UPDATE
+3544b8bb1e5666d100f7652fc63b985187990e49 39508bee8506ce06feead7599a53ffd09cc89198 weilong <guoweilong@gmail.com> 1369355033 -0700	commit: support diff indexes
+39508bee8506ce06feead7599a53ffd09cc89198 99e2633f8338b3c1f44cf3d1e2fa7ed5e3ce73ed weilong <guoweilong@gmail.com> 1369785459 -0700	commit: Update Readme
+99e2633f8338b3c1f44cf3d1e2fa7ed5e3ce73ed 823880bb2ebba5ae6bd1c7de7dfc4ce03935155b weilong <guoweilong@gmail.com> 1369876356 -0700	commit: fix bug in galaxy; chmod +x *.py
+823880bb2ebba5ae6bd1c7de7dfc4ce03935155b 7664a927ba6f12b023f6cd72dc407e616c5b85e5 weilong <guoweilong@gmail.com> 1370044685 -0700	commit: fix galaxy xml
+7664a927ba6f12b023f6cd72dc407e616c5b85e5 3c14c7a6fc9fd01ef7ffc3bc3b16153e20fda931 weilong <guoweilong@gmail.com> 1371202921 -0700	commit: fix bugs for RRBS tag
+3c14c7a6fc9fd01ef7ffc3bc3b16153e20fda931 58de749ac6ebe90f32db2c89cdd72507669695e2 weilong <guoweilong@gmail.com> 1371366774 -0700	commit: fix bugs for RRBS tag
+58de749ac6ebe90f32db2c89cdd72507669695e2 5ffa6c0f3f3d1b78e2899cc1ad9636affb5f2330 weilong <guoweilong@gmail.com> 1375139287 -0700	commit: v2.0.4
+5ffa6c0f3f3d1b78e2899cc1ad9636affb5f2330 0c877f0900535fbee6909dc1591e8ad0eac29c52 weilong <guoweilong@gmail.com> 1375307754 -0700	commit: fix a bug
+0c877f0900535fbee6909dc1591e8ad0eac29c52 85a936d6dab3f3c5585bcab2eee7b18bbc7d7fd8 weilong <guoweilong@gmail.com> 1383633776 +0800	commit: V2.0.5
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/logs/refs/remotes/origin/HEAD	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,1 @@
+0000000000000000000000000000000000000000 6d252c627030a29eff9cc938f74c0be27ec853f0 Weilong Guo <weilong@Weilongs-MacBook-Pro.local> 1365490332 -0700	clone: from https://github.com/BSSeeker/BSseeker2.git
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/logs/refs/remotes/origin/master	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,15 @@
+6d252c627030a29eff9cc938f74c0be27ec853f0 565f548bc9a4ffcad63323481e8b03cb78a84b0a weilong <guoweilong@gmail.com> 1365495210 -0700	push: fast forward
+565f548bc9a4ffcad63323481e8b03cb78a84b0a 1373f3c499ff4b6fb8ddff39e8859fa5326d0098 weilong <guoweilong@gmail.com> 1366217075 -0700	push: fast forward
+1373f3c499ff4b6fb8ddff39e8859fa5326d0098 ffe723a1f313914590bb10496b6d418d8a2ea614 weilong <guoweilong@gmail.com> 1366521489 -0700	update by push
+ffe723a1f313914590bb10496b6d418d8a2ea614 203e3ea9ba50c325d53e45f6d31686b6b23bba41 weilong <guoweilong@gmail.com> 1368857637 -0700	update by push
+203e3ea9ba50c325d53e45f6d31686b6b23bba41 4a0fe7b0dfa14e5b4b62b5ead7a624f7361fee12 weilong <guoweilong@gmail.com> 1368872449 -0700	update by push
+4a0fe7b0dfa14e5b4b62b5ead7a624f7361fee12 3544b8bb1e5666d100f7652fc63b985187990e49 weilong <guoweilong@gmail.com> 1369030453 -0700	update by push
+3544b8bb1e5666d100f7652fc63b985187990e49 39508bee8506ce06feead7599a53ffd09cc89198 weilong <guoweilong@gmail.com> 1369355040 -0700	update by push
+39508bee8506ce06feead7599a53ffd09cc89198 99e2633f8338b3c1f44cf3d1e2fa7ed5e3ce73ed weilong <guoweilong@gmail.com> 1369785465 -0700	update by push
+99e2633f8338b3c1f44cf3d1e2fa7ed5e3ce73ed 823880bb2ebba5ae6bd1c7de7dfc4ce03935155b weilong <guoweilong@gmail.com> 1369876368 -0700	update by push
+823880bb2ebba5ae6bd1c7de7dfc4ce03935155b 7664a927ba6f12b023f6cd72dc407e616c5b85e5 weilong <guoweilong@gmail.com> 1370044698 -0700	update by push
+7664a927ba6f12b023f6cd72dc407e616c5b85e5 3c14c7a6fc9fd01ef7ffc3bc3b16153e20fda931 weilong <guoweilong@gmail.com> 1371202931 -0700	update by push
+3c14c7a6fc9fd01ef7ffc3bc3b16153e20fda931 58de749ac6ebe90f32db2c89cdd72507669695e2 weilong <guoweilong@gmail.com> 1371366804 -0700	update by push
+58de749ac6ebe90f32db2c89cdd72507669695e2 5ffa6c0f3f3d1b78e2899cc1ad9636affb5f2330 weilong <guoweilong@gmail.com> 1375139295 -0700	update by push
+5ffa6c0f3f3d1b78e2899cc1ad9636affb5f2330 0c877f0900535fbee6909dc1591e8ad0eac29c52 weilong <guoweilong@gmail.com> 1375307762 -0700	update by push
+0c877f0900535fbee6909dc1591e8ad0eac29c52 85a936d6dab3f3c5585bcab2eee7b18bbc7d7fd8 weilong <guoweilong@gmail.com> 1383633798 +0800	update by push
Binary file BSseeker2/.git/objects/00/617de95ccde6a4587513924dd8c377c282372a has changed
Binary file BSseeker2/.git/objects/02/23d68962616c5035b8f8a49d09eb9fea3bd4d6 has changed
Binary file BSseeker2/.git/objects/02/bff5729f69b469b4ec5a1c6df7d83a0c3f84df has changed
Binary file BSseeker2/.git/objects/02/f21118110bf12e3995381d0b5388ecc39f396b has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/objects/04/bd24805dff9825629951311783935221cb83bf	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,4 @@
+x+)JMU054c040031Qp
ñð
+f˜wÿ}°ún±yê·¬‘ýüPì¡]0P‰¹©©‚[fNIjQPjbJ±^A%Ã>Yï™3‚Œ±ž›v<ÿõr±?,lmPÃ|<]ý‚]Jmzšðä‹Ð
+©Ûj›ÿ³‰C•¹:ºøºêå¦0Ô¥¼‰w8Ç}aq¼€×'sM#s‘mpE>®ŽÁ®ñ~þ!®Á÷Ÿ$.ž]攸tO®_£ƒÛ·ò/&@ TŸ˜“™žÇàõÍÿþôÊI2N‘Ï
礴œ>}b)\If^Jjƒ[ûû£7&8¶‹œ^œl!se³àdýWP)NMÍN-2Òò¥lVl•}RƒfNIw¸ÛzŸU*Zå˜Ê“J3sR@ÊÃ_nñaà-{Àëd¥¶fúòSvv`*ONÌɉÏM-ɨÌI,ÉÌÏé|³óùåÉÜ1Ñ3mJîóÜcm8ñîôÒ’Ìœb•¿ÿŸËh
+þ¹‘`ݺgÇ+ËNC•¤'æ$VT2(Nùi[Ó4«r}øjm£[ÿîCÌ(I-.‰OI,Id˜ÕÂð¼ý·|XÞÜ«ýYÁŒë¸ÉÌÝ
\ No newline at end of file
Binary file BSseeker2/.git/objects/08/a0832c5412197e32227afc7d6258f33e30c5b7 has changed
Binary file BSseeker2/.git/objects/0a/043f3a26f2ffb733bf9d53aa494fc82a50f3b8 has changed
Binary file BSseeker2/.git/objects/0b/a9fcc6f7d8306fdd778b555380015a7e13df2b has changed
Binary file BSseeker2/.git/objects/0c/7195e7ec701f0acea6d3068335b72f44ef6606 has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/objects/0c/877f0900535fbee6909dc1591e8ad0eac29c52	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,2 @@
+x•Ž[
+Â0EýÎ*fJ’É£·2™fb¡1RRtùöÃ
øqápàÀåÞÚ2Àšé4¶R ³gažØ%fÑȳ%‰sáXQ/ÚÊs€¡ÀZPp69NÅN)1šSÀ@"Ù‹EÔŠöñè¼Ë²ög…kÝûïµÑ²^¸·ŒuŒÞÁYG­Õa£ü_*Y>@÷ª¾z†Eí
\ No newline at end of file
Binary file BSseeker2/.git/objects/10/9a8400e787d00b1f566e9dd58f6a5301ae0b81 has changed
Binary file BSseeker2/.git/objects/11/35d4173810162c03f791537225d87a45b02f88 has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/objects/13/73f3c499ff4b6fb8ddff39e8859fa5326d0098	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,1 @@
+x•ËmÃ0DsfÛ€
þEÁA`§¥‚år¥Å€¦öÃCÈm0ƒÌ£ZJî }xéf¥&s$Òz¶”¤UFaœVéוØk9ñλÕÙiF;æ£
ŠC”†â0Ø(Qà£Ö?œ÷zlðº=ê_¾nó~¦ZÞ@ﵚ¤™á$')ÅhÇ¿Îÿ'Å-%xr»çz@oH_q#âvÜóv”¡p?ó,Ëû¯~¿ÞmWx
\ No newline at end of file
Binary file BSseeker2/.git/objects/15/910301bc200b6f069dd75caa81101064c2fccf has changed
Binary file BSseeker2/.git/objects/17/109affd07fb12192968a793a7f362231132b24 has changed
Binary file BSseeker2/.git/objects/18/3503abbe78455abef73ad3e1a9c7615414b8a8 has changed
Binary file BSseeker2/.git/objects/19/bf07adb9f50b72bc4fa40ffe059f17c84826fd has changed
Binary file BSseeker2/.git/objects/1d/6a5d7a3f6280296c748b5746af2cf97a242a77 has changed
Binary file BSseeker2/.git/objects/1d/953d2c1096b42550676cf3c89852b5e2effa91 has changed
Binary file BSseeker2/.git/objects/1f/6bef43eec7df888917650e5866ab1cc751fd72 has changed
Binary file BSseeker2/.git/objects/1f/b3a026502e7eb0b3e9a214424e7469c558fde1 has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/objects/20/3e3ea9ba50c325d53e45f6d31686b6b23bba41	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,1 @@
+x•ŽË	Ã0DsVjÀA«ÕÏBH+kåäÈØ2i?>¤œfxÙڲ”.5Â¥oÌ2¸œƬ٧D:±E"E^<’=—hâäÅJ¿»Ì™½F‚Œ€#;ªA™ÑE—„H390‚Žþj›üp©í=ËÛ|´_Ì•zÚr—€.ëF9(¯”8éù¯óÿ¦xµ—µò°—λ<ÖDgŠ/eK
\ No newline at end of file
Binary file BSseeker2/.git/objects/21/3194f9375d7c8c529a79af57ab482b32dafedf has changed
Binary file BSseeker2/.git/objects/21/bcf8cb4839f97e7a7074ffe2e0c9ae3055a3bc has changed
Binary file BSseeker2/.git/objects/24/fdfe57e71c2911fcd8603b85bcb8d8d4a6cbfd has changed
Binary file BSseeker2/.git/objects/29/092499eb76b2cb0ba9bca7f3ccf47105ee9ed9 has changed
Binary file BSseeker2/.git/objects/2b/7d900407635a6b75f21da06a1a139c68faec52 has changed
Binary file BSseeker2/.git/objects/2b/8c5b6fc86f2b12850ed17edbb1b53ab1cbd519 has changed
Binary file BSseeker2/.git/objects/2c/a16a8e6d59595ac5dafdbc161d0a6ee1feedd3 has changed
Binary file BSseeker2/.git/objects/2e/4fe35304a449115376c544fd24867f234c28e2 has changed
Binary file BSseeker2/.git/objects/2e/55629272ae40f146735bb1291638fd4c7d9955 has changed
Binary file BSseeker2/.git/objects/2e/c327624b0f8354842644929bdb34965e4dbaa4 has changed
Binary file BSseeker2/.git/objects/2f/442ab3a8839eba3367928f43c03a1690b57367 has changed
Binary file BSseeker2/.git/objects/2f/53aeee4fc5ee9dd458b8846c3b19385a3e3965 has changed
Binary file BSseeker2/.git/objects/32/2151f525a03b44f1baf8efa95b7a4b71ca9b6f has changed
Binary file BSseeker2/.git/objects/32/ab8243c9645f8083e7d11713e5f76dfb33b191 has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/objects/33/68604160305d798b0aa8a101857b39a16aab92	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,2 @@
+xŽA E]sй@
 1Æ3x¦•¤ÓR½¾ìÜ»ú??yùj)¹ºÈSÛ˜ÁŒ¹˜‚‹¬(¢2Ò{©Ðg}@
+^'gˆ¤x…×iÇ&¡&D$VÎûHcAáhÒź¨'Ÿ‰p´gÝ`>ê‡óR×®¿~ŸKÈË™j¹Á¨Q;…è-ÒJ)úÚÿ‹¿óΰSÝr?º¯ihuè¥&^ÄRR
\ No newline at end of file
Binary file BSseeker2/.git/objects/34/dfdab6463a8270332c510b91e669a40e7bde95 has changed
Binary file BSseeker2/.git/objects/35/44b8bb1e5666d100f7652fc63b985187990e49 has changed
Binary file BSseeker2/.git/objects/36/3573c4a1889f8a89136bea77502da4e4caf31d has changed
Binary file BSseeker2/.git/objects/36/e0c12ffea02da8b86f0eb70d13eb4bd1c5e52f has changed
Binary file BSseeker2/.git/objects/37/15a507ba242e7ffee322e83bb88495bffdfa84 has changed
Binary file BSseeker2/.git/objects/38/858de2e6dacf0ebf77379a9cb7a1f9115d1f58 has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/objects/39/508bee8506ce06feead7599a53ffd09cc89198	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,4 @@
+x•ŽQ
+à Dûí)ö-êªÉB)½JÔ5b‰¡=~ýèú7ó`xj)¹Öti;3mIb«|
+h=!1E“µRû^'#‹mÚym€Ö?z¯Ø:碒2
Îêz­"ɆÄt¶WÝáÍy©ë÷ù¬¿üœË”—[¨å
+a!ÂURŠNû¿Æÿ/Åqn[ÝÄœä5ò‡ñ½ßIH
\ No newline at end of file
Binary file BSseeker2/.git/objects/39/d7071eae44ec7b52c624a4b24c7c67101f1b68 has changed
Binary file BSseeker2/.git/objects/3a/fc1efb6bad2ca078808ac2df9006ca3ff82a8c has changed
Binary file BSseeker2/.git/objects/3b/4abe03399682b05bdffc0b5601127cbcf59234 has changed
Binary file BSseeker2/.git/objects/3b/f7e94c85fcc3d67cebd0e19a84bfc00aa8605f has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/objects/3c/14c7a6fc9fd01ef7ffc3bc3b16153e20fda931	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,1 @@
+x•ŽAjÃ0E»Ö)æ	#ÙÒØPBÈÜÌH#Õ`GÅ‘IŽ/zì>ïǺ®s×áWÛTA†˜ý„¼r­gìU¨ëù 6KˆcÊÖüñ¦÷BÏ£#á­t]1‘K±GÒ`Cô2xõ†÷ö[7xê¼Ô{ï²×ÿ}-+ÏË9Öõ¶#ëÐÎÂ		Ñôø×ôsÓäù²—ä£;M·h\ÌцI¶
\ No newline at end of file
Binary file BSseeker2/.git/objects/3c/274ddc1164d826c6e9dddb7faf80d5d31f894c has changed
Binary file BSseeker2/.git/objects/3e/976df32e78806e4ff93a8e75059abdd0ea7181 has changed
Binary file BSseeker2/.git/objects/3e/f678dd2144fe82b422f173440c6f31a3430286 has changed
Binary file BSseeker2/.git/objects/3f/cc7ab24c5c00cb2cfa7da07cb73427f00a6a93 has changed
Binary file BSseeker2/.git/objects/3f/cd4fd599b9ec2a2ebf8da4875fdee78051e7cd has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/objects/41/2eeda78dc9de1186c2e0e1526764af82ab3431	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,2 @@
+xu±N1†Y¹§°Ô­CXn@­:!Qµbõ“”‹£ÄA…§ÇW˜ŠñéÓûÿ‡ÈÜ?ÜÝ,à±	9q£€¸³€ÑUÀD]ñ\&xÚBÒcøB	œºåÅìQ¿vÝÖ­
+O .¼„Ú0ÂAî–«±Â<¼ïÇú†%+¬1Ípråäú–.Õ̅߯àÇ`@o™ô×ÔdÑX´ãT?ë)ˆÞ'o"a+çˆAK­6Ïk“«þǵ8±üV¾Þ4y&oòÝfkæ)âM¾?Zþ7ý}§ú
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/objects/41/ae40d93e4224bc6438f6ef14c15a2846138065	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,2 @@
+xŽM
+Â0„]ç¹€òòŸ€ˆn<€7xI_j mJLoowîÝ
Ã7“ê<—Î¥†CoDÜç(¤!‹!¢1Jëƒ%	ò&Û,2Y¶b£¥sK:¡ÃŽgÊk…’¤ÄhApŠáÖŸµñq«o*S]F~þåë8c™N©Î.”ÕÞ§?‚`{»_ìôטÝR¢	vâ÷2í–áð:­ö'M4
\ No newline at end of file
Binary file BSseeker2/.git/objects/41/c210ea7e3658ae2eb5d2da7be475da7d548894 has changed
Binary file BSseeker2/.git/objects/41/f0f93dc10a62d752d9ee5eb43effcd2dbe19fe has changed
Binary file BSseeker2/.git/objects/41/fc8bda8be2cb62409902674879a6ca93d84cc0 has changed
Binary file BSseeker2/.git/objects/43/5a4593e613fc1025f92891a8f08ac771ae1398 has changed
Binary file BSseeker2/.git/objects/46/87efc5d890418714cba363381cd4b311932fea has changed
Binary file BSseeker2/.git/objects/46/ebbc533f9479de561eefbf9feba9ce603e996c has changed
Binary file BSseeker2/.git/objects/49/738c43a9d49817fac7d108233edfa40af27bdb has changed
Binary file BSseeker2/.git/objects/4a/0fe7b0dfa14e5b4b62b5ead7a624f7361fee12 has changed
Binary file BSseeker2/.git/objects/4a/f64fdf97c823621c4259e7319c6484cbcbc8a5 has changed
Binary file BSseeker2/.git/objects/4c/b483bc8f85c2254f2f4adbddb13ca48d9d3048 has changed
Binary file BSseeker2/.git/objects/4d/9abcd6467711a66114b3115856cf2e1642b18f has changed
Binary file BSseeker2/.git/objects/4e/6d15d27856015a2bf2fd6e403759db1e9269d6 has changed
Binary file BSseeker2/.git/objects/4e/cf1ddb295944cf8b4b45aafeed8c19bd0f3b06 has changed
Binary file BSseeker2/.git/objects/50/cfd7aeafd7d1d2300fda58c59e2d329c26d798 has changed
Binary file BSseeker2/.git/objects/51/0ec79f82b6b5a087fd18a04fe11944f7aede94 has changed
Binary file BSseeker2/.git/objects/52/37b06ffa3a3f772f087c79e58746e1008813e9 has changed
Binary file BSseeker2/.git/objects/53/817ffe5f20347c0b6e705b574b2c6a95a93941 has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/objects/56/5f548bc9a4ffcad63323481e8b03cb78a84b0a	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,2 @@
+x•Ž[
+Â0EýÎ*fÊdÒLq~ç1©…Ö”’"îÞŠnÀ¿Ãý©ÎóØ€ˆm‘è5£ÉKqž;2—Hd£6‰É­]¯£ZÂ*œÉÒÇ£Á@^Jñ)yÓ×%ŒBNRoMA¶v¯+<eœêc€ó°Õ_‡9ŒÓ)ÕùÚ°í¼ÕÌpD‡¨v»ÿkò©¶%‡&_pûŽª7<óH…
\ No newline at end of file
Binary file BSseeker2/.git/objects/57/01e9b44c000d76e00d423a26ac97a7caa0b988 has changed
Binary file BSseeker2/.git/objects/57/4651a64fded0bcebcd52eacd9397255b092ce4 has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/objects/58/de749ac6ebe90f32db2c89cdd72507669695e2	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,2 @@
+x•ŽQjÃ0Dû­SìZ´^YkC!GHO°–wUClG¦9~ôÑæcx¼Ie]—
+ùº«Eê™R†ÑF¤8©0÷¾›%hHb„³{È®[JK´4ÚìQÍM-±'í¼Í2:9êOÙáW—{Ù2œòQþú%¯²Ü¿RYÏ€ÄÍ™|zöÞµµý«úÒÙò‚éÈO°æ½Ý®ßP%»7ŸGIÌ
\ No newline at end of file
Binary file BSseeker2/.git/objects/5c/0b7c08daea2343ab693b528c9714c68a539262 has changed
Binary file BSseeker2/.git/objects/5d/403497d5eefe3066c6cdfaeba14bc75c0b2939 has changed
Binary file BSseeker2/.git/objects/5d/63362d11c856e70be08fcf8c50eff99213c22d has changed
Binary file BSseeker2/.git/objects/5e/a242b9c8a60dcc9a4b9ac62e30c3260d11f697 has changed
Binary file BSseeker2/.git/objects/5e/bd21a16d61827ba9ee2b0353fbf6c8c8e88bca has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/objects/5f/fa6c0f3f3d1b78e2899cc1ad9636affb5f2330	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,2 @@
+x•Ž[
+Â0EýÎ*²Ëdòq+yLj¡i¤¤º}ûáü»8œ›{k˨ìeìÌL*hØR+´‰¬ÒJù I[D•SЩŠWÜyÒ†ÂÞPÌŽT%a”KñhÁ;GŽ,£ˆÇxö]~xYû6ËÛ|ôß~Ì-.ë”{»K¥ýY#^^Áˆ“žÿÿoŠ7N0ñtÖB
\ No newline at end of file
Binary file BSseeker2/.git/objects/62/17bbbf10fa50677a32ed961a0480ddf81dd833 has changed
Binary file BSseeker2/.git/objects/63/73d2e7c31f55f649b36f57ff12caafb94d8ca4 has changed
Binary file BSseeker2/.git/objects/64/88851c562de8e409fc4b2504e2a0f6f5796b06 has changed
Binary file BSseeker2/.git/objects/66/a096e1255b77248f631a5789db0d26e5009952 has changed
Binary file BSseeker2/.git/objects/66/c7e68f8a8e3653085c6259d202f9c740938a41 has changed
Binary file BSseeker2/.git/objects/66/d73645d397e073ef3f6591cc8e20889f863441 has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/objects/68/aefe44af07a6434b8d1289b3b51ec01e2d1d18	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,1 @@
+x+)JMU07e040031QˆÏÌË,‰×+¨d(á[‘jtcòBõ°û»O0YUVZ’™SRd¾!ÿ—•}¹>GMåÓv·‡Â/‰<ý
\ No newline at end of file
Binary file BSseeker2/.git/objects/68/bbb4104520295cd1bba6d38dc4c8ef557578e1 has changed
Binary file BSseeker2/.git/objects/6a/eb6fc0a2180cd14c59d772e05c4c3139f37f2e has changed
Binary file BSseeker2/.git/objects/6a/f6e8c4f3e98fbe0a3668cc0bd49b400f78c2b7 has changed
Binary file BSseeker2/.git/objects/6b/b6ae1a79da1e04586d6f3273b012fc995bf33f has changed
Binary file BSseeker2/.git/objects/6c/a474f44b26d591aab232bb4f543094f60662fa has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/objects/6d/252c627030a29eff9cc938f74c0be27ec853f0	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,2 @@
+xŽM
+Â0F]ç¹€2™´3ñ"¿5Ð))^ßîÜ»ûÞƒ_ì­Õ¡íil9kǘhdž°¤ØzãØ±% Œ1‚Qo¿å×Ð.bPfo`¢è©HIQØ à§AÈå÷ñì›^öþÉuí¯E_û¾4_×Kìí¦¥y¶ˆú {\ù¯X=zª¥æ¤¾í@Fà
\ No newline at end of file
Binary file BSseeker2/.git/objects/6d/84df45d981b431b64262b0f9fc1cb4fca7d424 has changed
Binary file BSseeker2/.git/objects/6e/4b91491dbf503844b132902207b10bb675a073 has changed
Binary file BSseeker2/.git/objects/6e/5dc58b1699ff1e665477c08becaf9435b42677 has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/objects/71/5f8471c2dc3e60e99dfc042aed1b46bb9cc095	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,1 @@
+x+)JMU04´d040031QˆÏÌË,‰×+¨d(á[‘jtcòBõ°û»O0YUVT”TŸTš™“R¨¸çÇiËŸuU%ÿ=8¹Î tñ¨Âòt„²ŒÝ[\4c.î^v¹÷ȉ÷¡¥Èc4
\ No newline at end of file
Binary file BSseeker2/.git/objects/71/860c94d65f6a776e5d62cdbb682d096bd7ced1 has changed
Binary file BSseeker2/.git/objects/71/af4f4bcb6d83a044fe02aff92802eb493274c4 has changed
Binary file BSseeker2/.git/objects/72/e59cf052f86f276e4667b637357f2e57e999e1 has changed
Binary file BSseeker2/.git/objects/74/0ea86532d893a100102756643fa0bbcac034a8 has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/objects/74/11c2b2e56b60e4f412a81af1b7607d83ff0617	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,5 @@
+x]RÝoÚ0ß³ÿŠO­”v£{ÚÞLbе ÇŒñ˜C¼…ÅN«þ÷»Щ“‘Ïw¿¯sÕ¹
+æóù·Oº5°–R[›Þ¸ÃÃ=c±;¿
öظ«ïáéËüéÿ¾Â¢x(Œùc†'HÌ‹éÜÙþ€w€¢_ãÍðbšGÆ6f8Yï­ëÁzhÍ`ª78eLÁa0Üê¶Ž&‚à ì߀0qÀU¡´½íPBzv†a¼;„×r0ØÜ@齫m‰xиz<™>”ø¶3îœ׉ÙýDÒ˜²c¶G4·+xµ¡uc€Áø0Øš0"°}Ý
i¸]wöd¯4>…ä*=: œ\cô5“­óXuÖ·4– «1`§§â”yD>>»¼é:†uO^ÿ©›z(Ìù¯yª¼¶îôщõì0=Rb(ØÑ8Œlbümê@R~p]ç^ÉZíúÆ’_ÿ1Weå^ÌäåòzPê÷´€IÄe«×+ß–ø*s
ymϨt³ƒîÆÊ\¼-;8»aâûß&¾½PäK½ãJ€,`£òŸ2	ÌxçY;©WùVv(žé=äKàÙ~È,‰@üÚ(Q+&×›T
+¬É,N·‰ÌžasYŽÏ]â;GP^¡¤À¹%¬…ŠWˆÌ2•z±¥Ôa.s6\ioS®`³U›¼HŸ l&³¥B±™~DV¬ø‰(V<M‰Šñ-ªW¤â|³Wòy¥a•§‰ÀâB 2¾HÅ…
+MÅ)—ë¾æÏ¤NAŽ(ŠQÛEìV‚JÄÇñk™gd#Î3­ð¡K¥ßGw²p%
+d©òuÄ(Nœ@tÁ¹L\P(ê) ÷`¶EÓ7-ž"®'û°>Üæ_¸Ÿew
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/objects/75/2b598979416c079bebe57d9dee4fc00d816a5d	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,3 @@
+xmSÑnÓ0å9_q•—µ‚FI»Câ!k»ihí`MB•S;©…cÛi—}=÷&Að@*G¾>÷ÜsÎÍ•É!‰“øUpšFq4ƒ	¬YÉÕ˜ÆÉ,H"¸‘Ï7%H
—ÊEuL#H9‡Ýçeš­ J=À%|jTÓv5g^Àã*]®WQÅa´…ÔÒK£Áf‹ÛŠÕP[1?&tjêÂÑ"Óøºñp>
+
Ú@Í,«„6˜õ¥ÂZcÁŠÚØ¡ªqR—p¶ÿkæîH÷V0î€)YjD¸Œ`}—Á½<ípŒ¯¤ÃÇØ˜Ì’ÿêænOøJì…æ(HØÁ‡º©raݾ¶ç©ß+ç¿Ç?àõGPBvZþjÄþæi¿˜fã]³Ÿ¢›”‹‚5ÊÿáÞÀµ9{)hÆAAR¤W±×¹‡›Ì90¥&¨Ê±U¬Sö,•£ÑŒƒÑÞO²DÎýÛy‹#Óeß}ͨ™´œ
+hÒ‰P_ç™æÌòÁ%òm›®;,QÁ—Mº^ÁÍ}z‹Bq7ÞFá-³^ò ‘d®ÕøÂÉÁ!gN ¾k‚}!?>^o¡°¬¬„öxkºV™Öwè>:rÍYYpÁ»>•DÆÏô~`ßMgrè
Â0̸͖»,xÁ¶©»,…Èhâ
	öÖ#¨¤9µºeŠ=·pB˜çàêïc©)´´T›La¶ú–&qa*‰s8Ð(*_ƃªA“¥õRæÜ¿¹Ûdƒ¬)ž‚!n«çp1©`~AˆtŠ£x~$¸´´É~«hÕDïs@¿ß Jƒ
\ No newline at end of file
Binary file BSseeker2/.git/objects/76/64a927ba6f12b023f6cd72dc407e616c5b85e5 has changed
Binary file BSseeker2/.git/objects/77/2dab1d09e09848fe92a238fc1413ac86b78e49 has changed
Binary file BSseeker2/.git/objects/77/5412491f6a25e65dfc8220fbb80afdee92e19d has changed
Binary file BSseeker2/.git/objects/78/f0cc2d5679fac527ded2d199b7723d2858a609 has changed
Binary file BSseeker2/.git/objects/7b/ded3bdfd5c7cde1ac7a66a94e83d4352632d5b has changed
Binary file BSseeker2/.git/objects/7c/2f8e591b0355cf96ad95f887ce43c9ad9b6ccb has changed
Binary file BSseeker2/.git/objects/7c/61cced8cd621d9b25c26438f9bb2270e9bdad2 has changed
Binary file BSseeker2/.git/objects/7c/ca75230355b000206fa058bb095903f55aa063 has changed
Binary file BSseeker2/.git/objects/7d/70d64ee9046b29c7a3bd6b8bf6f87813ab3bc6 has changed
Binary file BSseeker2/.git/objects/7e/5487ac62878708fcf58fcdb0fcd13acfc37b2f has changed
Binary file BSseeker2/.git/objects/7e/64ec5f40ce0bd0a35f104af23729323714b648 has changed
Binary file BSseeker2/.git/objects/82/3880bb2ebba5ae6bd1c7de7dfc4ce03935155b has changed
Binary file BSseeker2/.git/objects/82/ccc4a40d249856388e2a34e02f4ec42dce1b5f has changed
Binary file BSseeker2/.git/objects/83/93a0ab5e551d7c5221a1aee43d915a31a6bbd7 has changed
Binary file BSseeker2/.git/objects/84/06d09075408fde885ddfe8c4e183a75e0b959e has changed
Binary file BSseeker2/.git/objects/84/a6806795f21378c36629e61282f8bbaa95d9dc has changed
Binary file BSseeker2/.git/objects/84/c267bfba017386e573583b5190da45d513d274 has changed
Binary file BSseeker2/.git/objects/84/c8795a8d3adf0ee8bb820608886f1e833d70f3 has changed
Binary file BSseeker2/.git/objects/85/1f792a7fa3077c4a3b2053e7ece53db1e1b5d1 has changed
Binary file BSseeker2/.git/objects/85/a936d6dab3f3c5585bcab2eee7b18bbc7d7fd8 has changed
Binary file BSseeker2/.git/objects/86/5761b47a7c85b4d343beeb7c9c3ed640601ebf has changed
Binary file BSseeker2/.git/objects/86/fd03bf2e7dda2de53aa0a7292173a5bf2b4bc7 has changed
Binary file BSseeker2/.git/objects/87/6457ba39990e75afb27c7243da61fdd85bfdf3 has changed
Binary file BSseeker2/.git/objects/88/496377d81be7202c5a385ed7e5df52778c9f9d has changed
Binary file BSseeker2/.git/objects/8b/159869b8124569a96b7e4e841ea3658a75db57 has changed
Binary file BSseeker2/.git/objects/8d/30a2f0de740bd1cbe9346cf486bb360881e7b0 has changed
Binary file BSseeker2/.git/objects/8f/0dc7039482a4fed3a0f4ee6c0dae8e61f38d91 has changed
Binary file BSseeker2/.git/objects/8f/586f3d54f92f4c295f1090fc15e61d3788c4fd has changed
Binary file BSseeker2/.git/objects/8f/640235eeddfaf50d208e68adf6e08ff96348fb has changed
Binary file BSseeker2/.git/objects/8f/b12719f1dba55da26896e09c090e385f6f1fe6 has changed
Binary file BSseeker2/.git/objects/91/2dad6a9bcc2294cd04131ab7f06ffce58435c5 has changed
Binary file BSseeker2/.git/objects/91/2ef7d6168979afb5b56ed40120b4c620809da7 has changed
Binary file BSseeker2/.git/objects/92/1edcff26ba7b7f7a2d6f2cedece007e8006c9d has changed
Binary file BSseeker2/.git/objects/94/29632a76fafb840eeddf179810a2e8cfc18b44 has changed
Binary file BSseeker2/.git/objects/94/a9ed024d3859793618152ea559a168bbcbb5e2 has changed
Binary file BSseeker2/.git/objects/95/1e8892050fa8255989993946a403d42dba05a2 has changed
Binary file BSseeker2/.git/objects/97/02043009a1c30882ee8efd386919b9775419c8 has changed
Binary file BSseeker2/.git/objects/97/2d65097162fdbd73a19797366806e2b72c0861 has changed
Binary file BSseeker2/.git/objects/97/bb6dd7f2cf43da4acb857b2d048ec87cb996e1 has changed
Binary file BSseeker2/.git/objects/99/9c2eacdd1b0da3bd211cbfa7e83183e3ae1ab0 has changed
Binary file BSseeker2/.git/objects/99/e2633f8338b3c1f44cf3d1e2fa7ed5e3ce73ed has changed
Binary file BSseeker2/.git/objects/9a/5920e30c012e1eba7a20047f4f85a48ecab04c has changed
Binary file BSseeker2/.git/objects/9c/2b8bf5a1046ca6f8fdc87146c8600a4c0b863b has changed
Binary file BSseeker2/.git/objects/9c/390872015d7873ebd00a98d32bbc5913414730 has changed
Binary file BSseeker2/.git/objects/9d/2bc37995bb4a9434575616e95201c82fd08e02 has changed
Binary file BSseeker2/.git/objects/9d/dd63485ec0ed6f3a7b0bd65593580ad8e18b41 has changed
Binary file BSseeker2/.git/objects/9e/dfef5327bb169e27dac0a8541df3e116e13e53 has changed
Binary file BSseeker2/.git/objects/a3/dc53707171c1390211069269899dd310e00210 has changed
Binary file BSseeker2/.git/objects/a4/01ac91383e16c013d76a4db4f4fc8a7bfe38b4 has changed
Binary file BSseeker2/.git/objects/a4/bfd08fca2bffe134f8499cd0b89002bcb8fd1c has changed
Binary file BSseeker2/.git/objects/a9/4159479577e1278a51348d1b2e7e29c5dc24f0 has changed
Binary file BSseeker2/.git/objects/ac/61e2ad7235c9b954450e267b95134404f60521 has changed
Binary file BSseeker2/.git/objects/ac/9fbd06659e06888188b5640e990f10720d0112 has changed
Binary file BSseeker2/.git/objects/ae/8a4ec09c62f840326244374ad5a5bfdf226bd6 has changed
Binary file BSseeker2/.git/objects/b4/84357be80aac412aa1f7ccb9e45290a22303d8 has changed
Binary file BSseeker2/.git/objects/b4/cbc789c9cded56c331d9c262444d0cbe58e3ff has changed
Binary file BSseeker2/.git/objects/b5/758231ef4f42621409676e9e6450a3a5885e5b has changed
Binary file BSseeker2/.git/objects/b6/26f4a52659a967b6132ad32a2e9071e6a1b004 has changed
Binary file BSseeker2/.git/objects/b7/171c2f1b920b16ac41198a6b0af1dc2c2c9e78 has changed
Binary file BSseeker2/.git/objects/b7/1b2be06f002551f619fca2db129a4284a32cd0 has changed
Binary file BSseeker2/.git/objects/b7/7b6e04c2f0d6cf0ff5662b8150b4cccacfeaf4 has changed
Binary file BSseeker2/.git/objects/b8/cf58db75eaf9a015a04eb734d756b1fb6c9df1 has changed
Binary file BSseeker2/.git/objects/b9/1997bb3d05bfaa2d85ca71ac327cd03f4fb644 has changed
Binary file BSseeker2/.git/objects/b9/8d98f275842e593aea9330a37de9e0fbcae1d5 has changed
Binary file BSseeker2/.git/objects/ba/0a63e17eb6f573cccbbd1d33cf149a3a66f306 has changed
Binary file BSseeker2/.git/objects/bb/9c3276c3158ae9eda8a517bb7f5f2561eafe1c has changed
Binary file BSseeker2/.git/objects/bc/1f424a3b8c4947e3bf03cd2af76a3c1446144e has changed
Binary file BSseeker2/.git/objects/bc/a097526f847079098d7dfa48905c6a446b721c has changed
Binary file BSseeker2/.git/objects/be/1d4b99985233fa05ce96c76feba716fc040686 has changed
Binary file BSseeker2/.git/objects/be/f543ff7089d4909c2386d8ceed3cae32e7a7fd has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/objects/bf/0578826f7cc94414b5132218481f4b3b97821a	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,1 @@
+x­TßkÛ0ÞküWYm"«qVðÃ++t,…=´!(µÒˆÚ–ä•ô¯ßI²Ûx[ØÃ&HìÓÝ}÷ݧ“×µZCqVœ¾‘VÆuF¶ÖÏ'6²²Õ£`·¢þ!(8Ùà¿íÖÚ¨{a-ÃÛJ5ÉÆ¨æ5z¸KD¸òÑÿš7,”mÒGã»áN™¬´ÓÜX1„~ÓNªvá·L<JØßM³¤w0+ܪÞÕΦ¾–7¢$ß?Íç'×k¸ÖØ'Ɇx^U+,ˆR’o’ç>
ßÜNcfÍJXW’’PF—$Èä7[¸¼ºþŒ‘pü7%	önš»mäÆŽÐÑ‘Ž<Dg@Ñ>ã…Çâãͬ‘¤±S<<nl†*F9Yx¬ü&J	¿­¤ÙùWoÁ%PI·-‡ÝP’¼Íÿq%ªs¾HIŒ¨º{Qåd¶G$¸±®hS_tÖGSò„­n”Z¶8Cíëp²pX1z(»H&u飙յt(Áă±'#HÉÔÞ¹ø#ÓÇ!­oO—­oÏ—4šy±Ì²¹k}edê°ûZY`k0þƒ,FV¥¯/ óÙº´˜‡E?Ä•yêJ˜¢$7_«‘v3‚6â$I¸‡éQ«¶†æ±’¦ަQ¥!£þ3P—7¦8F?x‰Šr”¬wn«ZèLï _Ãyà¹vŒ¸ù#ø•z±oçg(£§Ìó‹âý2#¾¼ÇÕjjáAÃd¿œ4ìâŸ)²'tܧi ÿ{Ÿ£î0‰½õÃ6f”ðð,õ(å ÙÉdògZÅ£
\ No newline at end of file
Binary file BSseeker2/.git/objects/c0/55d46bb9f3cb38f09ec5e4cff4130dd8671898 has changed
Binary file BSseeker2/.git/objects/c1/817fa1138e147fefc7c95af925ec76cc97fe23 has changed
Binary file BSseeker2/.git/objects/c2/44909e51bfc35b939e9db343f5502b39ea1dde has changed
Binary file BSseeker2/.git/objects/c4/35e1564497baba3aa70cea8b03c5173dd767d1 has changed
Binary file BSseeker2/.git/objects/c6/420c84ecc2892b8de9ef79ac41f561839aa8f5 has changed
Binary file BSseeker2/.git/objects/c7/08088d803509f61713c367d1ba3139c61e466b has changed
Binary file BSseeker2/.git/objects/c7/6ec688d38ceaf396c842592f18c0d97f295ea8 has changed
Binary file BSseeker2/.git/objects/c7/b134d0bd0420393ed72c961d8a2d85de8de6d8 has changed
Binary file BSseeker2/.git/objects/c8/323117348c23bea8440d5f50a483f544b01b8d has changed
Binary file BSseeker2/.git/objects/c9/6c477f7ac888f641c2b601920ef741523b94c2 has changed
Binary file BSseeker2/.git/objects/ca/95bc33a08c4e9bbc99ade9de8ecc875306fdc5 has changed
Binary file BSseeker2/.git/objects/ce/46247e9f5a37f638a53b8a1ded67a629fae840 has changed
Binary file BSseeker2/.git/objects/ce/f06629065737ee12b7f273b8b3ed3b4ac8b7e5 has changed
Binary file BSseeker2/.git/objects/cf/92584d96edb4a3b499fff3d557eea5c34fef2c has changed
Binary file BSseeker2/.git/objects/d0/58b66d33091deedbd911a4159cc2952784f1df has changed
Binary file BSseeker2/.git/objects/d1/f7f34453e3025a3867c973b6987c34e0b31b55 has changed
Binary file BSseeker2/.git/objects/d2/5e5f86e89284405516e24d41d1bb27688e7347 has changed
Binary file BSseeker2/.git/objects/d3/a7114a0984f878bf7d17774d2ce85e2eb240ba has changed
Binary file BSseeker2/.git/objects/d4/cae6a4f8fac1506dedaf53fa4279c66f730ce0 has changed
Binary file BSseeker2/.git/objects/d5/fbd40fdd677155773dc935bff7f4980db345fe has changed
Binary file BSseeker2/.git/objects/d9/67f3295a240312118ad48a7dff28eff2ae4c28 has changed
Binary file BSseeker2/.git/objects/da/e85a8d63775a001a4f14c4b5abf233b8b65f67 has changed
Binary file BSseeker2/.git/objects/dd/bd82ab95d51adc1ce4e1f0094be1885344ecf6 has changed
Binary file BSseeker2/.git/objects/dd/d8783f63a7b6c3b51a73597fe0d2b7c8f5fa35 has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/objects/de/51e461a39b764261a5bc6d4e7a014046f677f4	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,2 @@
+xMÏÍJÄ0`×yŠÃ¬4LÓÁÁe±U+"HÍmH“Ǿ½-ãÂÍÙÜÃw9½q=ÄýñŠ}¾ç%îÐÊÅÃ-ľ(YÁñ¤ÐçÚ"'m"÷•R8}ÔU×`ІØ8¬Àk6Ä?áä•L„ϦªÛ†Ï
+×5
Ú꤅Puϳô\˜eºÙôíiš»wgi—“Ï	ç‰,¬ƒ—AΔ(°òR¥\@ ïÂ_+GmGœƒ[ÓË4m8â´ÝI!í*8Ú—oú‹l\g0ö°tSõ
\ No newline at end of file
Binary file BSseeker2/.git/objects/de/9d33fcba71782f03c7695b87bacb6b0b80e6aa has changed
Binary file BSseeker2/.git/objects/e0/7397a0fdcb0bb86dcd2c7d9fa3ab121b1717af has changed
Binary file BSseeker2/.git/objects/e6/9de29bb2d1d6434b8b29ae775ad8c2e48c5391 has changed
Binary file BSseeker2/.git/objects/e8/f9d7a9ef29943d91dc44ec39f2941cf5d308af has changed
Binary file BSseeker2/.git/objects/ea/96cb7439184335f7bb1680aa7fdc58f82cdd57 has changed
Binary file BSseeker2/.git/objects/ea/a930cc269c8b99fd6bd56c518de13ee2e50665 has changed
Binary file BSseeker2/.git/objects/eb/0e225d8aafcc0a0c58bfe0819a863d78d049fd has changed
Binary file BSseeker2/.git/objects/eb/7a5764d926f8460d2874ee382c135c0a6cd38e has changed
Binary file BSseeker2/.git/objects/ec/b9e7d3930b5c5b91693c74df0cdb560580c8fd has changed
Binary file BSseeker2/.git/objects/ec/d952bec69ea1164d94471964ac7269052c3992 has changed
Binary file BSseeker2/.git/objects/ee/314b81826a271f96a65ca1b4249a71843ca393 has changed
Binary file BSseeker2/.git/objects/ee/5f622335ab9431565c0eb9dfbaa7c39249a9bf has changed
Binary file BSseeker2/.git/objects/ee/b91603db0ff79641cd6fb225b13c627a11781b has changed
Binary file BSseeker2/.git/objects/ef/532a4f1428f5e19739afae006caf6c0bc705d7 has changed
Binary file BSseeker2/.git/objects/ef/5c83956056aed85fcbbc2bacd9b544ce3accad has changed
Binary file BSseeker2/.git/objects/f0/67aeca9b0da754061ab0ccc58a6c2d14b5ac81 has changed
Binary file BSseeker2/.git/objects/f2/86983cf69da7511f3921cd9a6a8d640e29b9bb has changed
Binary file BSseeker2/.git/objects/f2/8faa1d516a9da3841ab8e21aecef5abbfb37a3 has changed
Binary file BSseeker2/.git/objects/f8/2057db16b606422bc239ac5d0218efc63584f3 has changed
Binary file BSseeker2/.git/objects/f9/585ea347c6c0d42ecb8b9e1cc774fdff81ba04 has changed
Binary file BSseeker2/.git/objects/fc/38e4d63c666ce2899bc1baa2614d578b3f9d4c has changed
Binary file BSseeker2/.git/objects/fc/c2e4790d67031d58ee3ca7796bc4825d1077a5 has changed
Binary file BSseeker2/.git/objects/fd/ca7708027c72c081c0d48d257d84ce5d5a6c24 has changed
Binary file BSseeker2/.git/objects/fe/3af2b9748dd0594f9caedc5ce446f72d758f56 has changed
Binary file BSseeker2/.git/objects/ff/e723a1f313914590bb10496b6d418d8a2ea614 has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/packed-refs	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,2 @@
+# pack-refs with: peeled 
+6d252c627030a29eff9cc938f74c0be27ec853f0 refs/remotes/origin/master
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/refs/heads/master	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,1 @@
+85a936d6dab3f3c5585bcab2eee7b18bbc7d7fd8
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/refs/remotes/origin/HEAD	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,1 @@
+ref: refs/remotes/origin/master
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.git/refs/remotes/origin/master	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,1 @@
+85a936d6dab3f3c5585bcab2eee7b18bbc7d7fd8
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.idea/.name	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,1 @@
+BSseeker2
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.idea/BSseeker2.iml	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,9 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<module type="PYTHON_MODULE" version="4">
+  <component name="NewModuleRootManager">
+    <content url="file://$MODULE_DIR$" />
+    <orderEntry type="inheritedJdk" />
+    <orderEntry type="sourceFolder" forTests="false" />
+  </component>
+</module>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.idea/encodings.xml	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<project version="4">
+  <component name="Encoding" useUTFGuessing="true" native2AsciiForPropertiesFiles="false" />
+</project>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.idea/misc.xml	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<project version="4">
+  <component name="ProjectRootManager" version="2" project-jdk-name="Python 2.7.2 (/System/Library/Frameworks/Python.framework/Versions/2.7/bin/python)" project-jdk-type="Python SDK" />
+</project>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.idea/modules.xml	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,9 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<project version="4">
+  <component name="ProjectModuleManager">
+    <modules>
+      <module fileurl="file://$PROJECT_DIR$/.idea/BSseeker2.iml" filepath="$PROJECT_DIR$/.idea/BSseeker2.iml" />
+    </modules>
+  </component>
+</project>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.idea/other.xml	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,7 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<project version="4">
+  <component name="PyDocumentationSettings">
+    <option name="myDocStringFormat" value="Plain" />
+  </component>
+</project>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.idea/scopes/scope_settings.xml	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,5 @@
+<component name="DependencyValidationManager">
+  <state>
+    <option name="SKIP_IMPORT_STATEMENTS" value="false" />
+  </state>
+</component>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.idea/testrunner.xml	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,8 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<project version="4">
+  <component name="TestRunnerService">
+    <option name="projectConfiguration" value="Unittests" />
+    <option name="PROJECT_TEST_RUNNER" value="Unittests" />
+  </component>
+</project>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.idea/vcs.xml	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,7 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<project version="4">
+  <component name="VcsDirectoryMappings">
+    <mapping directory="$PROJECT_DIR$" vcs="Git" />
+  </component>
+</project>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BSseeker2/.idea/workspace.xml	Tue Nov 05 01:55:39 2013 -0500
@@ -0,0 +1,644 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<project version="4">
+  <component name="ChangeListManager">
+    <list default="true" id="172bd281-b8c2-4544-b510-26029a6498b7" name="Default" comment="" />
+    <ignored path="BSseeker2.iws" />
+    <ignored path=".idea/workspace.xml" />
+    <file path="/Dummy.txt" changelist="172bd281-b8c2-4544-b510-26029a6498b7" time="1383633767371" ignored="false" />
+    <file path="/a.py" changelist="172bd281-b8c2-4544-b510-26029a6498b7" time="1365491538292" ignored="false" />
+    <file path="/bs_rrbs.py" changelist="172bd281-b8c2-4544-b510-26029a6498b7" time="1383621399873" ignored="false" />
+    <file path="/bs_pair_end.py" changelist="172bd281-b8c2-4544-b510-26029a6498b7" time="1383622148043" ignored="false" />
+    <file path="/bs_single_end.py" changelist="172bd281-b8c2-4544-b510-26029a6498b7" time="1383571511133" ignored="false" />
+    <file path="/bs_align_utils.py" changelist="172bd281-b8c2-4544-b510-26029a6498b7" time="1381998901080" ignored="false" />
+    <file path="/rrbs_build.py" changelist="172bd281-b8c2-4544-b510-26029a6498b7" time="1367304455503" ignored="false" />
+    <file path="/utils.py" changelist="172bd281-b8c2-4544-b510-26029a6498b7" time="1383633738005" ignored="false" />
+    <file path="/README.md" changelist="172bd281-b8c2-4544-b510-26029a6498b7" time="1383632256060" ignored="false" />
+    <file path="/bs_seeker2-align.py" changelist="172bd281-b8c2-4544-b510-26029a6498b7" time="1383632641037" ignored="false" />
+    <file path="/bs_seeker2-build.py" changelist="172bd281-b8c2-4544-b510-26029a6498b7" time="1383632528537" ignored="false" />
+    <file path="/bs_seeker2-call_methylation.py" changelist="172bd281-b8c2-4544-b510-26029a6498b7" time="1377909319118" ignored="false" />
+    <file path="/rrbs_build_new.py" changelist="172bd281-b8c2-4544-b510-26029a6498b7" time="1366402518261" ignored="false" />
+    <file path="/bs_rrbs_new.py" changelist="172bd281-b8c2-4544-b510-26029a6498b7" time="1366448702885" ignored="false" />
+    <file path="$APPLICATION_HOME_DIR$/lib/pycharm.jar!/resources/relaxng.rng" changelist="172bd281-b8c2-4544-b510-26029a6498b7" time="1366311004094" ignored="false" />
+    <file path="/wg_build.py" changelist="172bd281-b8c2-4544-b510-26029a6498b7" time="1383623123179" ignored="false" />
+    <file path="/bs_seeker2_wrapper.py" changelist="172bd281-b8c2-4544-b510-26029a6498b7" time="1368857835824" ignored="false" />
+    <file path="/bs_seeker2_wrapper.xml" changelist="172bd281-b8c2-4544-b510-26029a6498b7" time="1382083103094" ignored="false" />
+    <file path="/UPDATE" changelist="172bd281-b8c2-4544-b510-26029a6498b7" time="1369021897154" ignored="false" />
+    <file path="/RELEASE_NOTES" changelist="172bd281-b8c2-4544-b510-26029a6498b7" time="1383630679572" ignored="false" />
+    <file path="/output.py" changelist="172bd281-b8c2-4544-b510-26029a6498b7" time="1382096328368" ignored="false" />
+    <file path="/bs_pair_end2.py" changelist="172bd281-b8c2-4544-b510-26029a6498b7" time="1382863836790" ignored="false" />
+    <file path="/bs_pair_end_2.py" changelist="172bd281-b8c2-4544-b510-26029a6498b7" time="1383060615712" ignored="false" />
+    <option name="TRACKING_ENABLED" value="true" />
+    <option name="SHOW_DIALOG" value="false" />
+    <option name="HIGHLIGHT_CONFLICTS" value="true" />
+    <option name="HIGHLIGHT_NON_ACTIVE_CHANGELIST" value="false" />
+    <option name="LAST_RESOLUTION" value="IGNORE" />
+  </component>
+  <component name="ChangesViewManager" flattened_view="true" show_ignored="false" />
+  <component name="CreatePatchCommitExecutor">
+    <option name="PATCH_PATH" value="" />
+  </component>
+  <component name="DaemonCodeAnalyzer">
+    <disable_hints />
+  </component>
+  <component name="ExecutionTargetManager" SELECTED_TARGET="default_target" />
+  <component name="FavoritesManager">
+    <favorites_list name="BSseeker2">
+      <favorite_root url="file://$PROJECT_DIR$/gpl-3.0.txt" type="psiFile" klass="com.intellij.ide.projectView.impl.nodes.PsiFileNode" />
+    </favorites_list>
+  </component>
+  <component name="FileEditorManager">
+    <leaf>
+      <file leaf-file-name="README.md" pinned="false" current="false" current-in-tab="false">
+        <entry file="file://$PROJECT_DIR$/README.md">
+          <provider selected="true" editor-type-id="text-editor">
+            <state line="77" column="25" selection-start="2888" selection-end="2895" vertical-scroll-proportion="-7.92">
+              <folding />
+            </state>
+          </provider>
+        </entry>
+      </file>
+      <file leaf-file-name="utils.py" pinned="false" current="true" current-in-tab="true">
+        <entry file="file://$PROJECT_DIR$/bs_utils/utils.py">
+          <provider selected="true" editor-type-id="text-editor">
+            <state line="14" column="0" selection-start="176" selection-end="176" vertical-scroll-proportion="0.16103059">
+              <folding />
+            </state>
+          </provider>
+        </entry>
+      </file>
+    </leaf>
+  </component>
+  <component name="FindManager">
+    <FindUsagesManager>
+      <setting name="OPEN_NEW_TAB" value="false" />
+    </FindUsagesManager>
+  </component>
+  <component name="Git.Settings">
+    <option name="RECENT_GIT_ROOT_PATH" value="$PROJECT_DIR$" />
+  </component>
+  <component name="GitLogSettings">
+    <option name="myDateState">
+      <MyDateState />
+    </option>
+  </component>
+  <component name="IdeDocumentHistory">
+    <option name="changedFiles">
+      <list>
+        <option value="$PROJECT_DIR$/bs_align/bs_align_utils.py" />
+        <option value="$PROJECT_DIR$/galaxy/bs_seeker2_wrapper.py" />
+        <option value="$PROJECT_DIR$/galaxy/bs_seeker2_wrapper.xml" />
+        <option value="$PROJECT_DIR$/bs_align/output.py" />
+        <option value="$PROJECT_DIR$/bs_align/bs_pair_end2.py" />
+        <option value="$PROJECT_DIR$/bs_align/bs_pair_end_2.py" />
+        <option value="$PROJECT_DIR$/bs_align/bs_rrbs.py" />
+        <option value="$PROJECT_DIR$/bs_align/bs_single_end.py" />
+        <option value="$PROJECT_DIR$/bs_align/bs_pair_end.py" />
+        <option value="$PROJECT_DIR$/bs_index/wg_build.py" />
+        <option value="$PROJECT_DIR$/bs_seeker2-call_methylation.py" />
+        <option value="$PROJECT_DIR$/RELEASE_NOTES" />
+        <option value="$PROJECT_DIR$/bs_seeker2-build.py" />
+        <option value="$PROJECT_DIR$/bs_seeker2-align.py" />
+        <option value="$PROJECT_DIR$/README.md" />
+        <option value="$PROJECT_DIR$/bs_utils/utils.py" />
+      </list>
+    </option>
+  </component>
+  <component name="ProjectFrameBounds">
+    <option name="x" value="53" />
+    <option name="y" value="22" />
+    <option name="width" value="1226" />
+    <option name="height" value="778" />
+  </component>
+  <component name="ProjectLevelVcsManager" settingsEditedManually="false">
+    <OptionsSetting value="true" id="Add" />
+    <OptionsSetting value="true" id="Remove" />
+    <OptionsSetting value="true" id="Checkout" />
+    <OptionsSetting value="true" id="Update" />
+    <OptionsSetting value="true" id="Status" />
+    <OptionsSetting value="true" id="Edit" />
+    <ConfirmationsSetting value="0" id="Add" />
+    <ConfirmationsSetting value="0" id="Remove" />
+  </component>
+  <component name="ProjectReloadState">
+    <option name="STATE" value="0" />
+  </component>
+  <component name="ProjectView">
+    <navigator currentView="ProjectPane" proportions="" version="1" splitterProportion="0.5">
+      <flattenPackages />
+      <showMembers />
+      <showModules />
+      <showLibraryContents />
+      <hideEmptyPackages />
+      <abbreviatePackageNames />
+      <autoscrollToSource />
+      <autoscrollFromSource />
+      <sortByType />
+    </navigator>
+    <panes>
+      <pane id="Scope" />
+      <pane id="ProjectPane">
+        <subPane>
+          <PATH>
+            <PATH_ELEMENT>
+              <option name="myItemId" value="BSseeker2" />
+              <option name="myItemType" value="com.intellij.ide.projectView.impl.nodes.ProjectViewProjectNode" />
+            </PATH_ELEMENT>
+          </PATH>
+          <PATH>
+            <PATH_ELEMENT>
+              <option name="myItemId" value="BSseeker2" />
+              <option name="myItemType" value="com.intellij.ide.projectView.impl.nodes.ProjectViewProjectNode" />
+            </PATH_ELEMENT>
+            <PATH_ELEMENT>
+              <option name="myItemId" value="BSseeker2" />
+              <option name="myItemType" value="com.intellij.ide.projectView.impl.nodes.PsiDirectoryNode" />
+            </PATH_ELEMENT>
+          </PATH>
+          <PATH>
+            <PATH_ELEMENT>
+              <option name="myItemId" value="BSseeker2" />
+              <option name="myItemType" value="com.intellij.ide.projectView.impl.nodes.ProjectViewProjectNode" />
+            </PATH_ELEMENT>
+            <PATH_ELEMENT>
+              <option name="myItemId" value="BSseeker2" />
+              <option name="myItemType" value="com.intellij.ide.projectView.impl.nodes.PsiDirectoryNode" />
+            </PATH_ELEMENT>
+            <PATH_ELEMENT>
+              <option name="myItemId" value="galaxy" />
+              <option name="myItemType" value="com.intellij.ide.projectView.impl.nodes.PsiDirectoryNode" />
+            </PATH_ELEMENT>
+          </PATH>
+          <PATH>
+            <PATH_ELEMENT>
+              <option name="myItemId" value="BSseeker2" />
+              <option name="myItemType" value="com.intellij.ide.projectView.impl.nodes.ProjectViewProjectNode" />
+            </PATH_ELEMENT>
+            <PATH_ELEMENT>
+              <option name="myItemId" value="BSseeker2" />
+              <option name="myItemType" value="com.intellij.ide.projectView.impl.nodes.PsiDirectoryNode" />
+            </PATH_ELEMENT>
+            <PATH_ELEMENT>
+              <option name="myItemId" value="bs_utils" />
+              <option name="myItemType" value="com.intellij.ide.projectView.impl.nodes.PsiDirectoryNode" />
+            </PATH_ELEMENT>
+          </PATH>
+          <PATH>
+            <PATH_ELEMENT>
+              <option name="myItemId" value="BSseeker2" />
+              <option name="myItemType" value="com.intellij.ide.projectView.impl.nodes.ProjectViewProjectNode" />
+            </PATH_ELEMENT>
+            <PATH_ELEMENT>
+              <option name="myItemId" value="BSseeker2" />
+              <option name="myItemType" value="com.intellij.ide.projectView.impl.nodes.PsiDirectoryNode" />
+            </PATH_ELEMENT>
+            <PATH_ELEMENT>
+              <option name="myItemId" value="bs_index" />
+              <option name="myItemType" value="com.intellij.ide.projectView.impl.nodes.PsiDirectoryNode" />
+            </PATH_ELEMENT>
+          </PATH>
+          <PATH>
+            <PATH_ELEMENT>
+              <option name="myItemId" value="BSseeker2" />
+              <option name="myItemType" value="com.intellij.ide.projectView.impl.nodes.ProjectViewProjectNode" />
+            </PATH_ELEMENT>
+            <PATH_ELEMENT>
+              <option name="myItemId" value="BSseeker2" />
+              <option name="myItemType" value="com.intellij.ide.projectView.impl.nodes.PsiDirectoryNode" />
+            </PATH_ELEMENT>
+            <PATH_ELEMENT>
+              <option name="myItemId" value="bs_align" />
+              <option name="myItemType" value="com.intellij.ide.projectView.impl.nodes.PsiDirectoryNode" />
+            </PATH_ELEMENT>
+          </PATH>
+        </subPane>
+      </pane>
+    </panes>
+  </component>
+  <component name="PropertiesComponent">
+    <property name="options.splitter.main.proportions" value="0.3" />
+    <property name="WebServerToolWindowFactoryState" value="false" />
+    <property name="recentsLimit" value="5" />
+    <property name="options.lastSelected" value="reference.settingsdialog.IDE.editor.colors.Font" />
+    <property name="FullScreen" value="false" />
+    <property name="options.searchVisible" value="true" />
+    <property name="options.splitter.details.proportions" value="0.2" />
+  </component>
+  <component name="PyConsoleOptionsProvider">
+    <option name="myPythonConsoleState">
+      <PyConsoleSettings />
+    </option>
+    <option name="myDjangoConsoleState">
+      <PyConsoleSettings />
+    </option>
+  </component>
+  <component name="RecentsManager">
+    <key name="CopyFile.RECENT_KEYS">
+      <recent name="$PROJECT_DIR$/bs_align" />
+      <recent name="$PROJECT_DIR$/bs_index" />
+    </key>
+  </component>
+  <component name="RunManager" selected="Python.output">
+    <configuration default="false" name="output" type="PythonConfigurationType" factoryName="Python" temporary="true">
+      <option name="INTERPRETER_OPTIONS" value="" />
+      <option name="PARENT_ENVS" value="true" />
+      <envs>
+        <env name="PYTHONUNBUFFERED" value="1" />
+      </envs>
+      <option name="SDK_HOME" value="" />
+      <option name="WORKING_DIRECTORY" value="$PROJECT_DIR$/bs_align" />
+      <option name="IS_MODULE_SDK" value="true" />
+      <option name="ADD_CONTENT_ROOTS" value="true" />
+      <option name="ADD_SOURCE_ROOTS" value="true" />
+      <module name="BSseeker2" />
+      <EXTENSION ID="PythonCoverageRunConfigurationExtension" enabled="false" sample_coverage="true" runner="coverage.py" />
+      <option name="SCRIPT_NAME" value="$PROJECT_DIR$/bs_align/output.py" />
+      <option name="PARAMETERS" value="" />
+      <RunnerSettings RunnerId="PythonCover" />
+      <ConfigurationWrapper RunnerId="PythonCover" />
+      <method />
+    </configuration>
+    <configuration default="true" type="PythonConfigurationType" factoryName="Python">
+      <option name="INTERPRETER_OPTIONS" value="" />
+      <option name="PARENT_ENVS" value="true" />
+      <envs>
+        <env name="PYTHONUNBUFFERED" value="1" />
+      </envs>
+      <option name="SDK_HOME" value="" />
+      <option name="WORKING_DIRECTORY" value="" />
+      <option name="IS_MODULE_SDK" value="false" />
+      <option name="ADD_CONTENT_ROOTS" value="true" />
+      <option name="ADD_SOURCE_ROOTS" value="true" />
+      <module name="BSseeker2" />
+      <EXTENSION ID="PythonCoverageRunConfigurationExtension" enabled="false" sample_coverage="true" runner="coverage.py" />
+      <option name="SCRIPT_NAME" value="" />
+      <option name="PARAMETERS" value="" />
+      <method />
+    </configuration>
+    <configuration default="true" type="tests" factoryName="Unittests">
+      <option name="INTERPRETER_OPTIONS" value="" />
+      <option name="PARENT_ENVS" value="true" />
+      <envs />
+      <option name="SDK_HOME" value="" />
+      <option name="WORKING_DIRECTORY" value="" />
+      <option name="IS_MODULE_SDK" value="false" />
+      <option name="ADD_CONTENT_ROOTS" value="true" />
+      <option name="ADD_SOURCE_ROOTS" value="true" />
+      <module name="BSseeker2" />
+      <EXTENSION ID="PythonCoverageRunConfigurationExtension" enabled="false" sample_coverage="true" runner="coverage.py" />
+      <option name="SCRIPT_NAME" value="" />
+      <option name="CLASS_NAME" value="" />
+      <option name="METHOD_NAME" value="" />
+      <option name="FOLDER_NAME" value="" />
+      <option name="TEST_TYPE" value="TEST_SCRIPT" />
+      <option name="PATTERN" value="" />
+      <option name="USE_PATTERN" value="false" />
+      <option name="PUREUNITTEST" value="true" />
+      <option name="PARAMS" value="" />
+      <option name="USE_PARAM" value="false" />
+      <method />
+    </configuration>
+    <configuration default="true" type="tests" factoryName="Doctests">
+      <option name="INTERPRETER_OPTIONS" value="" />
+      <option name="PARENT_ENVS" value="true" />
+      <envs />
+      <option name="SDK_HOME" value="" />
+      <option name="WORKING_DIRECTORY" value="" />
+      <option name="IS_MODULE_SDK" value="false" />
+      <option name="ADD_CONTENT_ROOTS" value="true" />
+      <option name="ADD_SOURCE_ROOTS" value="true" />
+      <module name="BSseeker2" />
+      <EXTENSION ID="PythonCoverageRunConfigurationExtension" enabled="false" sample_coverage="true" runner="coverage.py" />
+      <option name="SCRIPT_NAME" value="" />
+      <option name="CLASS_NAME" value="" />
+      <option name="METHOD_NAME" value="" />
+      <option name="FOLDER_NAME" value="" />
+      <option name="TEST_TYPE" value="TEST_SCRIPT" />
+      <option name="PATTERN" value="" />
+      <option name="USE_PATTERN" value="false" />
+      <method />
+    </configuration>
+    <list size="1">
+      <item index="0" class="java.lang.String" itemvalue="Python.output" />
+    </list>
+    <recent_temporary>
+      <list size="1">
+        <item index="0" class="java.lang.String" itemvalue="Python.output" />
+      </list>
+    </recent_temporary>
+  </component>
+  <component name="ShelveChangesManager" show_recycled="false" />
+  <component name="SvnConfiguration" maxAnnotateRevisions="500" myUseAcceleration="nothing" myAutoUpdateAfterCommit="false" cleanupOnStartRun="false" SSL_PROTOCOLS="sslv3">
+    <option name="USER" value="" />
+    <option name="PASSWORD" value="" />
+    <option name="mySSHConnectionTimeout" value="30000" />
+    <option name="mySSHReadTimeout" value="30000" />
+    <option name="LAST_MERGED_REVISION" />
+    <option name="MERGE_DRY_RUN" value="false" />
+    <option name="MERGE_DIFF_USE_ANCESTRY" value="true" />
+    <option name="UPDATE_LOCK_ON_DEMAND" value="false" />
+    <option name="IGNORE_SPACES_IN_MERGE" value="false" />
+    <option name="CHECK_NESTED_FOR_QUICK_MERGE" value="false" />
+    <option name="IGNORE_SPACES_IN_ANNOTATE" value="true" />
+    <option name="SHOW_MERGE_SOURCES_IN_ANNOTATE" value="true" />
+    <option name="FORCE_UPDATE" value="false" />
+    <option name="IGNORE_EXTERNALS" value="false" />
+    <myIsUseDefaultProxy>false</myIsUseDefaultProxy>
+  </component>
+  <component name="TaskManager">
+    <task active="true" id="Default" summary="Default task">
+      <changelist id="172bd281-b8c2-4544-b510-26029a6498b7" name="Default" comment="" />
+      <created>1365490852338</created>
+      <updated>1365490852338</updated>
+    </task>
+    <task id="LOCAL-00001" summary="update by Weilong">
+      <created>1365495166132</created>
+      <updated>1365495166132</updated>
+    </task>
+    <task id="LOCAL-00002" summary="Add version track;&#10;Accelerate alignment;&#10;Revised RRBS part.">
+      <created>1366217039909</created>
+      <updated>1366217039909</updated>
+    </task>
+    <task id="LOCAL-00003" summary="RRBS un-directional&#10;RRBS different digest enzyme">
+      <created>1366521472272</created>
+      <updated>1366521472272</updated>
+    </task>
+    <task id="LOCAL-00004" summary="Multiple-sites updates">
+      <created>1368857624039</created>
+      <updated>1368857624039</updated>
+    </task>
+    <task id="LOCAL-00005" summary="Clean-up/Galaxy/Test_data">
+      <created>1368872343967</created>
+      <updated>1368872343967</updated>
+    </task>
+    <task id="LOCAL-00006" summary="Clean-up/galaxy/test_data">
+      <created>1368872394831</created>
+      <updated>1368872394831</updated>
+    </task>
+    <task id="LOCAL-00007" summary="Fix bug on utils.py; Increased version; Add UPDATE">
+      <created>1369030443105</created>
+      <updated>1369030443105</updated>
+    </task>
+    <task id="LOCAL-00008" summary="support diff indexes">
+      <created>1369355034039</created>
+      <updated>1369355034040</updated>
+    </task>
+    <task id="LOCAL-00009" summary="Update Readme">
+      <created>1369785459146</created>
+      <updated>1369785459146</updated>
+    </task>
+    <task id="LOCAL-00010" summary="fix bug in galaxy; chmod +x *.py">
+      <created>1369876356622</created>
+      <updated>1369876356622</updated>
+    </task>
+    <task id="LOCAL-00011" summary="fix galaxy xml">
+      <created>1370044685987</created>
+      <updated>1370044685987</updated>
+    </task>
+    <task id="LOCAL-00012" summary="fix bugs for RRBS tag">
+      <created>1371202921858</created>
+      <updated>1371202921858</updated>
+    </task>
+    <task id="LOCAL-00013" summary="fix bugs for RRBS tag">
+      <created>1371366774531</created>
+      <updated>1371366774531</updated>
+    </task>
+    <task id="LOCAL-00014" summary="fix a bug">
+      <created>1375307754641</created>
+      <updated>1375307754641</updated>
+    </task>
+    <task id="LOCAL-00015" summary="V2.0.5">
+      <created>1383633777408</created>
+      <updated>1383633777408</updated>
+    </task>
+    <option name="localTasksCounter" value="16" />
+    <servers />
+  </component>
+  <component name="TodoView" selected-index="0">
+    <todo-panel id="selected-file">
+      <are-packages-shown value="false" />
+      <are-modules-shown value="false" />
+      <flatten-packages value="false" />
+      <is-autoscroll-to-source value="false" />
+    </todo-panel>
+    <todo-panel id="all">
+      <are-packages-shown value="false" />
+      <are-modules-shown value="false" />
+      <flatten-packages value="false" />
+      <is-autoscroll-to-source value="false" />
+    </todo-panel>
+    <todo-panel id="default-changelist">
+      <are-packages-shown value="false" />
+      <are-modules-shown value="false" />
+      <flatten-packages value="false" />
+      <is-autoscroll-to-source value="false" />
+    </todo-panel>
+  </component>
+  <component name="ToolWindowManager">
+    <frame x="53" y="22" width="1226" height="778" extended-state="0" />
+    <editor active="true" />
+    <layout>
+      <window_info id="Messages" active="false" anchor="bottom" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="false" weight="0.33" sideWeight="0.5" order="7" side_tool="false" content_ui="tabs" />
+      <window_info id="Changes" active="false" anchor="bottom" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="false" weight="0.32970452" sideWeight="0.5" order="7" side_tool="false" content_ui="tabs" />
+      <window_info id="TODO" active="false" anchor="bottom" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="false" weight="0.32980332" sideWeight="0.5" order="6" side_tool="false" content_ui="tabs" />
+      <window_info id="Database" active="false" anchor="right" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="false" weight="0.33" sideWeight="0.5" order="3" side_tool="false" content_ui="tabs" />
+      <window_info id="Structure" active="false" anchor="left" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="false" weight="0.24978974" sideWeight="0.5" order="1" side_tool="false" content_ui="tabs" />
+      <window_info id="Project" active="false" anchor="left" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="true" weight="0.25211507" sideWeight="0.6718507" order="0" side_tool="false" content_ui="combo" />
+      <window_info id="Debug" active="false" anchor="bottom" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="false" weight="0.4" sideWeight="0.5" order="3" side_tool="false" content_ui="tabs" />
+      <window_info id="Favorites" active="false" anchor="left" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="false" weight="0.32968882" sideWeight="0.5" order="2" side_tool="false" content_ui="tabs" />
+      <window_info id="Event Log" active="false" anchor="bottom" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="false" weight="0.32980332" sideWeight="0.5" order="7" side_tool="false" content_ui="tabs" />
+      <window_info id="Run" active="false" anchor="bottom" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="false" weight="0.33" sideWeight="0.5" order="2" side_tool="false" content_ui="tabs" />
+      <window_info id="Version Control" active="false" anchor="bottom" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="false" weight="0.33" sideWeight="0.5" order="7" side_tool="false" content_ui="tabs" />
+      <window_info id="Cvs" active="false" anchor="bottom" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="false" weight="0.25" sideWeight="0.5" order="4" side_tool="false" content_ui="tabs" />
+      <window_info id="Message" active="false" anchor="bottom" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="false" weight="0.33" sideWeight="0.5" order="0" side_tool="false" content_ui="tabs" />
+      <window_info id="Ant Build" active="false" anchor="right" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="false" weight="0.25" sideWeight="0.5" order="1" side_tool="false" content_ui="tabs" />
+      <window_info id="Find" active="false" anchor="bottom" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="false" weight="0.32829046" sideWeight="0.5" order="1" side_tool="false" content_ui="tabs" />
+      <window_info id="Commander" active="false" anchor="right" auto_hide="false" internal_type="SLIDING" type="SLIDING" visible="false" weight="0.4" sideWeight="0.5" order="0" side_tool="false" content_ui="tabs" />
+      <window_info id="Hierarchy" active="false" anchor="right" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="false" weight="0.25" sideWeight="0.5" order="2" side_tool="false" content_ui="combo" />
+      <window_info id="Inspection" active="false" anchor="bottom" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="false" weight="0.4" sideWeight="0.5" order="5" side_tool="false" content_ui="tabs" />
+    </layout>
+  </component>
+  <component name="VcsContentAnnotationSettings">
+    <option name="myLimit" value="2678400000" />
+  </component>
+  <component name="VcsManagerConfiguration">
+    <option name="OFFER_MOVE_TO_ANOTHER_CHANGELIST_ON_PARTIAL_COMMIT" value="true" />
+    <option name="CHECK_CODE_SMELLS_BEFORE_PROJECT_COMMIT" value="false" />
+    <option name="CHECK_NEW_TODO" value="true" />
+    <option name="myTodoPanelSettings">
+      <value>
+        <are-packages-shown value="false" />
+        <are-modules-shown value="false" />
+        <flatten-packages value="false" />
+        <is-autoscroll-to-source value="false" />
+      </value>
+    </option>
+    <option name="PERFORM_UPDATE_IN_BACKGROUND" value="true" />
+    <option name="PERFORM_COMMIT_IN_BACKGROUND" value="true" />
+    <option name="PERFORM_EDIT_IN_BACKGROUND" value="true" />
+    <option name="PERFORM_CHECKOUT_IN_BACKGROUND" value="true" />
+    <option name="PERFORM_ADD_REMOVE_IN_BACKGROUND" value="true" />
+    <option name="PERFORM_ROLLBACK_IN_BACKGROUND" value="false" />
+    <option name="CHECK_LOCALLY_CHANGED_CONFLICTS_IN_BACKGROUND" value="false" />
+    <option name="CHANGED_ON_SERVER_INTERVAL" value="60" />
+    <option name="SHOW_ONLY_CHANGED_IN_SELECTION_DIFF" value="true" />
+    <option name="CHECK_COMMIT_MESSAGE_SPELLING" value="true" />
+    <option name="DEFAULT_PATCH_EXTENSION" value="patch" />
+    <option name="SHORT_DIFF_HORIZONTALLY" value="true" />
+    <option name="SHORT_DIFF_EXTRA_LINES" value="2" />
+    <option name="SOFT_WRAPS_IN_SHORT_DIFF" value="true" />
+    <option name="INCLUDE_TEXT_INTO_PATCH" value="false" />
+    <option name="INCLUDE_TEXT_INTO_SHELF" value="false" />
+    <option name="SHOW_FILE_HISTORY_DETAILS" value="true" />
+    <option name="SHOW_VCS_ERROR_NOTIFICATIONS" value="true" />
+    <option name="SHOW_DIRTY_RECURSIVELY" value="false" />
+    <option name="LIMIT_HISTORY" value="true" />
+    <option name="MAXIMUM_HISTORY_ROWS" value="1000" />
+    <option name="UPDATE_FILTER_SCOPE_NAME" />
+    <option name="USE_COMMIT_MESSAGE_MARGIN" value="false" />
+    <option name="COMMIT_MESSAGE_MARGIN_SIZE" value="72" />
+    <option name="WRAP_WHEN_TYPING_REACHES_RIGHT_MARGIN" value="false" />
+    <option name="FORCE_NON_EMPTY_COMMENT" value="false" />
+    <option name="CLEAR_INITIAL_COMMIT_MESSAGE" value="false" />
+    <option name="LAST_COMMIT_MESSAGE" value="V2.0.5" />
+    <option name="MAKE_NEW_CHANGELIST_ACTIVE" value="false" />
+    <option name="OPTIMIZE_IMPORTS_BEFORE_PROJECT_COMMIT" value="false" />
+    <option name="CHECK_FILES_UP_TO_DATE_BEFORE_COMMIT" value="false" />
+    <option name="REFORMAT_BEFORE_PROJECT_COMMIT" value="false" />
+    <option name="REFORMAT_BEFORE_FILE_COMMIT" value="false" />
+    <option name="FILE_HISTORY_DIALOG_COMMENTS_SPLITTER_PROPORTION" value="0.8" />
+    <option name="FILE_HISTORY_DIALOG_SPLITTER_PROPORTION" value="0.5" />
+    <option name="ACTIVE_VCS_NAME" />
+    <option name="UPDATE_GROUP_BY_PACKAGES" value="false" />
+    <option name="UPDATE_GROUP_BY_CHANGELIST" value="false" />
+    <option name="UPDATE_FILTER_BY_SCOPE" value="false" />
+    <option name="SHOW_FILE_HISTORY_AS_TREE" value="false" />
+    <option name="FILE_HISTORY_SPLITTER_PROPORTION" value="0.6" />
+    <MESSAGE value="update by Weilong" />
+    <MESSAGE value="Add version track;&#10;Accelerate alignment;&#10;Revised RRBS part." />
+    <MESSAGE value="RRBS un-directional&#10;RRBS different digest enzyme" />
+    <MESSAGE value="Multiple-sites updates" />
+    <MESSAGE value="Clean-up/Galaxy/Test_data" />
+    <MESSAGE value="Clean-up/galaxy/test_data" />
+    <MESSAGE value="Fix bug on utils.py; Increased version; Add UPDATE" />
+    <MESSAGE value="support diff indexes" />
+    <MESSAGE value="Update Readme" />
+    <MESSAGE value="fix bug in galaxy; chmod +x *.py" />
+    <MESSAGE value="Bug fixed in Galaxy.xml" />
+    <MESSAGE value="fix galaxy xml" />
+    <MESSAGE value="fix bugs for RRBS tag" />
+    <MESSAGE value="fix a bug" />
+    <MESSAGE value="V2.0.5" />
+  </component>
+  <component name="XDebuggerManager">
+    <breakpoint-manager>
+      <option name="time" value="23" />
+    </breakpoint-manager>
+  </component>
+  <component name="editorHistoryManager">
+    <entry file="file://$PROJECT_DIR$/FilterReads.py">
+      <provider selected="true" editor-type-id="text-editor">
+        <state line="234" column="14" selection-start="6889" selection-end="6889" vertical-scroll-proportion="0.7379768" />
+      </provider>
+    </entry>
+    <entry file="file://$PROJECT_DIR$/galaxy/bs_seeker2_wrapper.py">
+      <provider selected="true" editor-type-id="text-editor">
+        <state line="116" column="0" selection-start="4938" selection-end="4938" vertical-scroll-proportion="1.3648424" />
+      </provider>
+    </entry>
+    <entry file="file://$PROJECT_DIR$/galaxy/bs_seeker2_wrapper.xml">
+      <provider selected="true" editor-type-id="text-editor">
+        <state line="2" column="40" selection-start="188" selection-end="188" vertical-scroll-proportion="-0.5970149" />
+      </provider>
+    </entry>
+    <entry file="file://$PROJECT_DIR$/bs_align/output.py">
+      <provider selected="true" editor-type-id="text-editor">
+        <state line="53" column="25" selection-start="2172" selection-end="2172" vertical-scroll-proportion="0.9339775" />
+      </provider>
+    </entry>
+    <entry file="file://$PROJECT_DIR$/bs_align/bs_align_utils.py">
+      <provider selected="true" editor-type-id="text-editor">
+        <state line="390" column="21" selection-start="12695" selection-end="12695" vertical-scroll-proportion="0.59731543" />
+      </provider>
+    </entry>
+    <entry file="file:///System/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/fileinput.py">
+      <provider selected="true" editor-type-id="text-editor">
+        <state line="90" column="4" selection-start="3827" selection-end="3827" vertical-scroll-proportion="0.28391168" />
+      </provider>
+    </entry>
+    <entry file="file://$PROJECT_DIR$/bs_index/wg_build.py">
+      <provider selected="true" editor-type-id="text-editor">
+        <state line="7" column="37" selection-start="268" selection-end="268" vertical-scroll-proportion="-0.70347005">
+          <folding />
+        </state>
+      </provider>
+    </entry>
+    <entry file="file://$PROJECT_DIR$/bs_seeker2-build.py">
+      <provider selected="true" editor-type-id="text-editor">
+        <state line="15" column="102" selection-start="651" selection-end="651" vertical-scroll-proportion="0.19323671">
+          <folding />
+        </state>
+      </provider>
+    </entry>
+    <entry file="file://$PROJECT_DIR$/bs_align/bs_single_end.py">
+      <provider selected="true" editor-type-id="text-editor">
+        <state line="73" column="19" selection-start="2782" selection-end="2789" vertical-scroll-proportion="0.9328859">
+          <folding>
+            <element signature="e#0#40#0" expanded="true" />
+          </folding>
+        </state>
+      </provider>
+    </entry>
+    <entry file="file://$PROJECT_DIR$/bs_align/bs_rrbs.py">
+      <provider selected="true" editor-type-id="text-editor">
+        <state line="621" column="50" selection-start="27893" selection-end="27908" vertical-scroll-proportion="0.33221477">
+          <folding />
+        </state>
+      </provider>
+    </entry>
+    <entry file="file://$PROJECT_DIR$/bs_align/bs_pair_end.py">
+      <provider selected="true" editor-type-id="text-editor">
+        <state line="734" column="76" selection-start="31798" selection-end="31798" vertical-scroll-proportion="20.067114">
+          <folding />
+        </state>
+      </provider>
+    </entry>
+    <entry file="file://$PROJECT_DIR$/RELEASE_NOTES">
+      <provider selected="true" editor-type-id="text-editor">
+        <state line="23" column="0" selection-start="1006" selection-end="1006" vertical-scroll-proportion="0.6845426">
+          <folding />
+        </state>
+      </provider>
+    </entry>
+    <entry file="file://$PROJECT_DIR$/bs_seeker2-call_methylation.py">
+      <provider selected="true" editor-type-id="text-editor">
+        <state line="135" column="30" selection-start="5381" selection-end="5404" vertical-scroll-proportion="-1.1900162">
+          <folding>
+            <element signature="e#23#69#0" expanded="true" />
+          </folding>
+        </state>
+      </provider>
+    </entry>
+    <entry file="file://$PROJECT_DIR$/bs_seeker2-align.py">
+      <provider selected="true" editor-type-id="text-editor">
+        <state line="57" column="122" selection-start="5501" selection-end="5501" vertical-scroll-proportion="0.7085346">
+          <folding />
+        </state>
+      </provider>
+    </entry>
+    <entry file="file://$PROJECT_DIR$/README.md">
+      <provider selected="true" editor-type-id="text-editor">
+        <state line="77" column="25" selection-start="2888" selection-end="2895" vertical-scroll-proportion="-7.92">
+          <folding />
+        </state>
+      </provider>
+    </entry>
+    <entry file="file://$PROJECT_DIR$/bs_utils/utils.py">
+      <provider selected="true" editor-type-id="text-editor">
+        <state line="14" column="0" selection-start="176" selection-end="176" vertical-scroll-proportion="0.16103059">
+          <folding />
+        </state>
+      </provider>
+    </entry>
+  </component>
+</project>
+
--- a/BSseeker2/FilterReads.py	Fri Jul 12 18:47:28 2013 -0400
+++ b/BSseeker2/FilterReads.py	Tue Nov 05 01:55:39 2013 -0500
@@ -1,4 +1,4 @@
-#!/usr/bin/python
+#!/usr/bin/env python
 
 import sys
 import os
@@ -226,7 +226,7 @@
     (options, args) = parser.parse_args()
     
     if (options.infile is None) or (options.outfile is None) :
-        print parser.print_help()
+        parser.print_help()
         exit(-1)
     FilterReads(options.infile, options.outfile, options.keepquality)
 
--- a/BSseeker2/README.md	Fri Jul 12 18:47:28 2013 -0400
+++ b/BSseeker2/README.md	Tue Nov 05 01:55:39 2013 -0500
@@ -48,9 +48,10 @@
 
 * Linux or Mac OS platform
 * One of the following Aligner
-  - [bowtie](http://bowtie-bio.sourceforge.net/)
-  - [bowtie2](http://bowtie-bio.sourceforge.net/bowtie2/) (Recommend)
+  - [bowtie](http://bowtie-bio.sourceforge.net/) (fast)
+  - [bowtie2](http://bowtie-bio.sourceforge.net/bowtie2/) (Default)
   - [soap](http://soap.genomics.org.cn/)
+  - [rmap](http://www.cmb.usc.edu/people/andrewds/rmap/)
 * [Python](http://www.python.org/download/) (Version 2.6 +)
 
   (It is normally pre-installed in Linux. Type " python -V" to see the installed version.)
@@ -74,7 +75,7 @@
 
 	$ python FilterReads.py
 	Usage: FilterReads.py -i <input> -o <output> [-k]
-	Author : Guo, Weilong; guoweilong@gmail.com; 2012-11-10
+	Author : Guo, Weilong; 2012-11-10
 	Unique reads for qseq/fastq/fasta/sequencce, and filter
 	low quality file in qseq file.
 
@@ -105,16 +106,16 @@
       -h, --help            show this help message and exit
       -f FILE, --file=FILE  Input your reference genome file (fasta)
       --aligner=ALIGNER     Aligner program to perform the analysis: bowtie,
-                            bowtie2, soap [Default: bowtie2]
-      -p PATH, --path=PATH  Path to the aligner program. Defaults:
-                            bowtie: /u/home/mcdb/weilong/install/bowtie-0.12.8
-                            bowtie2:
-                            /u/home/mcdb/weilong/install/bowtie2-2.0.0-beta7
-                            soap: /u/home/mcdb/weilong/install/soap2.21release/
+                            bowtie2, soap, rmap [Default: bowtie]
+      -p PATH, --path=PATH  Path to the aligner program. Detected:
+                            bowtie: ~/install/bowtie
+                            bowtie2: ~/install/bowtie2
+                            rmap: ~/install/rmap_/bin
+                            soap: ~/install/soap/
       -d DBPATH, --db=DBPATH
                             Path to the reference genome library (generated in
-                            preprocessing genome) [Default: /u/home/mcdb/weilong/i
-                            nstall/BSseeker2/bs_utils/reference_genomes]
+                            preprocessing genome) [Default: ~/install
+                            /BSseeker2/bs_utils/reference_genomes]
       -v, --version         show version of BS-Seeker2
 
       Reduced Representation Bisulfite Sequencing Options:
@@ -125,7 +126,7 @@
                             certain fragments will be masked. [Default: False]
         -l LOW_BOUND, --low=LOW_BOUND
                             lower bound of fragment length (excluding recognition
-                            sequence such as C-CGG) [Default: 40]
+                            sequence such as C-CGG) [Default: 20]
         -u UP_BOUND, --up=UP_BOUND
                             upper bound of fragment length (excluding recognition
                             sequence such as C-CGG ends) [Default: 500]
@@ -134,6 +135,7 @@
                             Mael:(C-TAG), double-enzyme MspI&Mael:(C-CGG,C-TAG).
                             [Default: C-CGG]
 
+
 ##Example
 
 * Build genome index for WGBS using bowtie, path of bowtie should be included in $PATH
@@ -150,7 +152,7 @@
 
 * Build genome index for RRBS library for double-enzyme : MspI (C-CGG) & ApeKI (G-CWGC, where W=A|T, see [IUPAC code](http://www.bioinformatics.org/sms/iupac.html))
 
-        python bs_seeker2-build.py -f genome.fa -r -c C-CGG,G-CWGC
+        python bs_seeker2-build.py -f genome.fa -r -c C-CGG,G-CWGC --aligner=bowtie
 
 ##Tips:
 
@@ -172,75 +174,73 @@
 ##Usage :
 
     $ python ~/install/BSseeker2/bs_seeker2-align.py -h
-    Usage: bs_seeker2-align.py [options]
+    Usage: bs_seeker2-align.py {-i <single> | -1 <mate1> -2 <mate2>} -g <genome.fa> [options]
 
     Options:
       -h, --help            show this help message and exit
 
       For single end reads:
         -i INFILE, --input=INFILE
-                            Input your read file name (FORMAT: sequences,
-                            fastq, qseq,fasta)
+                            Input read file (FORMAT: sequences, qseq, fasta,
+                            fastq). Ex: read.fa or read.fa.gz
 
       For pair end reads:
         -1 FILE, --input_1=FILE
-                            Input your read file end 1 (FORMAT: sequences,
-                            qseq, fasta, fastq)
+                            Input read file, mate 1 (FORMAT: sequences, qseq,
+                            fasta, fastq)
         -2 FILE, --input_2=FILE
-                            Input your read file end 2 (FORMAT: sequences,
-                            qseq, fasta, fastq)
-        --minins=MIN_INSERT_SIZE
+                            Input read file, mate 2 (FORMAT: sequences, qseq,
+                            fasta, fastq)
+        -I MIN_INSERT_SIZE, --minins=MIN_INSERT_SIZE
                             The minimum insert size for valid paired-end
-                            alignments [Default: -1]
-        --maxins=MAX_INSERT_SIZE
+                            alignments [Default: 0]
+        -X MAX_INSERT_SIZE, --maxins=MAX_INSERT_SIZE
                             The maximum insert size for valid paired-end
-                            alignments [Default: 400]
+                            alignments [Default: 500]
 
       Reduced Representation Bisulfite Sequencing Options:
-        -r, --rrbs          Process reads from Reduced Representation Bisulfite
-                            Sequencing experiments
+        -r, --rrbs          Map reads to the Reduced Representation genome
         -c pattern, --cut-site=pattern
                             Cutting sites of restriction enzyme. Ex: MspI(C-CGG),
                             Mael:(C-TAG), double-enzyme MspI&Mael:(C-CGG,C-TAG).
+                            [Default: C-CGG]
         -L RRBS_LOW_BOUND, --low=RRBS_LOW_BOUND
-                            lower bound of fragment length (excluding C-CGG ends)
-                            [Default: 40]
+                            Lower bound of fragment length (excluding C-CGG ends)
+                            [Default: 20]
         -U RRBS_UP_BOUND, --up=RRBS_UP_BOUND
-                            upper bound of fragment length (excluding C-CGG ends)
+                            Upper bound of fragment length (excluding C-CGG ends)
                             [Default: 500]
 
       General options:
         -t TAG, --tag=TAG   [Y]es for undirectional lib, [N]o for directional
                             [Default: N]
         -s CUTNUMBER1, --start_base=CUTNUMBER1
-                            The first base of your read to be mapped [Default: 1]
+                            The first cycle of the read to be mapped [Default: 1]
         -e CUTNUMBER2, --end_base=CUTNUMBER2
-                            The last cycle number of your read to be mapped
-                            [Default: 200]
+                            The last cycle of the read to be mapped [Default: 200]
         -a FILE, --adapter=FILE
                             Input text file of your adaptor sequences (to be
-                            trimed from the 3'end of the reads). Input 1 seq for
-                            dir. lib., 2 seqs for undir. lib. One line per
-                            sequence
+                            trimmed from the 3'end of the reads, ). Input one seq
+                            for dir. lib., twon seqs for undir. lib. One line per
+                            sequence. Only the first 10bp will be used
         --am=ADAPTER_MISMATCH
-                            Number of mismatches allowed in adaptor [Default: 1]
+                            Number of mismatches allowed in adapter [Default: 0]
         -g GENOME, --genome=GENOME
-                            Name of the reference genome (the same as the
-                            reference genome file in the preprocessing step) [ex.
-                            chr21_hg18.fa]
-        -m INT_NO_MISMATCHES, --mismatches=INT_NO_MISMATCHES
+                            Name of the reference genome (should be the same as
+                            "-f" in bs_seeker2-build.py ) [ex. chr21_hg18.fa]
+        -m NO_MISMATCHES, --mismatches=NO_MISMATCHES
                             Number of mismatches in one read [Default: 4]
-        --aligner=ALIGNER   Aligner program to perform the analisys: bowtie,
-                            bowtie2, soap [Default: bowtie2]
+        --aligner=ALIGNER   Aligner program for short reads mapping: bowtie,
+                            bowtie2, soap, rmap [Default: bowtie]
         -p PATH, --path=PATH
-                            Path to the aligner program. Defaults:
-                            bowtie: /u/home/mcdb/weilong/install/bowtie-0.12.8
-                            bowtie2:
-                            /u/home/mcdb/weilong/install/bowtie2-2.0.0-beta7
-                            soap: /u/home/mcdb/weilong/soap2.21release/
+                            Path to the aligner program. Detected:
+                            bowtie: ~/install/bowtie
+                            bowtie2: ~/install/bowtie2
+                            rmap: ~/install/rmap/bin
+                            soap: ~/install/soap/
         -d DBPATH, --db=DBPATH
                             Path to the reference genome library (generated in
-                            preprocessing genome) [Default: /u/home/mcdb/weilong/i
+                            preprocessing genome) [Default: ~/i
                             nstall/BSseeker2/bs_utils/reference_genomes]
         -l NO_SPLIT, --split_line=NO_SPLIT
                             Number of lines per split (the read file will be split
@@ -251,7 +251,7 @@
         -f FORMAT, --output-format=FORMAT
                             Output format: bam, sam, bs_seeker1 [Default: bam]
         --no-header         Suppress SAM header lines [Default: False]
-        --temp_dir=PATH     The path to your temporary directory [Default: /tmp]
+        --temp_dir=PATH     The path to your temporary directory [Detected: /tmp]
         --XS=XS_FILTER      Filter definition for tag XS, format X,Y. X=0.8 and
                             y=5 indicate that for one read, if #(mCH sites)/#(all
                             CH sites)>0.8 and #(mCH sites)>5, then tag XS=1; or
@@ -263,31 +263,51 @@
       Aligner Options:
         You may specify any additional options for the aligner. You just have
         to prefix them with --bt- for bowtie, --bt2- for bowtie2, --soap- for
-        soap, and BS Seeker will pass them on. For example: --bt-p 4 will
-        increase the number of threads for bowtie to 4, --bt--tryhard will
-        instruct bowtie to try as hard as possible to find valid alignments
-        when they exist, and so on. Be sure that you know what you are doing
-        when using these options! Also, we don't do any validation on the
-        values.
-
+        soap, --rmap- for rmap, and BS Seeker will pass them on. For example:
+        --bt-p 4 will increase the number of threads for bowtie to 4, --bt--
+        tryhard will instruct bowtie to try as hard as possible to find valid
+        alignments when they exist, and so on. Be sure that you know what you
+        are doing when using these options! Also, we don't do any validation
+        on the values.
 
 
 ##Examples :
 
-* Align from fasta format with bowtie2 (local alignment) for whole genome, allowing 3 mismatches
+* WGBS library ; alignment mode, bowtie ; map to WGBS index
+
+        python bs_seeker2-align.py -i WGBS.fa --aligner=bowtie -o WGBS.bam -f bam -g genome.fa
+
+* WGBS library ; alignment mode, bowtie2-local ; map to WGBS index
 
-        python bs_seeker2-align.py -i WGBS.fa -m 3 --aligner=bowtie2 -o WGBS.bam -f bam -g genome.fa
+        python bs_seeker2-align.py -i WGBS.fa --aligner=bowtie2 -o WGBS.bam -f bam -g genome.fa
+
+* WGBS library ; alignment mode, bowtie2-end-to-end ; map to WGBS index
 
-* Align from qseq format for RRBS with bowtie, default parameters for RRBS fragments
+        python bs_seeker2-align.py -i WGBS.fa -m 3 --aligner=bowtie2 -o WGBS.bam -f bam -g genome.fa --bt2--end-to-end
+
+* RRBS library ; alignment mode, bowtie ; map to RR index
 
-        python bs_seeker2-align.py -i RRBS.fa --aligner=bowtie -o RRBS.sam -f sam -g genome.fa -r -a adapter.txt
+        python bs_seeker2-align.py -i RRBS.fa --aligner=bowtie -o RRBS.bam -g genome.fa -r -a adapter.txt
+
+* RRBS library ; alignment mode, bowtie ; map to WG index
+
+        python bs_seeker2-align.py -i RRBS.fa --aligner=bowtie -o RRBS.bam -g genome.fa -a adapter.txt
 
-* Align from qseq format for RRBS with bowtie (end-to-end), specifying lengths of fragments ranging [40bp, 400bp]
+* RRBS library ; alignment mode, bowtie2-end-to-end ; map to WG index
+
+        python bs_seeker2-align.py -i RRBS.fa --aligner=bowtie -o RRBS.bam -g genome.fa -a adapter.txt --bt2--end-to-end
 
-        python bs_seeker2-align.py -i RRBS.qseq --aligner=bowtie2 --bt2--end-to-end -o RRBS.bam -f bam -g genome.fa -r --low=40 --up=400 -a adapter.txt
+* Align from qseq format for RRBS with bowtie, specifying lengths of fragments ranging [40bp, 400bp]
+
+        python bs_seeker2-align.py -i RRBS.qseq --aligner=bowtie -o RRBS.bam -f bam -g genome.fa -r --low=40 --up=400 -a adapter.txt
 
 The parameters '--low' and '--up' should be the same with corresponding parameters when building the genome index
 
+* WGBS library ; alignment mode, bowtie ; map to WGBS index; use 8 threads for alignment
+
+        python bs_seeker2-align.py -i WGBS.fa --aligner=bowtie -o WGBS.bam -f bam -g genome.fa --bt-p 4
+
+BS-Seeker2 will run TWO bowtie instances in parallel.
 
 
 ##Input file:
@@ -341,6 +361,10 @@
 
 	For example, if 95% of reads come from fragments with length range [50bp, 250bp], you'd better choose [40bp, 300bp].
 
+- Fewer mismatches for the 'local alignment' mode.
+
+    As the 'local alignment', the bad sequenced bases are usually trimmed, and would not be considered by the parameter "-m".
+    It is suggested to user fewer mismatches for the 'local alignment' mode.
 
 (3) bs_seeker2-call_methylation.py
 ------------
@@ -351,16 +375,14 @@
 ##Usage:
 
         $ python bs_seeker2-call_methylation.py -h
-        Usage: bs_seeker2-call_methylation.py [options]
-
         Options:
           -h, --help            show this help message and exit
           -i INFILE, --input=INFILE
                                 BAM output from bs_seeker2-align.py
           -d DBPATH, --db=DBPATH
                                 Path to the reference genome library (generated in
-                                preprocessing genome) [Default: /u/home/mcdb/weilong/i
-                                nstall/BSseeker2/bs_utils/reference_genomes]
+                                preprocessing genome) [Default: ~/install
+                                /BSseeker2/bs_utils/reference_genomes]
           -o OUTFILE, --output-prefix=OUTFILE
                                 The output prefix to create ATCGmap and wiggle files
                                 [INFILE]
@@ -370,6 +392,7 @@
           -x, --rm-SX           Removed reads with tag 'XS:i:1', which would be
                                 considered as not fully converted by bisulfite
                                 treatment [Default: False]
+          --txt                 Show CGmap and ATCGmap in .gz [Default: False]
           -r READ_NO, --read-no=READ_NO
                                 The least number of reads covering one site to be
                                 shown in wig file [Default: 1]
@@ -430,9 +453,9 @@
         (3) position
         (4) context (CG/CHG/CHH)
         (5) dinucleotide-context (CA/CC/CG/CT)
-        (6) methyltion-level = #-of-C / (#-of-C + #-of-T)
-        (7) #-of-C (methylated)
-        (8) (#-ofC + #-of-T) (all cytosines)
+        (6) methylation-level = #_of_C / (#_of_C + #_of_T).
+        (7) #_of_C (methylated C, the count of reads showing C here)
+        (8) = #_of_C + #_of_T (all Cytosines, the count of reads showing C or T here)
 
 
 - ATCGmap file
@@ -442,7 +465,7 @@
         chr1	T	3009410	--	--	0	10	0	0	0	0	0	0	0	0	na
         chr1	C	3009411	CHH	CC	0	10	0	0	0	0	0	0	0	0	0.0
         chr1	C	3009412	CHG	CC	0	10	0	0	0	0	0	0	0	0	0.0
-        chr1	C	3009413	CG	CG	0	10	50	0	0	0	0	0	0	0	0.833333333333
+        chr1	C	3009413	CG	CG	0	10	50	0	0	0	0	0	0	0	0.83
 
 
     Format descriptions:
@@ -467,14 +490,15 @@
         (14) # of reads from Crick strand mapped here, support G on Watson strand and C on Crick strand
         (15) # of reads from Crick strand mapped here, support N
 
-        (16) methylation_level = #C/(#C+#T) = (C8+C14)/(C7+C8+C11+C14); "nan" means none reads support C/T at this position.
+        (16) methylation_level = #C/(#C+#T) = C8/(C7+C8) for Watson strand, =C14/(C11+C14) for Crick strand;
+        "nan" means none reads support C/T at this position.
 
 
 
 Contact Information
 ============
 
-If you still have questions on BS-Seeker 2, or you find bugs when using BS-Seeker 2, or you have suggestions, please write email to guoweilong@gmail.com (Weilong Guo).
+If you still have questions on BS-Seeker 2, or you find bugs when using BS-Seeker 2, or you have suggestions, please write email to [Weilong Guo](guoweilong@gmail.com).
 
 
 
@@ -556,7 +580,7 @@
         cd BSseeker2-master/
 
 
-(4)Run BS-Seeker2
+(4)Run BS-Seeker2
 
 Q: Can I add the path of BS-Seeker2's *.py to the $PATH, so I can call
 BS-Seeker2 from anywhere?
@@ -585,6 +609,69 @@
         bs_seeker-align.py -h
         bs_seeker-call_methylation.py -h
 
+(5) Unique alignment
+
+Q: If I want to only keep alignments that map uniquely, is this an argument I should supply directly
+to Bowtie2 (via BS Seeker 2's command line option), or is this an option that's available in
+BS Seeker 2 itself?
+
+A: BS-Seeker2 reports unique alignment by default already. If you want to know how many reads
+could have multiple hits, run BS-Seeker2 with parameter "--multiple-hit".
+
+
+(6) Output
+
+Q: In CGmap files, why some lines shown "--" but not a motif (CG/CHG/CHH), for example:
+
+    chr01   C       4303711 --      CC      0.0     0       2
+    chr01   C       4303712 --      CN      0.0     0       2
+
+A: In this example, the site 4303713 is "N" in genome, thus we could not decide the explict pattern.
+
+(7) Algorithm to remove the adapter.
+
+Q: What's the algorithm to remove the adapter
+
+A: BS-Seeker2 has built-in algorithm for removing the adapter, which is developed by [Weilong Guo](http://bioinfo.au.tsinghua.edu.cn/member/wguo/index.html).
+
+    First, if the adapter was provided as "AGATCGGAAGAGCACACGTC", only the first 10bp would be used.
+    Second, we use semi-local alignment strategy for removing the adapters.
+    Exmaple:
+
+        Read :       ACCGCGTTGATCGAGTACGTACGTGGGTC
+        Adapter :    ....................ACGTGGGTCCCG
+
+        no_mismatch : the maximum number allowed for mismatches
+
+        Algorithm: (allowing 1 mismatch)
+        -Step 1:
+          ACCGCGTTGATCGAGTACGTACGTGGGTC
+          ||XX
+          ACGTGGGTCCCG
+        -Step 2:
+          ACCGCGTTGATCGAGTACGTACGTGGGTC
+           X||X
+          .ACGTGGGTCCCG
+        -Step 3:
+          ACCGCGTTGATCGAGTACGTACGTGGGTC
+            XX
+          ..ACGTGGGTCCCG
+        -Step ...
+        -Step N:
+          ACCGCGTTGATCGAGTACGTACGTGGGTC
+                              |||||||||
+          ....................ACGTGGGTCCCG
+        Success & return!
+
+    Third, we also removed the synthesized bases at the end of RRBS fragments.
+    Take the "C-CGG" cutting site as example,
+
+        - - C|U G G - - =>cut=> - - C      =>add=> - - C|C G =>sequencing
+        - - G G C|C - -         - - G G C          - - G G C
+
+    In our algorithm, the "CG" in "--CCG" (upper strand) was trimmed, in order to get accurate methyaltion level.
 
 
 
+
+
--- a/BSseeker2/RELEASE_NOTES	Fri Jul 12 18:47:28 2013 -0400
+++ b/BSseeker2/RELEASE_NOTES	Tue Nov 05 01:55:39 2013 -0500
@@ -3,5 +3,25 @@
 1. Fix bug in utils.py
 2. Add UPDATE file
 
+v2.0.4 - July 29, 2013
+1. Update README.md (Definition of ATCGmap format)
+2. Fix the "None" output when no parameter
+3. Fix error report when using wrong path for short reads aligner
+4. MIT License
+
+V2.0.5 - Nov 31, 2013
+1. Fix bug in "bs_single_end.py" for "numbers_premapped_lst[0] += len(Unique_FW_C2T)"
+2. Make the default aligner to Bowtie
+3. Update the README file
+4. "-r N" in call-methylation will only control Wiggle file
+5. Change the output of pair-end mapping to the standard format of SAM file (the QNAME and FLAG fields)
+6. The artificially synthesized bases at the ends of RRBS fragments are removed when removing the adapters
+7. Add the total number of bases of uniquely mapped reads to the STDOUT
+8. Support "end-to-end" alignment mode in the Galaxy version
+9. Support input file in both TEXT or Compressed (.gz) format
+10. "-m" allow both INT and FLOAT as input. Ex: '-m 5' or '-m 0.05'
+11. Add mode information in output
 
 
+
+
Binary file BSseeker2/bs_align/.___init__.py has changed
Binary file BSseeker2/bs_align/._bs_align_utils.py has changed
Binary file BSseeker2/bs_align/._bs_pair_end.py has changed
Binary file BSseeker2/bs_align/._bs_rrbs.py has changed
Binary file BSseeker2/bs_align/._bs_single_end.py has changed
Binary file BSseeker2/bs_align/._output.py has changed
--- a/BSseeker2/bs_align/bs_align_utils.py	Fri Jul 12 18:47:28 2013 -0400
+++ b/BSseeker2/bs_align/bs_align_utils.py	Tue Nov 05 01:55:39 2013 -0500
@@ -54,9 +54,15 @@
 
 """
 
-def RemoveAdapter ( read, adapter, no_mismatch ) :
+# Remove the adapter from 3' end
+def RemoveAdapter ( read, adapter, no_mismatch, rm_back=0) :
     lr = len(read)
     la = len(adapter)
+    # Check the empty adapter, namely, the reads start with the 2nd base of adapter,
+    # not including the 'A' base in front of the adapter.
+    if adapter[2:] == read[0:(la-1)] :
+        return ""
+
     for i in xrange( lr - no_mismatch ) :
         read_pos = i
         adapter_pos = 0
@@ -74,8 +80,14 @@
                     adapter_pos = adapter_pos + 1
         # while_end
 
+        # Cut the extra bases before the adapter
+        #     --C|CG G--  => --CNN+A+<adapter>
+        #     --G GC|C--     --GGC
         if adapter_pos == la or read_pos == lr :
-            return read[:i]
+            if i <= rm_back :
+                return ''
+            else :
+                return read[:(i-rm_back)]
     # for_end
     return read
 
--- a/BSseeker2/bs_align/bs_pair_end.py	Fri Jul 12 18:47:28 2013 -0400
+++ b/BSseeker2/bs_align/bs_pair_end.py	Tue Nov 05 01:55:39 2013 -0500
@@ -104,13 +104,13 @@
                 aligner_command,
                 db_path,
                 tmp_path,
-                outfile, XS_pct, XS_count, show_multiple_hit=False):
+                outfile, XS_pct, XS_count, adapter_mismatch, show_multiple_hit=False):
 
 
     #----------------------------------------------------------------
-    adapter=""
-    adapterA=""
-    adapterB=""
+    adapter  = ""
+    adapterA = ""
+    adapterB = ""
     if adapter_file !="":
         try :
             adapter_inf=open(adapter_file,"r")
@@ -134,12 +134,15 @@
     logm("End 1 filename: %s"% main_read_file_1  )
     logm("End 2 filename: %s"% main_read_file_2  )
     logm("The first base (for mapping): %d"% cut1  )
-    logm("The last base (for mapping): %d"% cut2  )
+    logm("The  last base (for mapping): %d"% cut2  )
 
-    logm("-------------------------------- " )
-    logm("Un-directional library: %s" % asktag  )
     logm("Path for short reads aligner: %s"% aligner_command + '\n')
     logm("Reference genome library path: %s"% db_path  )
+
+    if asktag == "Y" :
+        logm("Un-directional library" )
+    else :
+        logm("Directional library")
     logm("Number of mismatches allowed: %s"% max_mismatch_no  )
 
     if adapter_file !="":
@@ -182,6 +185,9 @@
     all_trimmed=0
     all_mapped=0
     all_mapped_passed=0
+    all_base_before_trim=0
+    all_base_after_trim=0
+    all_base_mapped=0
 
     all_unmapped=0
 
@@ -192,6 +198,8 @@
     uC_lst=[0,0,0]
 
     no_my_files=0
+    read_id_lst_1 = dict()
+    read_id_lst_2 = dict()
 
     #----------------------------------------------------------------
     print "== Start mapping =="
@@ -212,11 +220,14 @@
             #----------------------------------------------------------------
             outfile_1FCT = tmp_d('Trimmed_FCT_1.fa'+random_id)
             outfile_1RCT = tmp_d('Trimmed_RCT_1.fa'+random_id)
-            outfile_2FCT = tmp_d('Trimmed_FCT_2.fa'+random_id)
+            outfile_2RGA = tmp_d('Trimmed_FCT_2.fa'+random_id)
             outfile_2RCT = tmp_d('Trimmed_RCT_2.fa'+random_id)
 
             try :
-                read_inf = open(tmp_d(read_file_1),"r")
+                if read_file_1.endswith(".gz") : # support input file ending with ".gz"
+                    read_inf = gzip.open(tmp_d(read_file_1), "rb")
+                else :
+                    read_inf = open(tmp_d(read_file_1),"r")
             except IOError :
                 print "[Error] Cannot open file : %s", tmp_d(read_file_1)
                 exit(-1)
@@ -226,128 +237,131 @@
 
             if oneline[0]=="@":	# Illumina GAII FastQ (Lister et al Nature 2009)
                 input_format="fastq"
-                n_fastq=0
             elif len(l)==1 and oneline[0]!=">": 	# pure sequences
                 input_format="seq"
             elif len(l)==11:	# Illumina GAII qseq file
                 input_format="qseq"
             elif oneline[0]==">":	# fasta
                 input_format="fasta"
-                n_fasta=0
             read_inf.close()
 
             print "Detected data format: %s" % input_format
 
             #----------------------------------------------------------------
             read_file_list   = [read_file_1, read_file_2]
-            outfile_FCT_list = [outfile_1FCT, outfile_2FCT]
+            outfile_FCT_list = [outfile_1FCT, outfile_2RGA]
             outfile_RCT_list = [outfile_1RCT, outfile_2RCT]
             n_list = [0, 0]
-
-
             for f in range(2):
                 read_file = read_file_list[f]
                 outf_FCT = open(outfile_FCT_list[f], 'w')
-                outf_RCT = open(outfile_RCT_list[f], 'w')
+                outf_RGA = open(outfile_RCT_list[f], 'w')
                 original_bs_reads = original_bs_reads_lst[f]
                 n = n_list[f]
-
-                seq_id = ""
+                read_id = ""
                 seq = ""
                 seq_ready = "N"
+                line_no = 0
                 for line in fileinput.input(tmp_d(read_file)):
-                    l=line.split()
+                    l = line.split()
+                    line_no += 1
                     if input_format=="seq":
-                        n+=1
-                        seq_id=str(n)
-                        seq_id=seq_id.zfill(12)
-                        seq=l[0]
-                        seq_ready="Y"
+                        n += 1
+                        read_id = str(n)
+                        read_id = read_id.zfill(12)
+                        if f == 1 :
+                            read_id_lst_1[read_id] = read_id
+                        else :
+                            read_id_lst_2[read_id] = read_id
+                        seq = l[0]
+                        seq_ready = "Y"
                     elif input_format=="fastq":
-                        m_fastq=math.fmod(n_fastq,4)
-                        n_fastq+=1
-                        seq_ready="N"
-                        if m_fastq==0:
-                            n+=1
-                            seq_id=str(n)
-                            seq_id=seq_id.zfill(12)
-                            seq=""
-                        elif m_fastq==1:
-                            seq=l[0]
-                            seq_ready="Y"
-                        else:
-                            seq=""
+                        l_fastq = math.fmod(line_no, 4)
+                        if l_fastq==1 :
+                            all_raw_reads += 1
+                            read_id = str(line_no/4+1).zfill(12)
+                            if f==1 :
+                                read_id_lst_1[read_id] = l[0][1:]
+                            else :
+                                read_id_lst_2[read_id] = l[0][1:]
+                            seq_ready="N"
+                        elif l_fastq==2 :
+                            seq = l[0]
+                            seq_ready = "Y"
+                        else :
+                            seq = ""
+                            seq_ready = "N"
                     elif input_format=="qseq":
-                        n+=1
-                        seq_id=str(n)
-                        seq_id=seq_id.zfill(12)
-                        seq=l[8]
-                        seq_ready="Y"
+                        all_raw_reads += 1
+                        read_id = str(line_no)
+                        read_id = read_id.zfill(12)
+                        if f == 1 :
+                            read_id_lst_1[read_id] = l[0][1:]
+                        else :
+                            read_id_lst_2[read_id] = l[0][1:]
+                        seq = l[8]
+                        seq_ready = "Y"
                     elif input_format=="fasta":
-                        m_fasta=math.fmod(n_fasta,2)
-                        n_fasta+=1
-                        seq_ready="N"
-                        if m_fasta==0:
-                            n+=1
-                            seq_id=l[0][1:]
-                            seq_id=seq_id.zfill(17)
-                            seq=""
-                        elif m_fasta==1:
-                            seq=l[0]
-                            seq_ready="Y"
-                        else:
-                            seq=""
+                        l_fasta = math.fmod(line_no,2)
+                        seq_ready = "N"
+                        if l_fasta==1:
+                            all_raw_reads += 1
+                            read_id = str(line_no/2+1).zfill(12)
+                            if f==1 :
+                                read_id_lst_1[read_id] = l[0][1:]
+                            else :
+                                read_id_lst_2[read_id] = l[0][1:]
+                            seq = ""
+                        elif l_fasta==0 :
+                            seq = l[0]
+                            seq_ready = "Y"
                     #----------------------------------------------------------------
                     if seq_ready=="Y":
-                        seq=seq[cut1-1:cut2] #------- selecting 0..52 from 1..72  -e 52
-                        seq=seq.upper()
-                        seq=seq.replace(".","N")
+                        seq = seq[cut1-1:cut2] #------- selecting 0..52 from 1..72  -e 52
+                        seq = seq.upper()
+                        seq = seq.replace(".","N")
 
                         #--striping BS adapter from 3' read --------------------------------------------------------------
-                        if (adapterA !="") and (adapterB !=""):
-                            signature=adapterA[:6]
-                            if signature in seq:
-                                signature_pos=seq.index(signature)
-                                if seq[signature_pos:] in adapterA:
-                                    seq=seq[:signature_pos]#+"".join(["N" for x in range(len(seq)-len(signature_pos))])
-                                    all_trimmed+=1
-                            else:
-                                signature=adapterB[:6]
-                                if signature in seq:
-                                    #print seq_id,seq,signature;
-                                    signature_pos=seq.index(signature)
-                                    if seq[signature_pos:] in adapterB:
-                                        seq=seq[:signature_pos]#+"".join(["N" for x in range(len(seq)-len(signature_pos))])
-                                        all_trimmed+=1
+                        all_base_before_trim += len(seq)
+                        if f==0 and adapterA!="" :
+                            new_read = RemoveAdapter(seq, adapterA, adapter_mismatch)
+                            if len(new_read)<len(seq) :
+                                all_trimmed += 1
+                            seq = new_read
+                        if f==1 and adapterB!="" :
+                            new_read = RemoveAdapter(seq, adapterB, adapter_mismatch)
+                            if len(new_read)<len(seq) :
+                                all_trimmed += 1
+                            seq = new_read
+                        all_base_after_trim += len(seq)
 
-                        if len(seq) <= 4:
+                        if len(seq)<=4:
                             seq = "N" * (cut2-cut1+1)
                         #---------  trimmed_raw_BS_read  ------------------
-                        original_bs_reads[seq_id] = seq
+                        original_bs_reads[read_id] = seq
 
                         #---------  FW_C2T  ------------------
-                        outf_FCT.write('>%s\n%s\n' % (seq_id, seq.replace("C","T")))
+                        outf_FCT.write('>%s\n%s\n' % (read_id, seq.replace("C","T")))
                         #---------  RC_G2A  ------------------
-                        outf_RCT.write('>%s\n%s\n' % (seq_id, seq.replace("G","A")))
+                        outf_RGA.write('>%s\n%s\n' % (read_id, seq.replace("G","A")))
 
-                n_list[f]=n
+                n_list[f] = n
 
                 outf_FCT.close()
-                outf_RCT.close()
+                outf_RGA.close()
 
                 fileinput.close()
 
-
             #print "All input end 1: %d , end 2: %d "%(n_list[0],n_list[1]);
-            all_raw_reads+=n
+            all_raw_reads += n
 
             #--------------------------------------------------------------------------------
             # Bowtie mapping
             #--------------------------------------------------------------------------------
-            WC2T_fr=tmp_d("W_C2T_fr_m"+max_mismatch_no+".mapping"+random_id)
-            WC2T_rf=tmp_d("W_C2T_rf_m"+max_mismatch_no+".mapping"+random_id)
-            CC2T_fr=tmp_d("C_C2T_fr_m"+max_mismatch_no+".mapping"+random_id)
-            CC2T_rf=tmp_d("C_C2T_rf_m"+max_mismatch_no+".mapping"+random_id)
+            WC2T_fr = tmp_d("W_C2T_fr_m"+max_mismatch_no+".mapping"+random_id)
+            WC2T_rf = tmp_d("W_C2T_rf_m"+max_mismatch_no+".mapping"+random_id)
+            CG2A_fr = tmp_d("C_C2T_fr_m"+max_mismatch_no+".mapping"+random_id)
+            CC2T_rf = tmp_d("C_C2T_rf_m"+max_mismatch_no+".mapping"+random_id)
 
             run_in_parallel([aligner_command % {'reference_genome' : os.path.join(db_path,'W_C2T'),
                                                       'input_file_1' : outfile_1FCT,
@@ -357,64 +371,62 @@
                              aligner_command % {'reference_genome' : os.path.join(db_path,'C_C2T'),
                                                       'input_file_1' : outfile_1FCT,
                                                       'input_file_2' : outfile_2RCT,
-                                                      'output_file' : CC2T_fr},
+                                                      'output_file' : CG2A_fr},
 
                              aligner_command % {'reference_genome' : os.path.join(db_path,'W_C2T'),
-                                                      'input_file_1' : outfile_2FCT,
+                                                      'input_file_1' : outfile_2RGA,
                                                       'input_file_2' : outfile_1RCT,
                                                       'output_file' : WC2T_rf},
 
                              aligner_command % {'reference_genome' : os.path.join(db_path,'C_C2T'),
-                                                      'input_file_1' : outfile_2FCT,
+                                                      'input_file_1' : outfile_2RGA,
                                                       'input_file_2' : outfile_1RCT,
                                                       'output_file' : CC2T_rf}])
 
-
-            delete_files(outfile_1FCT, outfile_2FCT, outfile_1RCT, outfile_2RCT)
+            delete_files(outfile_1FCT, outfile_2RGA, outfile_1RCT, outfile_2RCT)
 
 
             #--------------------------------------------------------------------------------
             # Post processing
             #--------------------------------------------------------------------------------
 
-
             FW_C2T_fr_U, FW_C2T_fr_R = extract_mapping(WC2T_fr)
             FW_C2T_rf_U, FW_C2T_rf_R = extract_mapping(WC2T_rf)
-            RC_C2T_fr_U, RC_C2T_fr_R = extract_mapping(CC2T_fr)
+            RC_G2A_fr_U, RC_G2A_fr_R = extract_mapping(CG2A_fr)
             RC_C2T_rf_U, RC_C2T_rf_R = extract_mapping(CC2T_rf)
 
-            delete_files(WC2T_fr, WC2T_rf, CC2T_fr, CC2T_rf)
+            delete_files(WC2T_fr, WC2T_rf, CG2A_fr, CC2T_rf)
 
             #----------------------------------------------------------------
             # get uniq-hit reads
             #----------------------------------------------------------------
-            Union_set=set(FW_C2T_fr_U.iterkeys()) | set(FW_C2T_rf_U.iterkeys()) | set(RC_C2T_fr_U.iterkeys()) | set(RC_C2T_rf_U.iterkeys())
+            Union_set = set(FW_C2T_fr_U.iterkeys()) | set(FW_C2T_rf_U.iterkeys()) | set(RC_G2A_fr_U.iterkeys()) | set(RC_C2T_rf_U.iterkeys())
 
-            Unique_FW_fr_C2T=set() # +
-            Unique_FW_rf_C2T=set() # +
-            Unique_RC_fr_C2T=set() # -
-            Unique_RC_rf_C2T=set() # -
-            Multiple_hits=set()
+            Unique_FW_fr_C2T = set() # +
+            Unique_FW_rf_C2T = set() # +
+            Unique_RC_fr_G2A = set() # -
+            Unique_RC_rf_C2T = set() # -
+            Multiple_hits = set()
 
 
             for x in Union_set:
-                _list=[]
-                for d in [FW_C2T_fr_U, FW_C2T_rf_U, RC_C2T_fr_U, RC_C2T_rf_U]:
-                    mis_lst=d.get(x,[99])
-                    mis=int(mis_lst[0])
+                _list = []
+                for d in [FW_C2T_fr_U, FW_C2T_rf_U, RC_G2A_fr_U, RC_C2T_rf_U]:
+                    mis_lst = d.get(x,[99])
+                    mis = int(mis_lst[0])
                     _list.append(mis)
-                for d in [FW_C2T_fr_R, FW_C2T_rf_R, RC_C2T_fr_R, RC_C2T_rf_R]:
-                    mis=d.get(x,99)
+                for d in [FW_C2T_fr_R, FW_C2T_rf_R, RC_G2A_fr_R, RC_C2T_rf_R]:
+                    mis = d.get(x,99)
                     _list.append(mis)
-                mini=min(_list)
+                mini = min(_list)
                 if _list.count(mini)==1:
-                    mini_index=_list.index(mini)
+                    mini_index = _list.index(mini)
                     if mini_index==0:
                         Unique_FW_fr_C2T.add(x)
                     elif mini_index==1:
                         Unique_FW_rf_C2T.add(x)
                     elif mini_index==2:
-                        Unique_RC_fr_C2T.add(x)
+                        Unique_RC_fr_G2A.add(x)
                     elif mini_index==3:
                         Unique_RC_rf_C2T.add(x)
                     else :
@@ -424,7 +436,7 @@
 
             # write reads rejected by Multiple Hits to file
             if show_multiple_hit :
-                outf_MH=open("Multiple_hit.fa",'w')
+                outf_MH = open("Multiple_hit.fa",'w')
                 for i in Multiple_hits :
                     outf_MH.write(">%s\n" % i)
                     outf_MH.write("%s\n" % original_bs_reads[i])
@@ -433,32 +445,32 @@
             del Union_set
             del FW_C2T_fr_R
             del FW_C2T_rf_R
-            del RC_C2T_fr_R
+            del RC_G2A_fr_R
             del RC_C2T_rf_R
 
-            FW_C2T_fr_uniq_lst=[[FW_C2T_fr_U[u][1],u] for u in Unique_FW_fr_C2T]
-            FW_C2T_rf_uniq_lst=[[FW_C2T_rf_U[u][1],u] for u in Unique_FW_rf_C2T]
-            RC_C2T_fr_uniq_lst=[[RC_C2T_fr_U[u][1],u] for u in Unique_RC_fr_C2T]
-            RC_C2T_rf_uniq_lst=[[RC_C2T_rf_U[u][1],u] for u in Unique_RC_rf_C2T]
+            FW_C2T_fr_uniq_lst = [[FW_C2T_fr_U[u][1],u] for u in Unique_FW_fr_C2T]
+            FW_C2T_rf_uniq_lst = [[FW_C2T_rf_U[u][1],u] for u in Unique_FW_rf_C2T]
+            RC_C2T_fr_uniq_lst = [[RC_G2A_fr_U[u][1],u] for u in Unique_RC_fr_G2A]
+            RC_C2T_rf_uniq_lst = [[RC_C2T_rf_U[u][1],u] for u in Unique_RC_rf_C2T]
 
             FW_C2T_fr_uniq_lst.sort()
             FW_C2T_rf_uniq_lst.sort()
             RC_C2T_fr_uniq_lst.sort()
             RC_C2T_rf_uniq_lst.sort()
-            FW_C2T_fr_uniq_lst=[x[1] for x in FW_C2T_fr_uniq_lst]
-            FW_C2T_rf_uniq_lst=[x[1] for x in FW_C2T_rf_uniq_lst]
-            RC_C2T_fr_uniq_lst=[x[1] for x in RC_C2T_fr_uniq_lst]
-            RC_C2T_rf_uniq_lst=[x[1] for x in RC_C2T_rf_uniq_lst]
+            FW_C2T_fr_uniq_lst = [x[1] for x in FW_C2T_fr_uniq_lst]
+            FW_C2T_rf_uniq_lst = [x[1] for x in FW_C2T_rf_uniq_lst]
+            RC_C2T_fr_uniq_lst = [x[1] for x in RC_C2T_fr_uniq_lst]
+            RC_C2T_rf_uniq_lst = [x[1] for x in RC_C2T_rf_uniq_lst]
             #----------------------------------------------------------------
 
-            numbers_premapped_lst[0]+=len(Unique_FW_fr_C2T)
-            numbers_premapped_lst[1]+=len(Unique_FW_rf_C2T)
-            numbers_premapped_lst[2]+=len(Unique_RC_fr_C2T)
-            numbers_premapped_lst[3]+=len(Unique_RC_rf_C2T)
+            numbers_premapped_lst[0] += len(Unique_FW_fr_C2T)
+            numbers_premapped_lst[1] += len(Unique_FW_rf_C2T)
+            numbers_premapped_lst[2] += len(Unique_RC_fr_G2A)
+            numbers_premapped_lst[3] += len(Unique_RC_rf_C2T)
 
             del Unique_FW_fr_C2T
             del Unique_FW_rf_C2T
-            del Unique_RC_fr_C2T
+            del Unique_RC_fr_G2A
             del Unique_RC_rf_C2T
 
             #----------------------------------------------------------------
@@ -466,7 +478,7 @@
             nn = 0
             for ali_unique_lst, ali_dic in [(FW_C2T_fr_uniq_lst,FW_C2T_fr_U),
                                             (FW_C2T_rf_uniq_lst,FW_C2T_rf_U),
-                                            (RC_C2T_fr_uniq_lst,RC_C2T_fr_U),
+                                            (RC_C2T_fr_uniq_lst,RC_G2A_fr_U),
                                             (RC_C2T_rf_uniq_lst,RC_C2T_rf_U)]:
                 nn += 1
 
@@ -476,15 +488,15 @@
                     _, mapped_chr, mapped_location_1, cigar1, mapped_location_2, cigar2 = ali_dic[header]
 
                     #-------------------------------------
-                    if mapped_chr != mapped_chr0:
-                        my_gseq=deserialize(db_d(mapped_chr))
-                        chr_length=len(my_gseq)
-                        mapped_chr0=mapped_chr
+                    if mapped_chr!=mapped_chr0:
+                        my_gseq = deserialize(db_d(mapped_chr))
+                        chr_length = len(my_gseq)
+                        mapped_chr0 = mapped_chr
                     #-------------------------------------
-                    if nn == 1 or nn == 3:
+                    if nn==1 or nn==3 :
                         original_BS_1 = original_bs_reads_1[header]
                         original_BS_2 = reverse_compl_seq(original_bs_reads_2[header])
-                    else:
+                    else :
                         original_BS_1 = original_bs_reads_2[header]
                         original_BS_2 = reverse_compl_seq(original_bs_reads_1[header])
 
@@ -493,83 +505,41 @@
 
                     all_mapped += 1
 
-                    if nn == 1: 							# FW-RC mapped to + strand:
-
+                    if nn==1 : 							# FW-RC mapped to + strand:
                         FR = "+FR"
-
-#                        mapped_location_1 += 1
-#                        origin_genome_long_1 = my_gseq[mapped_location_1 - 2 - 1 : mapped_location_1 + g_len_1 + 2 - 1]
-#                        origin_genome_1 = origin_genome_long_1[2:-2]
                         mapped_strand_1 = "+"
-
-#                        mapped_location_2 += 1
-#                        origin_genome_long_2 = my_gseq[mapped_location_2 - 2 - 1 : mapped_location_2 + g_len_2 + 2 - 1]
-#                        origin_genome_2 = origin_genome_long_2[2:-2]
                         mapped_strand_2 = "+"
-
-                    elif nn==2: 							# RC-FW mapped to + strand:
-
-#                        original_BS_1 = original_bs_reads_2[header]
-#                        original_BS_2 = reverse_compl_seq(original_bs_reads_1[header])
+                    elif nn==2 : 							# RC-FW mapped to + strand:
                         FR = "+RF"
-#                        mapped_location_1 += 1
-#                        origin_genome_long_1 = my_gseq[mapped_location_1 - 2 - 1 : mapped_location_1 + g_len_1 + 2 - 1]
-#                        origin_genome_1 = origin_genome_long_1[2:-2]
                         mapped_strand_1 = "+"
-
-#                        mapped_location_2 += 1
-#                        origin_genome_long_2 = my_gseq[mapped_location_2 - 2 - 1 : mapped_location_2 + g_len_2 + 2 - 1]
-#                        origin_genome_2 = origin_genome_long_2[2:-2]
                         mapped_strand_2 = "+"
-
-
-                    elif nn==3: 						# FW-RC mapped to - strand:
-#                        original_BS_1=original_bs_reads_1[header]
-#                        original_BS_2=reverse_compl_seq(original_bs_reads_2[header])
-
+                    elif nn==3 : 						# FW-RC mapped to - strand:
                         FR = "-FR"
                         mapped_location_1 = chr_length - mapped_location_1 - g_len_1
-#                        origin_genome_long_1 = my_gseq[mapped_location_1 - 2 - 1 : mapped_location_1 + g_len_1 + 2 - 1]
-#                        origin_genome_long_1 = reverse_compl_seq(origin_genome_long_1)
-#                        origin_genome_1 = origin_genome_long_1[2:-2]
                         mapped_strand_1 = "-"
-
                         mapped_location_2 = chr_length - mapped_location_2 - g_len_2
-#                        origin_genome_long_2 = reverse_compl_seq(my_gseq[mapped_location_2 - 2 - 1 : mapped_location_2 + g_len_2 + 2 - 1 ])
-#                        origin_genome_2 = origin_genome_long_2[2:-2]
                         mapped_strand_2 = "-"
-
-                    elif nn==4: 						# RC-FW mapped to - strand:
-#                        original_BS_1=original_bs_reads_2[header]
-#                        original_BS_2=reverse_compl_seq(original_bs_reads_1[header])
-
+                    elif nn==4 : 						# RC-FW mapped to - strand:
                         FR = "-RF"
                         mapped_location_1 = chr_length - mapped_location_1 - g_len_1
-#                        origin_genome_long_1 = my_gseq[mapped_location_1 - 2 - 1 : mapped_location_1 + g_len_1 + 2 - 1]
-#                        origin_genome_long_1 = reverse_compl_seq(origin_genome_long_1)
-#                        origin_genome_1 = origin_genome_long_1[2:-2]
                         mapped_strand_1 = "-"
-
                         mapped_location_2 = chr_length - mapped_location_2 - g_len_2
-#                        origin_genome_long_2 = reverse_compl_seq(my_gseq[mapped_location_2 - 2 - 1 : mapped_location_2 + g_len_2 + 2 - 1])
-#                        origin_genome_2 = origin_genome_long_2[2:-2]
                         mapped_strand_2 = "-"
 
-
-
-
                     origin_genome_1, next_1, output_genome_1 = get_genomic_sequence(my_gseq, mapped_location_1, mapped_location_1 + g_len_1, mapped_strand_1)
                     origin_genome_2, next_2, output_genome_2 = get_genomic_sequence(my_gseq, mapped_location_2, mapped_location_2 + g_len_2, mapped_strand_2)
 
                     r_aln_1, g_aln_1 = cigar_to_alignment(cigar1, original_BS_1, origin_genome_1)
                     r_aln_2, g_aln_2 = cigar_to_alignment(cigar2, original_BS_2, origin_genome_2)
 
-
                     N_mismatch_1 = N_MIS(r_aln_1, g_aln_1) #+ original_BS_length_1 - (r_end_1 - r_start_1) # mismatches in the alignment + soft clipped nucleotides
                     N_mismatch_2 = N_MIS(r_aln_2, g_aln_2) #+ original_BS_length_2 - (r_end_2 - r_start_2) # mismatches in the alignment + soft clipped nucleotides
 
+                    N_mismatch = max(N_mismatch_1, N_mismatch_2)
+                    mm_no=float(max_mismatch_no)
+                    if (mm_no>=1 and N_mismatch<=mm_no) or (mm_no<1 and N_mismatch_1<=mm_no*len(original_BS_1)
+                            and N_mismatch_2<=mm_no*len(original_BS_2)):
 
-                    if max(N_mismatch_1, N_mismatch_2) <= int(max_mismatch_no) :
                         all_mapped_passed += 1
                         numbers_mapped_lst[nn-1] += 1
                         #---- unmapped -------------------------
@@ -577,43 +547,46 @@
                         del original_bs_reads_2[header]
                         #---------------------------------------
 
-#                        output_genome_1 = origin_genome_long_1[0:2] + "_" + origin_genome_1 + "_" + origin_genome_long_1[-2:]
-#                        output_genome_2 = origin_genome_long_2[0:2] + "_" + origin_genome_2 + "_" + origin_genome_long_2[-2:]
-
-                        methy_1=methy_seq(r_aln_1, g_aln_1 + next_1)
-                        methy_2=methy_seq(r_aln_2, g_aln_2 + next_2)
+                        methy_1 = methy_seq(r_aln_1, g_aln_1 + next_1)
+                        methy_2 = methy_seq(r_aln_2, g_aln_2 + next_2)
 
                         mC_lst, uC_lst = mcounts(methy_1, mC_lst, uC_lst)
                         mC_lst, uC_lst = mcounts(methy_2, mC_lst, uC_lst)
 
-
-                        # 
                         #---XS FILTER----------------
-                        #XS = 1 if "ZZZ" in methy.replace('-', '') else 0
                         XS_1 = 0
                         nCH_1 = methy_1.count('y') + methy_1.count('z')
                         nmCH_1 = methy_1.count('Y') + methy_1.count('Z')
                         if( (nmCH_1>XS_count) and nmCH_1/float(nCH_1+nmCH_1)>XS_pct ) :
                             XS_1 = 1
-                        #XS = 1 if "ZZZ" in methy.replace('-', '') else 0
                         XS_2 = 0
                         nCH_2 = methy_2.count('y') + methy_2.count('z')
                         nmCH_2 = methy_2.count('Y') + methy_2.count('Z')
                         if( (nmCH_2>XS_count) and nmCH_2/float(nCH_2+nmCH_2)>XS_pct ) :
                             XS_2 = 1
 
+                        if mapped_strand_1=='+' :
+                            flag_1 = 67     # 1000011   : 1st read, + strand
+                            flag_2 = 131    #10000011   : 2nd read, + strand
+                        else :
+                            flag_1 = 115    # 1110011   : 1st read, - strand
+                            flag_2 = 179    # 10110011  : 2nd read, - strand
 
-                        outfile.store(header, N_mismatch_1, FR, mapped_chr, mapped_strand_1, mapped_location_1, cigar1, original_BS_1, methy_1, XS_1,
+                        outfile.store2( read_id_lst_1[header], flag_1, N_mismatch_1, FR, mapped_chr, mapped_strand_1, mapped_location_1, cigar1, original_BS_1, methy_1, XS_1,
                             output_genome = output_genome_1, rnext = mapped_chr, pnext = mapped_location_2)
-                        outfile.store(header, N_mismatch_2, FR, mapped_chr, mapped_strand_2, mapped_location_2, cigar2, original_BS_2, methy_2, XS_2,
+                        all_base_mapped += len(original_BS_1)
+
+                        outfile.store2( read_id_lst_2[header], flag_2, N_mismatch_2, FR, mapped_chr, mapped_strand_2, mapped_location_2, cigar2, original_BS_2, methy_2, XS_2,
                             output_genome = output_genome_2, rnext = mapped_chr, pnext = mapped_location_1)
+                        all_base_mapped += len(original_BS_2)
+
 
             print "--> %s %s (%d/%d) " % (read_file_1, read_file_2, no_my_files, len(my_files))
             #----------------------------------------------------------------
             #	output unmapped pairs
             #----------------------------------------------------------------
 
-            unmapped_lst=original_bs_reads_1.keys()
+            unmapped_lst = original_bs_reads_1.keys()
             unmapped_lst.sort()
 
 #            for u in unmapped_lst:
@@ -623,189 +596,188 @@
             all_unmapped += len(unmapped_lst)
 
 
+        #  Directional library
         if asktag=="N":
 
             #----------------------------------------------------------------
-            outfile_1FCT= tmp_d('Trimed_FCT_1.fa'+random_id)
-            outfile_2FCT= tmp_d('Trimed_FCT_2.fa'+random_id)
+            outfile_1FCT = tmp_d('Trimed_FCT_1.fa'+random_id)
+            outfile_2RGA = tmp_d('Trimed_RGA_2.fa'+random_id)
 
             try :
-                read_inf=open(tmp_d(read_file_1),"r")
+                if read_file_1.endswith(".gz") : # support input file ending with ".gz"
+                    read_inf = gzip.open(tmp_d(read_file_1), "rb")
+                else :
+                    read_inf = open(tmp_d(read_file_1),"r")
             except IOError :
                 print "[Error] Cannot open file : %s", tmp_d(read_file_1)
                 exit(-1)
 
-            oneline=read_inf.readline()
-            l=oneline.split()
-            input_format=""
-
-            #if len(l)==5: # old solexa format
-            #	input_format="old Solexa Seq file"
+            oneline = read_inf.readline()
+            l = oneline.split()
+            input_format = ""
 
-            if oneline[0]=="@":	# Illumina GAII FastQ (Lister et al Nature 2009)
-                input_format="FastQ"
-                n_fastq=0
-            elif len(l)==1 and oneline[0]!=">": 	# pure sequences
-                input_format="_list of sequences"
-            elif len(l)==11:	# Illumina GAII qseq file
-                input_format="Illumina GAII qseq file"
-            elif oneline[0]==">":	# fasta
-                input_format="fasta"
-                n_fasta=0
+            if oneline[0]=="@" :
+                input_format = "fastq"
+            elif len(l)==1 and oneline[0]!=">" :
+                input_format = "seq"
+            elif len(l)==11 :
+                input_format = "qseq"
+            elif oneline[0]==">" :
+                input_format = "fasta"
 
             read_inf.close()
 
             print "Detected data format: %s" % input_format
 
             #----------------------------------------------------------------
-            read_file_list=[read_file_1,read_file_2]
-            outfile_FCT_list=[outfile_1FCT,outfile_2FCT]
-            n_list=[0,0]
+            read_file_list = [read_file_1,read_file_2]
+            outfile_FCT_list = [outfile_1FCT,outfile_2RGA]
+            n_list = [0,0]
 
             for f in range(2):
-                read_file=read_file_list[f]
-                outf_FCT=open(outfile_FCT_list[f],'w')
+                read_file = read_file_list[f]
+                outf_FCT = open(outfile_FCT_list[f],'w')
                 original_bs_reads = original_bs_reads_lst[f]
-                n=n_list[f]
+                n = n_list[f]
 
-                seq_id=""
-                seq=""
-                seq_ready="N"
+                read_id = ""
+                seq = ""
+                seq_ready = "N"
+                line_no = 0
                 for line in fileinput.input(tmp_d(read_file)):
-                    l=line.split()
-                    if input_format=="old Solexa Seq file":
-                        n+=1
-                        seq_id=str(n)
-                        seq_id=seq_id.zfill(12)
-                        seq=l[4]
-                        seq_ready="Y"
-                    elif input_format=="_list of sequences":
-                        n+=1
-                        seq_id=str(n)
-                        seq_id=seq_id.zfill(12)
-                        seq=l[0]
-                        seq_ready="Y"
-                    elif input_format=="FastQ":
-                        m_fastq=math.fmod(n_fastq,4)
-                        n_fastq+=1
-                        seq_ready="N"
-                        if m_fastq==0:
-                            n+=1
-                            seq_id=str(n)
-                            seq_id=seq_id.zfill(12)
-                            seq=""
-                        elif m_fastq==1:
-                            seq=l[0]
-                            seq_ready="Y"
-                        else:
-                            seq=""
-                    elif input_format=="Illumina GAII qseq file":
-                        n+=1
-                        seq_id=str(n)
-                        seq_id=seq_id.zfill(12)
-                        seq=l[8]
-                        seq_ready="Y"
+                    l = line.split()
+                    line_no += 1
+                    if input_format=="seq":
+                        n += 1
+                        read_id = str(n)
+                        read_id = read_id.zfill(12)
+                        if f == 1 :
+                            read_id_lst_1[read_id] = read_id
+                        else :
+                            read_id_lst_2[read_id] = read_id
+                        seq = l[0]
+                        seq_ready = "Y"
+                    elif input_format=="fastq":
+                        l_fastq = math.fmod(line_no, 4)
+                        if l_fastq==1 :
+                            all_raw_reads += 1
+                            read_id = str(line_no/4+1).zfill(12)
+                            if f==1 :
+                                read_id_lst_1[read_id] = l[0][1:]
+                            else :
+                                read_id_lst_2[read_id] = l[0][1:]
+                            seq_ready = "N"
+                        elif l_fastq==2 :
+                            seq = l[0]
+                            seq_ready = "Y"
+                        else :
+                            seq = ""
+                            seq_ready = "N"
+                    elif input_format=="qseq":
+                        all_raw_reads += 1
+                        read_id = str(line_no)
+                        read_id = read_id.zfill(12)
+                        if f == 1 :
+                            read_id_lst_1[read_id] = l[0][1:]
+                        else :
+                            read_id_lst_2[read_id] = l[0][1:]
+                        seq = l[8]
+                        seq_ready = "Y"
                     elif input_format=="fasta":
-                        m_fasta=math.fmod(n_fasta,2)
-                        n_fasta+=1
-                        seq_ready="N"
-                        if m_fasta==0:
-                            n+=1
-                            seq_id=l[0][1:]
-                            seq_id=seq_id.zfill(17)
-                            seq=""
-                        elif m_fasta==1:
-                            seq=l[0]
-                            seq_ready="Y"
-                        else:
-                            seq=""
+                        l_fasta = math.fmod(line_no,2)
+                        if l_fasta==1:
+                            seq_ready = "N"
+                            all_raw_reads += 1
+                            read_id = str(line_no/2+1).zfill(12)
+                            if f == 1 :
+                                read_id_lst_1[read_id] = l[0][1:]
+                            else :
+                                read_id_lst_2[read_id] = l[0][1:]
+                            seq = ""
+                        elif l_fasta==0 :
+                            seq = l[0]
+                            seq_ready = "Y"
                     #----------------------------------------------------------------
                     if seq_ready=="Y":
-                        seq=seq[cut1-1:cut2] #<----------------------selecting 0..52 from 1..72  -e 52
-                        seq=seq.upper()
-                        seq=seq.replace(".","N")
+                        seq = seq[cut1-1:cut2] #<----------------------selecting 0..52 from 1..72  -e 52
+                        seq = seq.upper()
+                        seq = seq.replace(".","N")
 
                         #--striping BS adapter from 3' read --------------------------------------------------------------
-                        if (adapterA !="") and (adapterB !=""):
-                            signature=adapterA[:6]
-                            if signature in seq:
-                                signature_pos=seq.index(signature)
-                                if seq[signature_pos:] in adapterA:
-                                    seq=seq[:signature_pos]#+"".join(["N" for x in range(len(seq)-len(signature_pos))])
-                                    all_trimmed+=1
-                            else:
-                                signature=adapterB[:6]
-                                if signature in seq:
-                                    #print seq_id,seq,signature;
-                                    signature_pos=seq.index(signature)
-                                    if seq[signature_pos:] in adapterB:
-                                        seq=seq[:signature_pos]#+"".join(["N" for x in range(len(seq)-len(signature_pos))])
-                                        all_trimmed+=1
+                        all_base_before_trim += len(seq)
+                        if f==0 and adapterA!="" :
+                            new_read = RemoveAdapter(seq, adapterA, adapter_mismatch)
+                            if len(new_read) < len(seq) :
+                                all_trimmed += 1
+                            seq = new_read
+                        if f==1 and adapterB!="" :
+                            new_read = RemoveAdapter(seq, adapterB, adapter_mismatch)
+                            if len(new_read)<len(seq) :
+                                all_trimmed += 1
+                            seq = new_read
+                        all_base_after_trim += len(seq)
 
-                        if len(seq) <= 4:
+                        if len(seq)<=4:
                             seq = "N" * (cut2-cut1+1)
                         #---------  trimmed_raw_BS_read  ------------------
-                        original_bs_reads[seq_id] = seq
+                        original_bs_reads[read_id] = seq
 
                         #---------  FW_C2T  ------------------
                         if f==0:
-                            outf_FCT.write('>%s\n%s\n'% (seq_id, seq.replace("C","T")))
+                            outf_FCT.write('>%s\n%s\n'% (read_id, seq.replace("C","T")))
                         elif f==1:
-                            outf_FCT.write('>%s\n%s\n'% (seq_id, reverse_compl_seq(seq).replace("C","T")))
+                            outf_FCT.write('>%s\n%s\n'% (read_id, seq.replace("G","A")))
 
-
-                n_list[f]=n
+                n_list[f] = n
                 outf_FCT.close()
-
                 fileinput.close()
 
-
             #print "All input end 1: %d , end 2: %d "%(n_list[0],n_list[1]);
-            all_raw_reads+=n
+            all_raw_reads += n
 
             #--------------------------------------------------------------------------------
             # Bowtie mapping
             #--------------------------------------------------------------------------------
-            WC2T_fr=tmp_d("W_C2T_fr_m"+max_mismatch_no+".mapping"+random_id)
-            CC2T_fr=tmp_d("C_C2T_fr_m"+max_mismatch_no+".mapping"+random_id)
+            WC2T_fr = tmp_d("W_C2T_fr_m"+max_mismatch_no+".mapping"+random_id)
+            CG2A_fr = tmp_d("C_C2T_fr_m"+max_mismatch_no+".mapping"+random_id)
 
             run_in_parallel([ aligner_command % {'reference_genome' : os.path.join(db_path,'W_C2T'),
                                          'input_file_1' : outfile_1FCT,
-                                         'input_file_2' : outfile_2FCT,
+                                         'input_file_2' : outfile_2RGA,
                                          'output_file' : WC2T_fr},
 
                               aligner_command % {'reference_genome' : os.path.join(db_path,'C_C2T'),
                                          'input_file_1' : outfile_1FCT,
-                                         'input_file_2' : outfile_2FCT,
-                                         'output_file' : CC2T_fr} ])
+                                         'input_file_2' : outfile_2RGA,
+                                         'output_file' : CG2A_fr} ])
 
 
-            delete_files(outfile_1FCT, outfile_2FCT)
+            delete_files(outfile_1FCT, outfile_2RGA)
 
             #--------------------------------------------------------------------------------
             # Post processing
             #--------------------------------------------------------------------------------
 
             FW_C2T_fr_U, FW_C2T_fr_R = extract_mapping(WC2T_fr)
-            RC_C2T_fr_U, RC_C2T_fr_R = extract_mapping(CC2T_fr)
+            RC_G2A_fr_U, RC_G2A_fr_R = extract_mapping(CG2A_fr)
 
             #----------------------------------------------------------------
             # get uniq-hit reads
             #----------------------------------------------------------------
-            Union_set = set(FW_C2T_fr_U.iterkeys()) | set(RC_C2T_fr_U.iterkeys())
+            Union_set = set(FW_C2T_fr_U.iterkeys()) | set(RC_G2A_fr_U.iterkeys())
 
             Unique_FW_fr_C2T = set() # +
-            Unique_RC_fr_C2T = set() # -
+            Unique_RC_fr_G2A = set() # -
             Multiple_hits=set()
 
 
             for x in Union_set:
                 _list = []
-                for d in [FW_C2T_fr_U, RC_C2T_fr_U]:
+                for d in [FW_C2T_fr_U, RC_G2A_fr_U]:
                     mis_lst = d.get(x,[99])
                     mis = int(mis_lst[0])
                     _list.append(mis)
-                for d in [FW_C2T_fr_R, RC_C2T_fr_R]:
+                for d in [FW_C2T_fr_R, RC_G2A_fr_R]:
                     mis = d.get(x,99)
                     _list.append(mis)
                 mini = min(_list)
@@ -814,7 +786,7 @@
                     if mini_index == 0:
                         Unique_FW_fr_C2T.add(x)
                     elif mini_index == 1:
-                        Unique_RC_fr_C2T.add(x)
+                        Unique_RC_fr_G2A.add(x)
                     else :
                         Multiple_hits.add(x)
                 else :
@@ -822,35 +794,34 @@
 
            # write reads rejected by Multiple Hits to file
             if show_multiple_hit :
-                outf_MH=open("Multiple_hit.fa",'w')
+                outf_MH = open("Multiple_hit.fa",'w')
                 for i in Multiple_hits :
                     outf_MH.write(">%s\n" % i)
                     outf_MH.write("%s\n" % original_bs_reads[i])
                 outf_MH.close()
 
-            FW_C2T_fr_uniq_lst=[[FW_C2T_fr_U[u][1],u] for u in Unique_FW_fr_C2T]
-            RC_C2T_fr_uniq_lst=[[RC_C2T_fr_U[u][1],u] for u in Unique_RC_fr_C2T]
+            FW_C2T_fr_uniq_lst = [[FW_C2T_fr_U[u][1],u] for u in Unique_FW_fr_C2T]
+            RC_C2T_fr_uniq_lst = [[RC_G2A_fr_U[u][1],u] for u in Unique_RC_fr_G2A]
 
             FW_C2T_fr_uniq_lst.sort()
             RC_C2T_fr_uniq_lst.sort()
-            FW_C2T_fr_uniq_lst=[x[1] for x in FW_C2T_fr_uniq_lst]
-            RC_C2T_fr_uniq_lst=[x[1] for x in RC_C2T_fr_uniq_lst]
+            FW_C2T_fr_uniq_lst = [x[1] for x in FW_C2T_fr_uniq_lst]
+            RC_C2T_fr_uniq_lst = [x[1] for x in RC_C2T_fr_uniq_lst]
             #----------------------------------------------------------------
 
-            numbers_premapped_lst[0]+=len(Unique_FW_fr_C2T)
-            numbers_premapped_lst[1]+=len(Unique_RC_fr_C2T)
+            numbers_premapped_lst[0] += len(Unique_FW_fr_C2T)
+            numbers_premapped_lst[1] += len(Unique_RC_fr_G2A)
 
 
             #----------------------------------------------------------------
 
             nn = 0
-            for ali_unique_lst, ali_dic in [(FW_C2T_fr_uniq_lst,FW_C2T_fr_U), (RC_C2T_fr_uniq_lst,RC_C2T_fr_U)]:
+            for ali_unique_lst, ali_dic in [(FW_C2T_fr_uniq_lst,FW_C2T_fr_U), (RC_C2T_fr_uniq_lst,RC_G2A_fr_U)]:
                 nn += 1
                 mapped_chr0 = ""
                 for header in ali_unique_lst:
                     _, mapped_chr, mapped_location_1, cigar1, mapped_location_2, cigar2 = ali_dic[header]
 
-
                     #-------------------------------------
                     if mapped_chr != mapped_chr0:
                         my_gseq = deserialize(db_d(mapped_chr))
@@ -860,6 +831,7 @@
 
                     original_BS_1 = original_bs_reads_1[header]
                     original_BS_2 = reverse_compl_seq(original_bs_reads_2[header])
+                    #original_BS_2 = original_bs_reads_2[header]
 
                     r_start_1, r_end_1, g_len_1 = get_read_start_end_and_genome_length(cigar1)
                     r_start_2, r_end_2, g_len_2 = get_read_start_end_and_genome_length(cigar2)
@@ -868,43 +840,30 @@
 
                     if nn == 1: 							# FW-RC mapped to + strand:
                         FR = "+FR"
-#                        mapped_location_1 += 1
-#                        origin_genome_long_1 = my_gseq[mapped_location_1 - 2 - 1 : mapped_location_1 + g_len_1 + 2 - 1]
-#                        origin_genome_1 = origin_genome_long_1[2:-2]
                         mapped_strand_1 = "+"
-
-#                        mapped_location_2 += 1
-#                        origin_genome_long_2 = my_gseq[mapped_location_2 - 2 - 1 : mapped_location_2 + g_len_2 + 2 - 1]
-#                        origin_genome_2 = origin_genome_long_2[2:-2]
                         mapped_strand_2 = "+"
-
                     elif nn == 2: 						# FW-RC mapped to - strand:
-
                         FR="-FR"
                         mapped_location_1 = chr_length - mapped_location_1 - g_len_1
-#                        origin_genome_long_1 = my_gseq[mapped_location_1 - 2 - 1 : mapped_location_1 + g_len_1 + 2 - 1]
-#                        origin_genome_long_1 = reverse_compl_seq(origin_genome_long_1)
-#                        origin_genome_1 = origin_genome_long_1[2:-2]
                         mapped_strand_1 = "-"
-
                         mapped_location_2 = chr_length - mapped_location_2 - g_len_2
-#                        origin_genome_long_2 = reverse_compl_seq(my_gseq[mapped_location_2 - 2 - 1 : mapped_location_2 + g_len_2 + 2 - 1])
-#                        origin_genome_2 = origin_genome_long_2[2:-2]
                         mapped_strand_2 = "-"
 
-
-
                     origin_genome_1, next_1, output_genome_1 = get_genomic_sequence(my_gseq, mapped_location_1, mapped_location_1 + g_len_1, mapped_strand_1)
                     origin_genome_2, next_2, output_genome_2 = get_genomic_sequence(my_gseq, mapped_location_2, mapped_location_2 + g_len_2, mapped_strand_2)
 
-
                     r_aln_1, g_aln_1 = cigar_to_alignment(cigar1, original_BS_1, origin_genome_1)
                     r_aln_2, g_aln_2 = cigar_to_alignment(cigar2, original_BS_2, origin_genome_2)
 
                     N_mismatch_1 = N_MIS(r_aln_1, g_aln_1) #+ original_BS_length_1 - (r_end_1 - r_start_1) # mismatches in the alignment + soft clipped nucleotides
                     N_mismatch_2 = N_MIS(r_aln_2, g_aln_2) #+ original_BS_length_2 - (r_end_2 - r_start_2) # mismatches in the alignment + soft clipped nucleotides
 
-                    if max(N_mismatch_1, N_mismatch_2) <= int(max_mismatch_no):
+#                    if max(N_mismatch_1, N_mismatch_2) <= int(max_mismatch_no):
+#                    if N_mismatch <= int(max_mismatch_no) :
+                    N_mismatch = max(N_mismatch_1, N_mismatch_2)
+                    mm_no=float(max_mismatch_no)
+                    if (mm_no>=1 and N_mismatch<=mm_no) or (mm_no<1 and N_mismatch_1<=mm_no*len(original_BS_1)
+                            and N_mismatch_2<=mm_no*len(original_BS_2)):
 
                         numbers_mapped_lst[nn-1] += 1
                         all_mapped_passed += 1
@@ -914,8 +873,6 @@
                         del original_bs_reads_2[header]
 
                         #---------------------------------------
-#                        output_genome_1 = origin_genome_long_1[0:2] + "_" + origin_genome_1 + "_" + origin_genome_long_1[-2:]
-#                        output_genome_2 = origin_genome_long_2[0:2] + "_" + origin_genome_2 + "_" + origin_genome_long_2[-2:]
                         methy_1=methy_seq(r_aln_1, g_aln_1 + next_1)
                         methy_2=methy_seq(r_aln_2, g_aln_2 + next_2)
                         mC_lst,uC_lst = mcounts(methy_1, mC_lst, uC_lst)
@@ -936,11 +893,20 @@
                         if( (nmCH_2>XS_count) and nmCH_2/float(nCH_2+nmCH_2)>XS_pct ) :
                             XS_2 = 1
 
+                        if mapped_strand_1 == '+' :
+                            flag_1 = 67     #  1000011   : 1st read, + strand
+                            flag_2 = 131    # 10000011   : 2nd read, + strand
+                        else :
+                            flag_1 = 115    #  1110011   : 1st read, - strand
+                            flag_2 = 179    # 10110011   : 2nd read, - strand
 
-                        outfile.store(header, N_mismatch_1, FR, mapped_chr, mapped_strand_1, mapped_location_1, cigar1, original_BS_1, methy_1, XS_1,
+                        outfile.store2( read_id_lst_1[header], flag_1, N_mismatch_1, FR, mapped_chr, mapped_strand_1, mapped_location_1, cigar1, original_BS_1, methy_1, XS_1,
                                       output_genome = output_genome_1, rnext = mapped_chr, pnext = mapped_location_2)
-                        outfile.store(header, N_mismatch_2, FR, mapped_chr, mapped_strand_2, mapped_location_2, cigar2, original_BS_2, methy_2, XS_2,
+                        all_base_mapped += len(original_BS_1)
+
+                        outfile.store2( read_id_lst_2[header], flag_2, N_mismatch_2, FR, mapped_chr, mapped_strand_2, mapped_location_2, cigar2, original_BS_2, methy_2, XS_2,
                                       output_genome = output_genome_2, rnext = mapped_chr, pnext = mapped_location_1)
+                        all_base_mapped += len(original_BS_2)
 
             print "--> %s %s (%d/%d) " % (read_file_1, read_file_2, no_my_files, len(my_files))
             #----------------------------------------------------------------
@@ -956,45 +922,40 @@
 
             all_unmapped+=len(unmapped_lst)
 
-
     #==================================================================================================
-#    outf.close()
-#
-#    outf_u1.close()
-#    outf_u2.close()
     delete_files(tmp_path)
 
     logm("-------------------------------- " )
-    logm("O Number of raw BS-read pairs: %d ( %d bp)"%(all_raw_reads,cut2-cut1+1) )
-    logm("O Number of ends trimmed for adapter: %d"% all_trimmed+"\n")
+    logm("Number of raw BS-read pairs: %d " %(all_raw_reads/2) )
+    if adapterA != "" or adapterB != "" :
+        logm("Number of reads having adapter removed: %d \n"% all_trimmed)
+        logm("Number of bases after trimming the adapters: %d (%1.3f)" % (all_base_after_trim, float(all_base_after_trim)/all_base_before_trim) )
 
     if all_raw_reads >0:
 
-        logm("O Number of unique-hits read pairs for post-filtering: %d" % all_mapped + "\n")
+        logm("Number of reads rejected because of multiple hits: %d\n" % len(Multiple_hits) )
+        logm("Number of unique-hits reads (before post-filtering): %d" % all_mapped + "\n")
         if asktag=="Y":
-            logm("O -- %7d FW-RC pairs mapped to Watson strand (before post-filtering)"%(numbers_premapped_lst[0]) )
-            logm("O -- %7d RC-FW pairs mapped to Watson strand (before post-filtering)"%(numbers_premapped_lst[1]) )
-            logm("O -- %7d FW-RC pairs mapped to Crick strand (before post-filtering)"%(numbers_premapped_lst[2]) )
-            logm("O -- %7d RC-FW pairs mapped to Crick strand (before post-filtering)"%(numbers_premapped_lst[3]) )
+            logm("-- %7d FW-RC pairs mapped to Watson strand (before post-filtering)"%(numbers_premapped_lst[0]) )
+            logm("-- %7d RC-FW pairs mapped to Watson strand (before post-filtering)"%(numbers_premapped_lst[1]) )
+            logm("-- %7d FW-RC pairs mapped to Crick strand (before post-filtering)"%(numbers_premapped_lst[2]) )
+            logm("-- %7d RC-FW pairs mapped to Crick strand (before post-filtering)"%(numbers_premapped_lst[3]) )
         elif asktag=="N":
-            logm("O -- %7d FW-RC pairs mapped to Watson strand (before post-filtering)"%(numbers_premapped_lst[0]) )
-            logm("O -- %7d FW-RC pairs mapped to Crick strand (before post-filtering)"%(numbers_premapped_lst[1]) )
-
+            logm("-- %7d FW-RC pairs mapped to Watson strand (before post-filtering)"%(numbers_premapped_lst[0]) )
+            logm("-- %7d FW-RC pairs mapped to Crick strand (before post-filtering)"%(numbers_premapped_lst[1]) )
+        logm("--- %d uniquely aligned pairs, where each end has mismatches <= %s"%(all_mapped_passed, max_mismatch_no) )
+        if asktag=="Y":
+            logm("----- %7d FW-RC pairs mapped to Watson strand"%(numbers_mapped_lst[0]) )
+            logm("----- %7d RC-FW pairs mapped to Watson strand"%(numbers_mapped_lst[1]) )
+            logm("----- %7d FW-RC pairs mapped to Crick strand"%(numbers_mapped_lst[2]) )
+            logm("----- %7d RC-FW pairs mapped to Crick strand"%(numbers_mapped_lst[3]) )
+        elif asktag=="N":
+            logm("----- %7d FW-RC pairs mapped to Watson strand"%(numbers_mapped_lst[0]) )
+            logm("----- %7d FW-RC pairs mapped to Crick strand"%(numbers_mapped_lst[1]) )
 
-        logm("O --- Number of reads rejected because of multiple hits: %d\n" % len(Multiple_hits) )
-        logm("O --- %d uniquely aligned pairs, where each end has mismatches <= %s"%(all_mapped_passed, max_mismatch_no) )
-        if asktag=="Y":
-            logm("O ----- %7d FW-RC pairs mapped to Watson strand"%(numbers_mapped_lst[0]) )
-            logm("O ----- %7d RC-FW pairs mapped to Watson strand"%(numbers_mapped_lst[1]) )
-            logm("O ----- %7d FW-RC pairs mapped to Crick strand"%(numbers_mapped_lst[2]) )
-            logm("O ----- %7d RC-FW pairs mapped to Crick strand"%(numbers_mapped_lst[3]) )
-        elif asktag=="N":
-            logm("O ----- %7d FW-RC pairs mapped to Watson strand"%(numbers_mapped_lst[0]) )
-            logm("O ----- %7d FW-RC pairs mapped to Crick strand"%(numbers_mapped_lst[1]) )
-
-        logm("O Mappability= %1.4f%%"%(100*float(all_mapped_passed)/all_raw_reads) )
-        logm("O Unmapped read pairs: %d"% all_unmapped+"\n")
-
+        logm("Mappability= %1.4f%%"%(100*float(all_mapped_passed)*2/all_raw_reads) )
+        logm("Total bases of uniquely mapped reads %7d"% all_base_mapped )
+        logm("Unmapped read pairs: %d"% all_unmapped+"\n")
 
         n_CG=mC_lst[0]+uC_lst[0]
         n_CHG=mC_lst[1]+uC_lst[1]
--- a/BSseeker2/bs_align/bs_rrbs.py	Fri Jul 12 18:47:28 2013 -0400
+++ b/BSseeker2/bs_align/bs_rrbs.py	Tue Nov 05 01:55:39 2013 -0500
@@ -42,24 +42,7 @@
     # For double enzyme: cut_format="C-CGG,A-CTG"; ApekI:"G^CWGC"
     #cut_context = re.sub("-", "", cut_format)
     # Ex. cut_format="C-CGG,AT-CG,G-CWGC"
-    """
 
-    :param main_read_file:
-    :param asktag:
-    :param adapter_file:
-    :param cut_s:
-    :param cut_e:
-    :param no_small_lines:
-    :param max_mismatch_no:
-    :param aligner_command:
-    :param db_path:
-    :param tmp_path:
-    :param outfile:
-    :param XS_pct:
-    :param XS_count:
-    :param adapter_mismatch:
-    :param cut_format:
-    """
     cut_format_lst = EnumerateIUPAC(cut_format.upper().split(",")) # ['G-CAGC', 'AT-CG', 'C-CGG', 'G-CTGC']
     cut_context = [i.replace("-","") for i in cut_format_lst] # ['GCAGC', 'ATCG', 'CCGG', 'GCTGC']
     cut5_context = [re.match( r'(.*)\-(.*)', i).group(1) for i in cut_format_lst] # ['G', 'AT', 'C', 'G']
@@ -106,18 +89,31 @@
             print "[Error] Cannot find adapter file : %s !" % adapter_file
             exit(-1)
 
-    logm("I Read filename: %s" % main_read_file)
-    logm("I The last cycle (for mapping): %d" % cut_e )
-    logm("I Bowtie path: %s" % aligner_command )
-    logm("I Reference genome library path: %s" % db_path )
-    logm("I Number of mismatches allowed: %s" % max_mismatch_no)
-    logm("I Adapter seq: %s" % whole_adapter_seq)
-    logm("----------------------------------------------")
+    logm("Read filename: %s" % main_read_file)
+    logm("The first base (for mapping): %d"% cut_s  )
+    logm("The  last base (for mapping): %d"% cut_e  )
+
+    logm("Path for short reads aligner: %s"% aligner_command + '\n')
+    logm("Reference genome library path: %s"% db_path  )
+
+    if asktag == "Y" :
+        logm("Un-directional library" )
+    else :
+        logm("Directional library")
+
+    logm("Number of mismatches allowed: %s"% max_mismatch_no  )
+
+    if adapter_file !="":
+        logm("Adapter seq: %s" % whole_adapter_seq)
+    logm("-------------------------------- " )
 
     #----------------------------------------------------------------
     all_raw_reads=0
     all_tagged=0
     all_tagged_trimmed=0
+    all_base_before_trim=0
+    all_base_after_trim=0
+    all_base_mapped=0
     all_mapped=0
     all_mapped_passed=0
     n_cut_tag_lst={}
@@ -135,6 +131,9 @@
     num_mapped_FW_G2A = 0
     num_mapped_RC_G2A = 0
 
+    # Count of nucleotides, which should be cut before the adapters
+    Extra_base_cut_5end_adapter = max([ abs(len(i)-len(j)) for i,j in zip(cut5_context, cut3_context)])
+
     #===============================================
     # directional sequencing
     #===============================================
@@ -156,72 +155,71 @@
 
             #--- Checking input format ------------------------------------------
             try :
-                read_inf=open(read_file,"r")
+                if read_file.endswith(".gz") : # support input file ending with ".gz"
+                    read_inf = gzip.open(read_file, "rb")
+                else :
+                    read_inf=open(read_file,"r")
             except IOError:
                 print "[Error] Cannot open input file : %s" % read_file
                 exit(-1)
 
-            oneline=read_inf.readline()
-            l=oneline.split()
-            n_fastq=0
-            n_fasta=0
-            input_format=""
-            if oneline[0]=="@":	# FastQ
-                input_format="fastq"
-            elif len(l)==1 and oneline[0]!=">": # pure sequences
-                input_format="seq"
-            elif len(l)==11: # Illumina qseq
-                input_format="qseq"
-            elif oneline[0]==">": # fasta
-                input_format="fasta"
+            oneline = read_inf.readline()
+            l = oneline.split()
+            input_format = ""
+            if oneline[0]=="@":
+                input_format = "fastq"
+            elif len(l)==1 and oneline[0]!=">" :
+                input_format = "seq"
+            elif len(l)==11:
+                input_format = "qseq"
+            elif oneline[0]==">" :
+                input_format = "fasta"
             read_inf.close()
 
+
             #----------------------------------------------------------------
-            seq_id=""
-            seq=""
-            seq_ready=0
-            for line in fileinput.input(read_file):
-                l=line.split()
-
+            read_id = ""
+            seq = ""
+            seq_ready = 0
+            line_no = 0
+            for line in fileinput.input(read_file, openhook=fileinput.hook_compressed):
+                l = line.split()
+                line_no += 1
                 if input_format=="seq":
-                    all_raw_reads+=1
-                    seq_id=str(all_raw_reads)
-                    seq_id=seq_id.zfill(12)
-                    seq=l[0]
-                    seq_ready="Y"
+                    all_raw_reads += 1
+                    read_id = str(all_raw_reads)
+                    read_id = read_id.zfill(12)
+                    seq = l[0]
+                    seq_ready = "Y"
                 elif input_format=="fastq":
-                    m_fastq=math.fmod(n_fastq,4)
-                    n_fastq+=1
-                    seq_ready="N"
-                    if m_fastq==0:
-                        all_raw_reads+=1
-                        seq_id=str(all_raw_reads)
-                        seq_id=seq_id.zfill(12)
-                        seq=""
-                    elif m_fastq==1:
-                        seq=l[0]
-                        seq_ready="Y"
-                    else:
-                        seq=""
+                    l_fastq = math.fmod(line_no, 4)
+                    if l_fastq == 1 :
+                        all_raw_reads += 1
+                        read_id = l[0][1:]
+                        seq_ready = "N"
+                    elif l_fastq == 2 :
+                        seq = l[0]
+                        seq_ready = "Y"
+                    else :
+                        seq = ""
+                        seq_ready = "N"
                 elif input_format=="qseq":
-                    all_raw_reads+=1
-                    seq_id=str(all_raw_reads)
-                    seq_id=seq_id.zfill(12)
-                    seq=l[8]
-                    seq_ready="Y"
-                elif input_format=="fasta":
-                    m_fasta=math.fmod(n_fasta,2)
-                    n_fasta+=1
-                    seq_ready="N"
-                    if m_fasta==0:
-                        all_raw_reads+=1
-                        seq_id=l[0][1:]
-                        seq=""
-                    elif m_fasta==1:
-                        seq=l[0]
-                        seq_ready="Y"
-                    else:
-                        seq=""
+                    all_raw_reads += 1
+                    read_id = str(all_raw_reads)
+                    read_id = read_id.zfill(12)
+                    seq = l[8]
+                    seq_ready = "Y"
+                elif input_format=="fasta" :
+                    l_fasta = math.fmod(line_no,2)
+                    if l_fasta==1:
+                        all_raw_reads += 1
+                        read_id = l[0][1:]
+                        seq = ""
+                        seq_ready = "N"
+                    elif l_fasta==0 :
+                        seq = l[0]
+                        seq_ready = "Y"
+
                 #---------------------------------------------------------------
                 if seq_ready=="Y":
                     # Normalize the characters
@@ -236,19 +234,22 @@
                     seq = seq[(cut_s-1):cut_e] # cut_s start from 1 cycle by default
 
                     #-- Trimming adapter sequence ---
+
+                    all_base_before_trim += len(seq)
                     if adapter_seq != "" :
-                        new_read = RemoveAdapter(seq, adapter_seq, adapter_mismatch)
+                        new_read = RemoveAdapter(seq, adapter_seq, adapter_mismatch, Extra_base_cut_5end_adapter)
                         if len(new_read) < len(seq) :
                             all_tagged_trimmed += 1
                         seq = new_read
+                    all_base_after_trim += len(seq)
                     if len(seq) <= 4 :
                         seq = "N" * (cut_e - cut_s)
 
                     # all reads will be considered, regardless of tags
                     #---------  trimmed_raw_BS_read and qscore ------------------
-                    original_bs_reads[seq_id] = seq
+                    original_bs_reads[read_id] = seq
                     #---------  FW_C2T  ------------------
-                    outf2.write('>%s\n%s\n'%(seq_id, seq.replace('C', 'T')))
+                    outf2.write('>%s\n%s\n'%(read_id, seq.replace('C', 'T')))
             fileinput.close()
 
             outf2.close()
@@ -384,7 +385,9 @@
 
 
                     N_mismatch = N_MIS(r_aln, g_aln)
-                    if N_mismatch <= int(max_mismatch_no) :
+#                    if N_mismatch <= int(max_mismatch_no) :
+                    mm_no=float(max_mismatch_no)
+                    if (mm_no>=1 and N_mismatch<=mm_no) or (mm_no<1 and N_mismatch<=(mm_no*len(r_aln)) ):
                         all_mapped_passed += 1
                         methy = methy_seq(r_aln, g_aln + next2bp)
                         mC_lst, uC_lst = mcounts(methy, mC_lst, uC_lst)
@@ -402,6 +405,7 @@
                                       my_region_serial = my_region_serial,
                                       my_region_start = my_region_start,
                                       my_region_end = my_region_end)
+                        all_base_mapped += len(original_BS)
                 else :
                     print "[For debug]: reads not in same lengths"
 
@@ -453,7 +457,9 @@
 
 
                     N_mismatch = N_MIS(r_aln, g_aln)
-                    if N_mismatch <= int(max_mismatch_no) :
+#                    if N_mismatch <= int(max_mismatch_no) :
+                    mm_no=float(max_mismatch_no)
+                    if (mm_no>=1 and N_mismatch<=mm_no) or (mm_no<1 and N_mismatch<=(mm_no*len(r_aln)) ):
                         all_mapped_passed += 1
                         methy = methy_seq(r_aln, g_aln + next2bp)
                         mC_lst, uC_lst = mcounts(methy, mC_lst, uC_lst)
@@ -471,6 +477,7 @@
                                       my_region_serial = my_region_serial,
                                       my_region_start = my_region_start,
                                       my_region_end = my_region_end)
+                        all_base_mapped += len(original_BS)
                 else :
                     print "[For debug]: reads not in same lengths"
 
@@ -507,76 +514,74 @@
 
             #--- Checking input format ------------------------------------------
             try :
-                read_inf=open(read_file,"r")
+                if read_file.endswith(".gz") : # support input file ending with ".gz"
+                    read_inf = gzip.open(read_file, "rb")
+                else :
+                    read_inf=open(read_file,"r")
             except IOError:
                 print "[Error] Cannot open input file : %s" % read_file
                 exit(-1)
 
-            oneline=read_inf.readline()
-            l=oneline.split()
-            n_fastq=0
-            n_fasta=0
-            input_format=""
-            if oneline[0]=="@":	# FastQ
-                input_format="fastq"
-            elif len(l)==1 and oneline[0]!=">": # pure sequences
-                input_format="seq"
-            elif len(l)==11: # Illumina qseq
-                input_format="qseq"
-            elif oneline[0]==">": # fasta
-                input_format="fasta"
+            oneline = read_inf.readline()
+            l = oneline.split()
+            input_format = ""
+            if oneline[0]=="@":
+                input_format = "fastq"
+            elif len(l)==1 and oneline[0]!=">" :
+                input_format = "seq"
+            elif len(l)==11:
+                input_format = "qseq"
+            elif oneline[0]==">" :
+                input_format = "fasta"
             read_inf.close()
 
             #----------------------------------------------------------------
-            seq_id = ""
+            read_id = ""
             seq = ""
-            seq_ready=0
-            for line in fileinput.input(read_file):
-                l=line.split()
-
-                if input_format == "seq":
-                    all_raw_reads+=1
-                    seq_id=str(all_raw_reads)
-                    seq_id=seq_id.zfill(12)
-                    seq=l[0]
-                    seq_ready="Y"
+            seq_ready = 0
+            line_no = 0
+            for line in fileinput.input(read_file, openhook=fileinput.hook_compressed):
+                l = line.split()
+                line_no += 1
+                if input_format=="seq":
+                    all_raw_reads += 1
+                    read_id = str(all_raw_reads)
+                    read_id = read_id.zfill(12)
+                    seq = l[0]
+                    seq_ready = "Y"
                 elif input_format=="fastq":
-                    m_fastq=math.fmod(n_fastq,4)
-                    n_fastq+=1
-                    seq_ready="N"
-                    if m_fastq==0:
-                        all_raw_reads+=1
-                        seq_id=str(all_raw_reads)
-                        seq_id=seq_id.zfill(12)
-                        seq=""
-                    elif m_fastq==1:
-                        seq=l[0]
-                        seq_ready="Y"
-                    else:
-                        seq=""
+                    l_fastq = math.fmod(line_no, 4)
+                    if l_fastq == 1 :
+                        all_raw_reads += 1
+                        read_id = l[0][1:]
+                        seq_ready = "N"
+                    elif l_fastq == 2 :
+                        seq = l[0]
+                        seq_ready = "Y"
+                    else :
+                        seq = ""
+                        seq_ready = "N"
                 elif input_format=="qseq":
-                    all_raw_reads+=1
-                    seq_id=str(all_raw_reads)
-                    seq_id=seq_id.zfill(12)
-                    seq=l[8]
-                    seq_ready="Y"
-                elif input_format=="fasta":
-                    m_fasta=math.fmod(n_fasta,2)
-                    n_fasta+=1
-                    seq_ready="N"
-                    if m_fasta==0:
-                        all_raw_reads+=1
-                        seq_id=l[0][1:]
-                        seq=""
-                    elif m_fasta==1:
-                        seq=l[0]
-                        seq_ready="Y"
-                    else:
-                        seq=""
-                    #---------------------------------------------------------------
+                    all_raw_reads += 1
+                    read_id = str(all_raw_reads)
+                    read_id = read_id.zfill(12)
+                    seq = l[8]
+                    seq_ready = "Y"
+                elif input_format=="fasta" :
+                    l_fasta = math.fmod(line_no,2)
+                    if l_fasta==1:
+                        all_raw_reads += 1
+                        read_id = l[0][1:]
+                        seq = ""
+                        seq_ready = "N"
+                    elif l_fasta==0 :
+                        seq = l[0]
+                        seq_ready = "Y"
+
+                #---------------------------------------------------------------
                 if seq_ready=="Y":
                     # Normalize the characters
-                    seq=seq.upper().replace(".","N")
+                    seq = seq.upper().replace(".","N")
 
                     read_tag = [ m for m,n in [ (i, len(i)) for i in uniq(cut3_tag_lst)] if seq[0:n] == m ]
                     if len(read_tag) > 0 :
@@ -587,21 +592,23 @@
                     seq = seq[(cut_s-1):cut_e] # cut_s start from 1 cycle by default
 
                     #-- Trimming adapter sequence ---
+                    all_base_before_trim += len(seq)
                     if adapter_seq != "" :
-                        new_read = RemoveAdapter(seq, adapter_seq, adapter_mismatch)
+                        new_read = RemoveAdapter(seq, adapter_seq, adapter_mismatch, Extra_base_cut_5end_adapter)
                         if len(new_read) < len(seq) :
                             all_tagged_trimmed += 1
                         seq = new_read
+                    all_base_after_trim += len(seq)
                     if len(seq) <= 4 :
                         seq = "N" * (cut_e - cut_s)
 
                     # all reads will be considered, regardless of tags
                     #---------  trimmed_raw_BS_read and qscore ------------------
-                    original_bs_reads[seq_id] = seq
+                    original_bs_reads[read_id] = seq
                     #---------  FW_C2T  ------------------
-                    outf2.write('>%s\n%s\n'%(seq_id, seq.replace('C', 'T')))
+                    outf2.write('>%s\n%s\n'%(read_id, seq.replace('C', 'T')))
                     #---------  RC_G2A  ------------------
-                    outf3.write('>%s\n%s\n' % (seq_id, seq.replace("G","A")))
+                    outf3.write('>%s\n%s\n' % (read_id, seq.replace("G","A")))
             fileinput.close()
 
             outf2.close()
@@ -612,10 +619,10 @@
 
             # mapping
             #--------------------------------------------------------------------------------
-            WC2T=tmp_d("W_C2T_m"+max_mismatch_no+".mapping"+random_id)
-            CC2T=tmp_d("C_C2T_m"+max_mismatch_no+".mapping"+random_id)
-            WG2A=tmp_d("W_G2A_m"+max_mismatch_no+".mapping"+random_id)
-            CG2A=tmp_d("C_G2A_m"+max_mismatch_no+".mapping"+random_id)
+            WC2T = tmp_d("W_C2T_m"+max_mismatch_no+".mapping"+random_id)
+            CC2T = tmp_d("C_C2T_m"+max_mismatch_no+".mapping"+random_id)
+            WG2A = tmp_d("W_G2A_m"+max_mismatch_no+".mapping"+random_id)
+            CG2A = tmp_d("C_G2A_m"+max_mismatch_no+".mapping"+random_id)
 
             run_in_parallel([ aligner_command % {'reference_genome' : os.path.join(db_path,'W_C2T'),
                                                  'input_file' : outfile2,
@@ -638,37 +645,37 @@
             # Post processing
             #--------------------------------------------------------------------------------
 
-            FW_C2T_U,FW_C2T_R=extract_mapping(WC2T)
-            RC_G2A_U,RC_G2A_R=extract_mapping(CG2A)
+            FW_C2T_U,FW_C2T_R = extract_mapping(WC2T)
+            RC_G2A_U,RC_G2A_R = extract_mapping(CG2A)
 
-            FW_G2A_U,FW_G2A_R=extract_mapping(WG2A)
-            RC_C2T_U,RC_C2T_R=extract_mapping(CC2T)
+            FW_G2A_U,FW_G2A_R = extract_mapping(WG2A)
+            RC_C2T_U,RC_C2T_R = extract_mapping(CC2T)
 
             logm("Extracting alignments is done")
 
             #----------------------------------------------------------------
             # get unique-hit reads
             #----------------------------------------------------------------
-            Union_set=set(FW_C2T_U.iterkeys()) | set(RC_G2A_U.iterkeys()) | set(FW_G2A_U.iterkeys()) | set(RC_C2T_U.iterkeys())
+            Union_set = set(FW_C2T_U.iterkeys()) | set(RC_G2A_U.iterkeys()) | set(FW_G2A_U.iterkeys()) | set(RC_C2T_U.iterkeys())
 
-            Unique_FW_C2T=set() # +
-            Unique_RC_G2A=set() # +
-            Unique_FW_G2A=set() # -
-            Unique_RC_C2T=set() # -
-            Multiple_hits=set()
+            Unique_FW_C2T = set() # +
+            Unique_RC_G2A = set() # +
+            Unique_FW_G2A = set() # -
+            Unique_RC_C2T = set() # -
+            Multiple_hits = set()
 
-            for x in Union_set:
-                _list=[]
+            for x in Union_set :
+                _list = []
                 for dx in [FW_C2T_U, RC_G2A_U, FW_G2A_U, RC_C2T_U]:
-                    mis_lst=dx.get(x,[99])
-                    mis=int(mis_lst[0])
+                    mis_lst = dx.get(x,[99])
+                    mis = int(mis_lst[0])
                     _list.append(mis)
                 for dx in [FW_C2T_R, RC_G2A_R, FW_G2A_R, RC_C2T_R]:
-                    mis=dx.get(x,99)
+                    mis = dx.get(x,99)
                     _list.append(mis)
-                mini=min(_list)
+                mini = min(_list)
                 if _list.count(mini) == 1:
-                    mini_index=_list.index(mini)
+                    mini_index = _list.index(mini)
                     if mini_index == 0:
                         Unique_FW_C2T.add(x)
                     elif mini_index == 1:
@@ -683,7 +690,7 @@
                     Multiple_hits.add(x)
             # write reads rejected by Multiple Hits to file
             if show_multiple_hit :
-                outf_MH=open("Multiple_hit.fa",'w')
+                outf_MH = open("Multiple_hit.fa",'w')
                 for i in Multiple_hits :
                     outf_MH.write(">%s\n" % i)
                     outf_MH.write("%s\n" % original_bs_reads[i])
@@ -695,18 +702,18 @@
             del RC_C2T_R
             del RC_G2A_R
 
-            FW_C2T_uniq_lst=[[FW_C2T_U[u][1],u] for u in Unique_FW_C2T]
-            FW_G2A_uniq_lst=[[FW_G2A_U[u][1],u] for u in Unique_FW_G2A]
-            RC_C2T_uniq_lst=[[RC_C2T_U[u][1],u] for u in Unique_RC_C2T]
-            RC_G2A_uniq_lst=[[RC_G2A_U[u][1],u] for u in Unique_RC_G2A]
+            FW_C2T_uniq_lst = [[FW_C2T_U[u][1],u] for u in Unique_FW_C2T]
+            FW_G2A_uniq_lst = [[FW_G2A_U[u][1],u] for u in Unique_FW_G2A]
+            RC_C2T_uniq_lst = [[RC_C2T_U[u][1],u] for u in Unique_RC_C2T]
+            RC_G2A_uniq_lst = [[RC_G2A_U[u][1],u] for u in Unique_RC_G2A]
             FW_C2T_uniq_lst.sort()
             RC_C2T_uniq_lst.sort()
             FW_G2A_uniq_lst.sort()
             RC_G2A_uniq_lst.sort()
-            FW_C2T_uniq_lst=[x[1] for x in FW_C2T_uniq_lst]
-            RC_C2T_uniq_lst=[x[1] for x in RC_C2T_uniq_lst]
-            FW_G2A_uniq_lst=[x[1] for x in FW_G2A_uniq_lst]
-            RC_G2A_uniq_lst=[x[1] for x in RC_G2A_uniq_lst]
+            FW_C2T_uniq_lst = [x[1] for x in FW_C2T_uniq_lst]
+            RC_C2T_uniq_lst = [x[1] for x in RC_C2T_uniq_lst]
+            FW_G2A_uniq_lst = [x[1] for x in FW_G2A_uniq_lst]
+            RC_G2A_uniq_lst = [x[1] for x in RC_G2A_uniq_lst]
 
             del Unique_FW_C2T
             del Unique_FW_G2A
@@ -716,7 +723,7 @@
 
             #----------------------------------------------------------------
             # Post-filtering reads
-            # ---- FW_C2T  ---- undirectional
+            # ---- FW_C2T  ---- un-directional
             FW_regions = dict()
             gseq = dict()
             chr_length = dict()
@@ -758,7 +765,9 @@
                             try_count += 1
 
                     N_mismatch = N_MIS(r_aln, g_aln)
-                    if N_mismatch <= int(max_mismatch_no) :
+#                    if N_mismatch <= int(max_mismatch_no) :
+                    mm_no=float(max_mismatch_no)
+                    if (mm_no>=1 and N_mismatch<=mm_no) or (mm_no<1 and N_mismatch<=(mm_no*len(r_aln)) ):
                         all_mapped_passed += 1
                         methy = methy_seq(r_aln, g_aln + next2bp)
                         mC_lst, uC_lst = mcounts(methy, mC_lst, uC_lst)
@@ -776,11 +785,12 @@
                                       my_region_serial = my_region_serial,
                                       my_region_start = my_region_start,
                                       my_region_end = my_region_end)
+                        all_base_mapped += len(original_BS)
                 else :
                     print "[For debug]: reads not in same lengths"
 
 
-            # ---- RC_C2T ---- undirectional
+            # ---- RC_C2T ---- un-directional
             RC_regions = dict()
             for header in RC_C2T_uniq_lst :
                 _, mapped_chr, mapped_location, cigar = RC_C2T_U[header]
@@ -821,7 +831,9 @@
                             try_count += 1
 
                     N_mismatch = N_MIS(r_aln, g_aln)
-                    if N_mismatch <= int(max_mismatch_no) :
+#                    if N_mismatch <= int(max_mismatch_no) :
+                    mm_no=float(max_mismatch_no)
+                    if (mm_no>=1 and N_mismatch<=mm_no) or (mm_no<1 and N_mismatch<=(mm_no*len(r_aln)) ):
                         all_mapped_passed += 1
                         methy = methy_seq(r_aln, g_aln + next2bp)
                         mC_lst, uC_lst = mcounts(methy, mC_lst, uC_lst)
@@ -839,12 +851,13 @@
                                       my_region_serial = my_region_serial,
                                       my_region_start = my_region_start,
                                       my_region_end = my_region_end)
+                        all_base_mapped += len(original_BS)
 
                 else :
                     print "[For debug]: reads not in same lengths"
 
 
-            # ---- FW_G2A  ---- undirectional
+            # ---- FW_G2A  ---- un-directional
             FW_regions = dict()
             gseq = dict()
             chr_length = dict()
@@ -891,9 +904,10 @@
                         #    print "[For debug]: FW_G2A read still can not find fragment serial"
                         # Tip: sometimes "my_region_serial" is still 0 ...
 
-
                     N_mismatch = N_MIS(r_aln, g_aln)
-                    if N_mismatch <= int(max_mismatch_no) :
+#                    if N_mismatch <= int(max_mismatch_no) :
+                    max_mismatch_no=float(max_mismatch_no)
+                    if (mm_no>=1 and N_mismatch<=mm_no) or (mm_no<1 and N_mismatch<=(mm_no*len(r_aln)) ):
                         all_mapped_passed += 1
                         methy = methy_seq(r_aln, g_aln + next2bp)
                         mC_lst, uC_lst = mcounts(methy, mC_lst, uC_lst)
@@ -911,11 +925,12 @@
                                       my_region_serial = my_region_serial,
                                       my_region_start = my_region_start,
                                       my_region_end = my_region_end)
+                        all_base_mapped += len(original_BS)
                 else :
                     print "[For debug]: reads not in same lengths"
 
 
-            # ---- RC_G2A ---- undirectional
+            # ---- RC_G2A ---- un-directional
             RC_regions = dict()
             for header in RC_G2A_uniq_lst :
                 _, mapped_chr, mapped_location, cigar = RC_G2A_U[header]
@@ -961,9 +976,10 @@
                         #    print "[For debug]: chr=", mapped_chr
                         #    print "[For debug]: RC_C2A read still cannot find fragment serial"
 
-
                     N_mismatch = N_MIS(r_aln, g_aln)
-                    if N_mismatch <= int(max_mismatch_no) :
+#                    if N_mismatch <= int(max_mismatch_no) :
+                    mm_no=float(max_mismatch_no)
+                    if (mm_no>=1 and N_mismatch<=mm_no) or (mm_no<1 and N_mismatch<=(mm_no*len(r_aln)) ):
                         all_mapped_passed += 1
                         methy = methy_seq(r_aln, g_aln + next2bp)
                         mC_lst, uC_lst = mcounts(methy, mC_lst, uC_lst)
@@ -981,37 +997,38 @@
                                       my_region_serial = my_region_serial,
                                       my_region_start = my_region_start,
                                       my_region_end = my_region_end)
+                        all_base_mapped += len(original_BS)
                 else :
                     print "[For debug]: reads not in same lengths"
 
-
-
             # Finished both FW and RC
             logm("Done: %s (%d) \n" % (read_file, no_my_files))
             print "--> %s (%d) "%(read_file, no_my_files)
             del original_bs_reads
             delete_files(WC2T, CC2T, WG2A, CG2A)
-
-
-
     # End of un-directional library
 
     delete_files(tmp_path)
 
 
-    logm("O Number of raw reads: %d "% all_raw_reads)
-    if all_raw_reads >0:
-        logm("O Number of CGG/TGG tagged reads: %d (%1.3f)"%(all_tagged,float(all_tagged)/all_raw_reads))
+    logm("Number of raw reads: %d "% all_raw_reads)
+    if all_raw_reads>0:
+        logm("Number of raw reads with CGG/TGG at 5' end: %d (%1.3f)"%(all_tagged,float(all_tagged)/all_raw_reads))
         for kk in range(len(n_cut_tag_lst)):
-            logm("O Number of raw reads with %s tag: %d (%1.3f)"%(cut3_tag_lst[kk],n_cut_tag_lst[cut3_tag_lst[kk]],float(n_cut_tag_lst[cut3_tag_lst[kk]])/all_raw_reads))
-        logm("O Number of CGG/TGG reads having adapter removed: %d "%all_tagged_trimmed)
-        logm("O Number of reads rejected because of multiple hits: %d\n" % len(Multiple_hits) )
-        logm("O Number of unique-hits reads for post-filtering: %d"%all_mapped)
+            logm("Number of raw reads with tag %s: %d (%1.3f)"%(cut3_tag_lst[kk],n_cut_tag_lst[cut3_tag_lst[kk]],float(n_cut_tag_lst[cut3_tag_lst[kk]])/all_raw_reads))
+        if adapter_seq!="" :
+            logm("Number of reads having adapter removed: %d "%all_tagged_trimmed)
+        logm("Number of bases in total: %d "%all_base_before_trim)
+        if adapter_seq!="" :
+            logm("Number of bases after trimming the adapters: %d (%1.3f)"%(all_base_after_trim, float(all_base_after_trim)/all_base_before_trim ) )
+        logm("Number of reads are rejected because of multiple hits: %d\n" % len(Multiple_hits) )
+        logm("Number of unique-hits reads (before post-filtering): %d"%all_mapped)
 
-        logm("O ------ %d uniquely aligned reads, passed fragment check, with mismatches <= %s"%(all_mapped_passed, max_mismatch_no))
-        logm("O Mappability= %1.4f%%"%(100*float(all_mapped_passed)/all_raw_reads))
+        logm("------ %d uniquely aligned reads, passed fragment check, with mismatches <= %s"%(all_mapped_passed, max_mismatch_no))
+        logm("Mappability= %1.4f%%"%(100*float(all_mapped_passed)/all_raw_reads))
+        logm("Total bases of uniquely mapped reads %7d"% all_base_mapped )
 
-        if asktag=="Y": # undiretional
+        if asktag=="Y": # un-diretional
             logm(" ---- %7d FW reads mapped to Watson strand"%(num_mapped_FW_C2T) )
             logm(" ---- %7d RC reads mapped to Watson strand"%(num_mapped_FW_G2A) )
             logm(" ---- %7d FW reads mapped to Crick strand"%(num_mapped_RC_C2T) )
@@ -1021,16 +1038,17 @@
         elif asktag=="N": # directional
             logm(" ---- %7d FW reads mapped to Watson strand"%(num_mapped_FW_C2T) )
             logm(" ---- %7d FW reads mapped to Crick strand"%(num_mapped_RC_C2T) )
+        logm("Total bases of uniquely mapped reads %7d"% all_base_mapped )
 
-        n_CG=mC_lst[0]+uC_lst[0]
-        n_CHG=mC_lst[1]+uC_lst[1]
-        n_CHH=mC_lst[2]+uC_lst[2]
+        n_CG = mC_lst[0] + uC_lst[0]
+        n_CHG = mC_lst[1] + uC_lst[1]
+        n_CHH = mC_lst[2] + uC_lst[2]
 
         logm("----------------------------------------------")
-        logm("M Methylated C in mapped reads ")
-        logm("M mCG %1.3f%%"%((100*float(mC_lst[0])/n_CG) if n_CG != 0 else 0))
-        logm("M mCHG %1.3f%%"%((100*float(mC_lst[1])/n_CHG) if n_CHG != 0 else 0))
-        logm("M mCHH %1.3f%%"%((100*float(mC_lst[2])/n_CHH) if n_CHH != 0 else 0))
+        logm("Methylated C in mapped reads ")
+        logm(" mCG %1.3f%%"%( (100 * float(mC_lst[0]) / n_CG) if n_CG!=0 else 0))
+        logm(" mCHG %1.3f%%"%( (100 * float(mC_lst[1]) / n_CHG) if n_CHG!=0 else 0))
+        logm(" mCHH %1.3f%%"%( (100 * float(mC_lst[2]) / n_CHH) if n_CHH!=0 else 0))
     logm("----------------------------------------------")
     logm("------------------- END ----------------------")
 
--- a/BSseeker2/bs_align/bs_single_end.py	Fri Jul 12 18:47:28 2013 -0400
+++ b/BSseeker2/bs_align/bs_single_end.py	Tue Nov 05 01:55:39 2013 -0500
@@ -1,6 +1,7 @@
 import fileinput, os, time, random, math
 from bs_utils.utils import *
 from bs_align_utils import *
+import gzip
 
 #----------------------------------------------------------------
 # Read from the mapped results, return lists of unique / multiple-hit reads
@@ -77,20 +78,23 @@
 
 
     #----------------------------------------------------------------
-    logm("Read filename: %s"% main_read_file )
-    logm("Un-directional library: %s" % asktag )
-    logm("The first base (for mapping): %d" % cut1)
-    logm("The last base (for mapping): %d" % cut2)
-    logm("Max. lines per mapping: %d"% no_small_lines)
-    logm("Aligner: %s" % aligner_command)
-    logm("Reference genome library path: %s" % db_path )
-    logm("Number of mismatches allowed: %s" % max_mismatch_no )
+    logm("Read filename: %s" % main_read_file)
+    logm("The first base (for mapping): %d"% cut1  )
+    logm("The  last base (for mapping): %d"% cut2  )
+
+    logm("Path for short reads aligner: %s"% aligner_command + '\n')
+    logm("Reference genome library path: %s"% db_path  )
+
+    if asktag == "Y" :
+        logm("Un-directional library" )
+    else :
+        logm("Directional library")
+
+    logm("Number of mismatches allowed: %s"% max_mismatch_no  )
+
     if adapter_file !="":
-        if asktag=="N":
-            logm("Adapter to be removed from 3' reads: %s"%(adapter.rstrip("\n")))
-        elif asktag=="Y":
-            logm("Adapter to be removed from 3' FW reads: %s"%(adapter_fw.rstrip("\n")) )
-            logm("Adapter to be removed from 3' RC reads: %s"%(adapter_rc.rstrip("\n")) )
+        logm("Adapter seq: %s" % adapter_fw)
+    logm("-------------------------------- " )
     #----------------------------------------------------------------
 
     # helper method to join fname with tmp_path
@@ -109,9 +113,12 @@
 
     #---- Stats ------------------------------------------------------------
     all_raw_reads=0
-    all_trimed=0
+    all_trimmed=0
     all_mapped=0
     all_mapped_passed=0
+    all_base_before_trim=0
+    all_base_after_trim=0
+    all_base_mapped=0
 
     numbers_premapped_lst=[0,0,0,0]
     numbers_mapped_lst=[0,0,0,0]
@@ -119,7 +126,6 @@
     mC_lst=[0,0,0]
     uC_lst=[0,0,0]
 
-
     no_my_files=0
 
     #----------------------------------------------------------------
@@ -132,7 +138,7 @@
         random_id = ".tmp-"+str(random.randint(1000000,9999999))
 
         #-------------------------------------------------------------------
-        # undirectional sequencing
+        # un-directional sequencing
         #-------------------------------------------------------------------
         if asktag=="Y":  
 
@@ -146,74 +152,70 @@
             #----------------------------------------------------------------
             # detect format of input file
             try :
-                read_inf=open(read_file,"r")
+                if read_file.endswith(".gz") : # support input file ending with ".gz"
+                    read_inf = gzip.open(read_file, "rb")
+                else :
+                    read_inf=open(read_file,"r")
             except IOError :
                 print "[Error] Cannot open input file : %s" % read_file
                 exit(-1)
 
-            oneline=read_inf.readline()
-            l=oneline.split()
-            input_format=""
-            if oneline[0]=="@":	# fastq
-                input_format="fastq"
-                n_fastq=0
-            elif len(l)==1 and oneline[0]!=">": # pure sequences
-                input_format="seq"
-            elif len(l)==11: # qseq
-                input_format="qseq"
-            elif oneline[0]==">":	# fasta
-                input_format="fasta"
-                n_fasta=0
+            oneline = read_inf.readline()
+            l = oneline.split()
+            input_format = ""
+            if oneline[0]=="@":
+                input_format = "fastq"
+            elif len(l)==1 and oneline[0]!=">":
+                input_format = "seq"
+            elif len(l)==11:
+                input_format = "qseq"
+            elif oneline[0]==">":
+                input_format = "fasta"
             read_inf.close()
 
             #----------------------------------------------------------------
-            # read sequence, remove adapter and convert 
-            read_id=""
-            seq=""
-            seq_ready="N"
-            for line in fileinput.input(read_file):
-                l=line.split()
-
+            # read sequence, remove adapter and convert
+            read_id = ""
+            seq = ""
+            seq_ready = "N"
+            line_no = 0
+            for line in fileinput.input(read_file, openhook=fileinput.hook_compressed): # allow input with .gz
+                l = line.split()
+                line_no += 1
                 if input_format=="seq":
-                    all_raw_reads+=1
-                    read_id=str(all_raw_reads)
-                    read_id=read_id.zfill(12)
-                    seq=l[0]
-                    seq_ready="Y"
+                    all_raw_reads += 1
+                    read_id = str(all_raw_reads)
+                    read_id = read_id.zfill(12)
+                    seq = l[0]
+                    seq_ready = "Y"
                 elif input_format=="fastq":
-                    m_fastq=math.fmod(n_fastq,4)
-                    n_fastq+=1
-                    seq_ready="N"
-                    if m_fastq==0:
-                        all_raw_reads+=1
-                        read_id=str(all_raw_reads)
-                        read_id=read_id.zfill(12)
-                        seq=""
-                    elif m_fastq==1:
-                        seq=l[0]
-                        seq_ready="Y"
-                    else:
-                        seq=""
+                    l_fastq = math.fmod(line_no, 4)
+                    if l_fastq == 1 :
+                        all_raw_reads += 1
+                        read_id = l[0][1:]
+                        seq_ready = "N"
+                    elif l_fastq == 2 :
+                        seq = l[0]
+                        seq_ready = "Y"
+                    else :
+                        seq = ""
+                        seq_ready = "N"
                 elif input_format=="qseq":
-                    all_raw_reads+=1
-                    read_id=str(all_raw_reads)
-                    read_id=read_id.zfill(12)
-                    seq=l[8]
-                    seq_ready="Y"
-                elif input_format=="fasta":
-                    m_fasta=math.fmod(n_fasta,2)
-                    n_fasta+=1
-                    seq_ready="N"
-                    if m_fasta==0:
-                        all_raw_reads+=1
-                        #read_id=str(all_raw_reads)
-                        read_id=l[0][1:]
-                        seq=""
-                    elif m_fasta==1:
-                        seq=l[0]
-                        seq_ready="Y"
-                    else:
-                        seq=""
+                    all_raw_reads += 1
+                    read_id = str(all_raw_reads)
+                    read_id = read_id.zfill(12)
+                    seq = l[8]
+                    seq_ready = "Y"
+                elif input_format=="fasta" :
+                    l_fasta = math.fmod(line_no,2)
+                    if l_fasta==1:
+                        all_raw_reads += 1
+                        read_id = l[0][1:]
+                        seq = ""
+                        seq_ready = "N"
+                    elif l_fasta==0 :
+                        seq = l[0]
+                        seq_ready = "Y"
 
                 #----------------------------------------------------------------
                 if seq_ready=="Y":
@@ -222,13 +224,14 @@
                     seq=seq.replace(".","N")
 
                     # striping BS adapter from 3' read
+                    all_base_before_trim += len(seq)
                     if (adapter_fw !="") and (adapter_rc !="") :
                         new_read = RemoveAdapter(seq, adapter_fw, adapter_mismatch)
                         new_read = Remove_5end_Adapter(new_read, adapter_rc)
                         if len(new_read) < len(seq) :
-                            all_trimed += 1
+                            all_trimmed += 1
                         seq = new_read
-
+                    all_base_after_trim += len(seq)
                     if len(seq)<=4:
                         seq=''.join(["N" for x in xrange(cut2-cut1+1)])
 
@@ -353,18 +356,18 @@
             RC_C2T_uniq_lst=[x[1] for x in RC_C2T_uniq_lst]
             FW_G2A_uniq_lst=[x[1] for x in FW_G2A_uniq_lst]
             RC_G2A_uniq_lst=[x[1] for x in RC_G2A_uniq_lst]
+            #----------------------------------------------------------------
+
+            numbers_premapped_lst[0] += len(Unique_FW_C2T)
+            numbers_premapped_lst[1] += len(Unique_RC_G2A)
+            numbers_premapped_lst[2] += len(Unique_FW_G2A)
+            numbers_premapped_lst[3] += len(Unique_RC_C2T)
 
             del Unique_FW_C2T
             del Unique_FW_G2A
             del Unique_RC_C2T
             del Unique_RC_G2A
 
-            #----------------------------------------------------------------
-            numbers_premapped_lst[0] += len(Unique_FW_C2T)
-            numbers_premapped_lst[1] += len(Unique_RC_G2A)
-            numbers_premapped_lst[2] += len(Unique_FW_G2A)
-            numbers_premapped_lst[3] += len(Unique_RC_C2T)
-
 
             #----------------------------------------------------------------
 
@@ -376,7 +379,6 @@
                                             (FW_G2A_uniq_lst,FW_G2A_U),
                                             (RC_C2T_uniq_lst,RC_C2T_U)]:
                 nn += 1
-                mapped_chr0 = ""
 
                 for header in ali_unique_lst:
 
@@ -422,7 +424,9 @@
 
                     if len(r_aln)==len(g_aln):
                         N_mismatch = N_MIS(r_aln, g_aln)
-                        if N_mismatch <= int(max_mismatch_no):
+#                        if N_mismatch <= int(max_mismatch_no):
+                        mm_no=float(max_mismatch_no)
+                        if (mm_no>=1 and N_mismatch<=mm_no) or (mm_no<1 and N_mismatch<=(mm_no*len(r_aln)) ):
                             numbers_mapped_lst[nn-1] += 1
                             all_mapped_passed += 1
                             methy = methy_seq(r_aln, g_aln + next)
@@ -436,6 +440,7 @@
                                 XS = 1
 
                             outfile.store(header, N_mismatch, FR, mapped_chr, mapped_strand, mapped_location, cigar, original_BS, methy, XS, output_genome = output_genome)
+                            all_base_mapped += len(original_BS)
 
             #----------------------------------------------------------------
             logm("--> %s (%d) "%(read_file, no_my_files))
@@ -449,78 +454,74 @@
 
         if asktag=="N":  
             #----------------------------------------------------------------
-            outfile2=tmp_d('Trimed_C2T.fa'+random_id)
+            outfile2=tmp_d('Trimmed_C2T.fa'+random_id)
             outf2=open(outfile2,'w')
-
-            n=0
             #----------------------------------------------------------------
             try :
-                read_inf=open(read_file,"r")
+                if read_file.endswith(".gz") : # support input file ending with ".gz"
+                    read_inf = gzip.open(read_file, "rb")
+                else :
+                    read_inf=open(read_file,"r")
             except IOError :
                 print "[Error] Cannot open input file : %s" % read_file
                 exit(-1)
 
-            oneline=read_inf.readline()
-            l=oneline.split()
-            input_format=""
-            if oneline[0]=="@":	# FastQ
-                input_format="fastq"
-                n_fastq=0
-            elif len(l)==1 and oneline[0]!=">": # pure sequences
-                input_format="seq"
-            elif len(l)==11: # Illumina GAII qseq file
-                input_format="qseq"
-            elif oneline[0]==">":	# fasta
-                input_format="fasta"
-                n_fasta=0
+            oneline = read_inf.readline()
+            l = oneline.split()
+            input_format = ""
+            if oneline[0]=="@":
+                input_format = "fastq"
+            elif len(l)==1 and oneline[0]!=">":
+                input_format = "seq"
+            elif len(l)==11:
+                input_format = "qseq"
+            elif oneline[0]==">":
+                input_format = "fasta"
             read_inf.close()
+
             #print "detected data format: %s"%(input_format)
             #----------------------------------------------------------------
             read_id=""
             seq=""
             seq_ready="N"
-            for line in fileinput.input(read_file):
-                l=line.split()
+            line_no = 0
+            for line in fileinput.input(read_file, openhook=fileinput.hook_compressed):
+                l = line.split()
+                line_no += 1
                 if input_format=="seq":
-                    all_raw_reads+=1
-                    read_id=str(all_raw_reads)
-                    read_id=read_id.zfill(12)
-                    seq=l[0]
-                    seq_ready="Y"
+                    all_raw_reads += 1
+                    read_id = str(all_raw_reads)
+                    read_id = read_id.zfill(12)
+                    seq = l[0]
+                    seq_ready = "Y"
                 elif input_format=="fastq":
-                    m_fastq=math.fmod(n_fastq,4)
-                    n_fastq+=1
-                    seq_ready="N"
-                    if m_fastq==0:
-                        all_raw_reads+=1
-                        read_id=str(all_raw_reads)
-                        read_id=read_id.zfill(12)
-                        seq=""
-                    elif m_fastq==1:
-                        seq=l[0]
-                        seq_ready="Y"
-                    else:
-                        seq=""
+                    l_fastq = math.fmod(line_no, 4)
+                    if l_fastq == 1 :
+                        all_raw_reads += 1
+                        read_id = l[0][1:]
+                        seq_ready = "N"
+                    elif l_fastq == 2 :
+                        seq = l[0]
+                        seq_ready = "Y"
+                    else :
+                        seq = ""
+                        seq_ready = "N"
                 elif input_format=="qseq":
-                    all_raw_reads+=1
-                    read_id=str(all_raw_reads)
-                    read_id=read_id.zfill(12)
-                    seq=l[8]
-                    seq_ready="Y"
-                elif input_format=="fasta":
-                    m_fasta=math.fmod(n_fasta,2)
-                    n_fasta+=1
-                    seq_ready="N"
-                    if m_fasta==0:
-                        all_raw_reads+=1
-                        read_id=l[0][1:]
-                        seq=""
-                    elif m_fasta==1:
-                        seq=l[0]
-                        seq_ready="Y"
-                    else:
-                        seq=""
-
+                    all_raw_reads += 1
+                    read_id = str(all_raw_reads)
+                    read_id = read_id.zfill(12)
+                    seq = l[8]
+                    seq_ready = "Y"
+                elif input_format=="fasta" :
+                    l_fasta = math.fmod(line_no,2)
+                    if l_fasta==1:
+                        all_raw_reads += 1
+                        read_id = l[0][1:]
+                        seq = ""
+                        seq_ready = "N"
+                    elif l_fasta==0 :
+                        seq = l[0]
+                        seq_ready = "Y"
                 #--------------------------------
                 if seq_ready=="Y":
                     seq=seq[cut1-1:cut2] #<---selecting 0..52 from 1..72  -e 52
@@ -528,12 +529,13 @@
                     seq=seq.replace(".","N")
 
                     #--striping adapter from 3' read -------
+                    all_base_before_trim += len(seq)
                     if adapter != "":
                         new_read = RemoveAdapter(seq, adapter, adapter_mismatch)
                         if len(new_read) < len(seq) :
-                            all_trimed += 1
+                            all_trimmed += 1
                         seq = new_read
-
+                    all_base_after_trim += len(seq)
                     if len(seq)<=4:
                         seq = "N" * (cut2-cut1+1)
 
@@ -612,7 +614,6 @@
                 outf_MH.close()
 
 
-
             FW_C2T_uniq_lst=[[FW_C2T_U[u][1],u] for u in Unique_FW_C2T]
             RC_C2T_uniq_lst=[[RC_C2T_U[u][1],u] for u in Unique_RC_C2T]
             FW_C2T_uniq_lst.sort()
@@ -633,7 +634,6 @@
             chr_length = dict()
             for ali_unique_lst, ali_dic in [(FW_C2T_uniq_lst,FW_C2T_U),(RC_C2T_uniq_lst,RC_C2T_U)]:
                 nn += 1
-                mapped_chr0 = ""
                 for header in ali_unique_lst:
                     _, mapped_chr, mapped_location, cigar = ali_dic[header]
                     original_BS = original_bs_reads[header]
@@ -641,11 +641,6 @@
                     if mapped_chr not in gseq :
                         gseq[mapped_chr] = deserialize(db_d(mapped_chr))
                         chr_length[mapped_chr] = len(gseq[mapped_chr])
-                    #if mapped_chr != mapped_chr0:
-                    #    my_gseq = deserialize(db_d(mapped_chr))
-                    #    chr_length = len(my_gseq)
-                    #    mapped_chr0 = mapped_chr
-                    #-------------------------------------
 
                     r_start, r_end, g_len = get_read_start_end_and_genome_length(cigar)
 
@@ -664,7 +659,8 @@
 
                     if len(r_aln) == len(g_aln):
                         N_mismatch = N_MIS(r_aln, g_aln) #+ original_BS_length - (r_end - r_start) # mismatches in the alignment + soft clipped nucleotides
-                        if N_mismatch <= int(max_mismatch_no):
+                        mm_no=float(max_mismatch_no)
+                        if (mm_no>=1 and N_mismatch<=mm_no) or (mm_no<1 and N_mismatch<=(mm_no*len(r_aln)) ):
                             numbers_mapped_lst[nn-1] += 1
                             all_mapped_passed += 1
                             methy = methy_seq(r_aln, g_aln+next)
@@ -678,6 +674,7 @@
                                 XS = 1
 
                             outfile.store(header, N_mismatch, FR, mapped_chr, mapped_strand, mapped_location, cigar, original_BS, methy, XS, output_genome = output_genome)
+                            all_base_mapped += len(original_BS)
 
             #----------------------------------------------------------------
             logm("--> %s (%d) "%(read_file,no_my_files))
@@ -686,14 +683,16 @@
 
     #----------------------------------------------------------------
 
-#    outf.close()
     delete_files(tmp_path)
 
     logm("Number of raw reads: %d \n"% all_raw_reads)
     if all_raw_reads >0:
-        logm("Number of reads having adapter removed: %d \n" % all_trimed )
-        logm("Number of reads rejected because of multiple hits: %d\n" % len(Multiple_hits) )
-        logm("Number of unique-hits reads for post-filtering: %d\n" % all_mapped)
+        logm("Number of bases in total: %d "%all_base_before_trim)
+        if adapter != "" :
+            logm("Number of reads having adapter removed: %d \n" % all_trimmed )
+            logm("Number of bases after trimming the adapters: %d (%1.3f)"%(all_base_after_trim, float(all_base_after_trim)/all_base_before_trim) )
+        logm("Number of reads are rejected because of multiple hits: %d\n" % len(Multiple_hits) )
+        logm("Number of unique-hits reads (before post-filtering): %d\n" % all_mapped)
         if asktag=="Y":
             logm(" ---- %7d FW reads mapped to Watson strand (before post-filtering)"%(numbers_premapped_lst[0]) )
             logm(" ---- %7d RC reads mapped to Watson strand (before post-filtering)"%(numbers_premapped_lst[1]) )
@@ -713,6 +712,8 @@
             logm(" ---- %7d FW reads mapped to Watson strand"%(numbers_mapped_lst[0]) )
             logm(" ---- %7d FW reads mapped to Crick strand"%(numbers_mapped_lst[1]) )
         logm("Mappability= %1.4f%%"%(100*float(all_mapped_passed)/all_raw_reads) )
+        logm("Total bases of uniquely mapped reads %7d"% all_base_mapped )
+
 
         n_CG=mC_lst[0]+uC_lst[0]
         n_CHG=mC_lst[1]+uC_lst[1]
--- a/BSseeker2/bs_align/output.py	Fri Jul 12 18:47:28 2013 -0400
+++ b/BSseeker2/bs_align/output.py	Tue Nov 05 01:55:39 2013 -0500
@@ -81,3 +81,53 @@
                           ('XG', output_genome))
 
             self.f.write(a)
+
+
+    def store2(self, qname, flag, N_mismatch, FR, refname, strand, pos, cigar, original_BS, methy, STEVE, rnext = -1, pnext = -1, qual = None, output_genome = None,
+              rrbs = False, my_region_serial = -1, my_region_start = 0, my_region_end = 0):
+
+        if self.format == BS_SEEKER1:
+
+            # remove the soft clipped bases from the read
+            # this is done for backwards compatibility with the old format
+            r_start, r_end, _ = get_read_start_end_and_genome_length(cigar)
+            original_BS = original_BS[r_start : r_end]
+
+            if rrbs:
+                self.f.write('%s\t%2d\t%s\t%s%s%s\t%s\t%s\t%s\t%d\n' % (qname, N_mismatch, FR, refname, strand, str(pos+1).zfill(10), output_genome, original_BS, methy, STEVE))
+            else:
+                self.f.write('%s\t%2d\t%s\t%s%s%s\t%s\t%s\t%s\t%d\t%d\t%d\t%d\n' % (qname, N_mismatch, FR, refname, strand, str(pos+1).zfill(10), output_genome, original_BS, methy, my_region_serial, my_region_start, my_region_end, STEVE))
+
+
+        elif self.format == BAM or self.format == SAM:
+
+            a = pysam.AlignedRead()
+            a.qname = qname
+            a.seq = original_BS if strand == '+' else reverse_compl_seq(original_BS)
+            a.flag = flag
+            a.tid = self.chrom_ids[refname]
+            a.pos = pos
+            a.mapq = 255
+            a.cigar = cigar if strand == '+' else list(reversed(cigar))
+            a.rnext = rnext if rnext == -1 else self.chrom_ids[rnext]
+            a.pnext = pnext
+            a.qual= qual
+            if rrbs:
+                a.tags = (('XO', FR),
+                          ('XS', STEVE),
+                          ('NM', N_mismatch),
+                          ('XM', methy),
+                          ('XG', output_genome),
+                          ('YR', my_region_serial),
+                          ('YS', my_region_start),
+                          ('YE', my_region_end)
+                          )
+
+            else:
+                a.tags = (('XO', FR),
+                          ('XS', STEVE),
+                          ('NM', N_mismatch),
+                          ('XM', methy),
+                          ('XG', output_genome))
+
+            self.f.write(a)
Binary file BSseeker2/bs_index/.___init__.py has changed
Binary file BSseeker2/bs_index/._rrbs_build.py has changed
Binary file BSseeker2/bs_index/._wg_build.py has changed
--- a/BSseeker2/bs_index/wg_build.py	Fri Jul 12 18:47:28 2013 -0400
+++ b/BSseeker2/bs_index/wg_build.py	Tue Nov 05 01:55:39 2013 -0500
@@ -3,8 +3,8 @@
 
 def wg_build(fasta_file, build_command, ref_path, aligner):
 
-    # ref_path is a string that containts the directory where the reference genomes are stored with
-    # the input fasta filename appended
+    # ref_path is a string that contains the directory where the reference genomes are stored with
+    # the input Fasta filename appended
     ref_path = os.path.join(ref_path,
                             os.path.split(fasta_file)[1] + '_'+aligner)
 
--- a/BSseeker2/bs_seeker2-align.py	Fri Jul 12 18:47:28 2013 -0400
+++ b/BSseeker2/bs_seeker2-align.py	Tue Nov 05 01:55:39 2013 -0500
@@ -1,4 +1,4 @@
-#!/usr/bin/python
+#!/usr/bin/env python
 
 from optparse import OptionParser, OptionGroup
 import re
@@ -7,44 +7,47 @@
 from bs_align.bs_pair_end import *
 from bs_align.bs_single_end import *
 from bs_align.bs_rrbs import *
-from bs_utils.utils import *
+#import re
+#from bs_utils.utils import *
 
 
 if __name__ == '__main__':
 
-    parser = OptionParser()
+    parser = OptionParser(usage="Usage: %prog {-i <single> | -1 <mate1> -2 <mate2>} -g <genome.fa> [options]")
     # option group 1
     opt_group = OptionGroup(parser, "For single end reads")
-    opt_group.add_option("-i", "--input", type="string", dest="infilename",help="Input your read file name (FORMAT: sequences, fastq, qseq,fasta)", metavar="INFILE")
+    opt_group.add_option("-i", "--input", type="string", dest="infilename",help="Input read file (FORMAT: sequences, qseq, fasta, fastq). Ex: read.fa or read.fa.gz", metavar="INFILE")
     parser.add_option_group(opt_group)
 
     # option group 2
     opt_group = OptionGroup(parser, "For pair end reads")
-    opt_group.add_option("-1", "--input_1", type="string", dest="infilename_1",help="Input your read file end 1 (FORMAT: sequences, qseq, fasta, fastq)", metavar="FILE")
-    opt_group.add_option("-2", "--input_2", type="string", dest="infilename_2",help="Input your read file end 2 (FORMAT: sequences, qseq, fasta, fastq)", metavar="FILE")
-    opt_group.add_option("--minins",type = "int",dest = "min_insert_size", help="The minimum insert size for valid paired-end alignments [Default: %default]", default = -1)
-    opt_group.add_option("--maxins",type = "int",dest = "max_insert_size", help="The maximum insert size for valid paired-end alignments [Default: %default]", default = 400)
+    opt_group.add_option("-1", "--input_1", type="string", dest="infilename_1",help="Input read file, mate 1 (FORMAT: sequences, qseq, fasta, fastq)", metavar="FILE")
+    opt_group.add_option("-2", "--input_2", type="string", dest="infilename_2",help="Input read file, mate 2 (FORMAT: sequences, qseq, fasta, fastq)", metavar="FILE")
+    opt_group.add_option("-I", "--minins",type = "int",dest = "min_insert_size", help="The minimum insert size for valid paired-end alignments [Default: %default]", default = 0)
+    opt_group.add_option("-X", "--maxins",type = "int",dest = "max_insert_size", help="The maximum insert size for valid paired-end alignments [Default: %default]", default = 500)
     parser.add_option_group(opt_group)
 
     # option group 3
     opt_group = OptionGroup(parser, "Reduced Representation Bisulfite Sequencing Options")
-    opt_group.add_option("-r", "--rrbs", action="store_true", dest="rrbs", default = False, help = 'Process reads from Reduced Representation Bisulfite Sequencing experiments')
+    opt_group.add_option("-r", "--rrbs", action="store_true", dest="rrbs", default = False, help = 'Map reads to the Reduced Representation genome')
     opt_group.add_option("-c", "--cut-site", type="string",dest="cut_format", help="Cutting sites of restriction enzyme. Ex: MspI(C-CGG), Mael:(C-TAG), double-enzyme MspI&Mael:(C-CGG,C-TAG). [Default: %default]", metavar="pattern", default = "C-CGG")
-    opt_group.add_option("-L", "--low", type = "int", dest="rrbs_low_bound", help="lower bound of fragment length (excluding C-CGG ends) [Default: %default]", default = 40)
-    opt_group.add_option("-U", "--up", type = "int", dest="rrbs_up_bound", help="upper bound of fragment length (excluding C-CGG ends) [Default: %default]", default = 500)
+    opt_group.add_option("-L", "--low", type = "int", dest="rrbs_low_bound", help="Lower bound of fragment length (excluding C-CGG ends) [Default: %default]", default = 20)
+    opt_group.add_option("-U", "--up", type = "int", dest="rrbs_up_bound", help="Upper bound of fragment length (excluding C-CGG ends) [Default: %default]", default = 500)
     parser.add_option_group(opt_group)
 
     # option group 4
     opt_group = OptionGroup(parser, "General options")
     opt_group.add_option("-t", "--tag", type="string", dest="taginfo",help="[Y]es for undirectional lib, [N]o for directional [Default: %default]", metavar="TAG", default = 'N')
-    opt_group.add_option("-s","--start_base",type = "int",dest = "cutnumber1", help="The first base of your read to be mapped [Default: %default]", default = 1)
-    opt_group.add_option("-e","--end_base",type = "int",dest = "cutnumber2", help="The last cycle number of your read to be mapped [Default: %default]", default = 200)
-    opt_group.add_option("-a", "--adapter", type="string", dest="adapter_file",help="Input text file of your adaptor sequences (to be trimed from the 3'end of the reads). Input 1 seq for dir. lib., 2 seqs for undir. lib. One line per sequence", metavar="FILE", default = '')
-    opt_group.add_option("--am",type = "int",dest = "adapter_mismatch", help="Number of mismatches allowed in adaptor [Default: %default]", default = 0)
-    opt_group.add_option("-g", "--genome", type="string", dest="genome",help="Name of the reference genome (the same as the reference genome file in the preprocessing step) [ex. chr21_hg18.fa]")
-    opt_group.add_option("-m", "--mismatches",type = "int", dest="int_no_mismatches",help="Number of mismatches in one read [Default: %default]", default = 4)
-    opt_group.add_option("--aligner", dest="aligner",help="Aligner program to perform the analisys: " + ', '.join(supported_aligners) + " [Default: %default]", metavar="ALIGNER", default = BOWTIE2)
-    opt_group.add_option("-p", "--path", dest="aligner_path", help="Path to the aligner program. Defaults: " +' '*70+ '\t'.join(('%s: %s '+' '*70) % (al, aligner_path[al]) for al in sorted(supported_aligners)),
+    opt_group.add_option("-s","--start_base",type = "int",dest = "cutnumber1", help="The first cycle of the read to be mapped [Default: %default]", default = 1)
+    opt_group.add_option("-e","--end_base",type = "int",dest = "cutnumber2", help="The last cycle of the read to be mapped [Default: %default]", default = 200)
+    opt_group.add_option("-a", "--adapter", type="string", dest="adapter_file",help="Input text file of your adaptor sequences (to be trimmed from the 3'end of the reads, ). "
+                                                                                    "Input one seq for dir. lib., twon seqs for undir. lib. One line per sequence. "
+                                                                                    "Only the first 10bp will be used", metavar="FILE", default = '')
+    opt_group.add_option("--am",type = "int",dest = "adapter_mismatch", help="Number of mismatches allowed in adapter [Default: %default]", default = 0)
+    opt_group.add_option("-g", "--genome", type="string", dest="genome",help="Name of the reference genome (should be the same as \"-f\" in bs_seeker2-build.py ) [ex. chr21_hg18.fa]")
+    opt_group.add_option("-m", "--mismatches",type = "float", dest="no_mismatches",help="Number of mismatches in one read [Default: %default]", default = 4)
+    opt_group.add_option("--aligner", dest="aligner",help="Aligner program for short reads mapping: " + ', '.join(supported_aligners) + " [Default: %default]", metavar="ALIGNER", default = BOWTIE)
+    opt_group.add_option("-p", "--path", dest="aligner_path", help="Path to the aligner program. Detected: " +' '*70+ '\t'.join(('%s: %s '+' '*70) % (al, aligner_path[al]) for al in sorted(supported_aligners)),
         metavar="PATH"
     )
     opt_group.add_option("-d", "--db", type="string", dest="dbpath",help="Path to the reference genome library (generated in preprocessing genome) [Default: %default]" , metavar="DBPATH", default = reference_genome_path)
@@ -52,7 +55,7 @@
     opt_group.add_option("-o", "--output", type="string", dest="outfilename",help="The name of output file [INFILE.bs(se|pe|rrbs)]", metavar="OUTFILE")
     opt_group.add_option("-f", "--output-format", type="string", dest="output_format",help="Output format: "+', '.join(output.formats)+" [Default: %default]", metavar="FORMAT", default = output.BAM)
     opt_group.add_option("--no-header", action="store_true", dest="no_SAM_header",help="Suppress SAM header lines [Default: %default]", default = False)
-    opt_group.add_option("--temp_dir", type="string", dest="temp_dir",help="The path to your temporary directory [Default: %default]", metavar="PATH", default = tempfile.gettempdir())
+    opt_group.add_option("--temp_dir", type="string", dest="temp_dir",help="The path to your temporary directory [Detected: %default]", metavar="PATH", default = tempfile.gettempdir())
     opt_group.add_option("--XS",type = "string", dest="XS_filter",help="Filter definition for tag XS, format X,Y. X=0.8 and y=5 indicate that for one read, if #(mCH sites)/#(all CH sites)>0.8 and #(mCH sites)>5, then tag XS=1; or else tag XS=0. [Default: %default]", default = "0.5,5") # added by weilong
     opt_group.add_option("--multiple-hit", action="store_true", dest="Output_multiple_hit", default = False, help = 'Output reads with multiple hits to file\"Multiple_hit.fa\"')
 
@@ -96,7 +99,7 @@
 
     # if no options were given by the user, print help and exit
     if len(sys.argv) == 1:
-        print parser.print_help()
+        parser.print_help()
         exit(0)
 
     if options.version :
@@ -112,6 +115,38 @@
 
     if not (options.infilename or (options.infilename_1 and options.infilename_2)):
         error('You should set either -i or -1 and -2 options.')
+
+    # Calculate the length of read
+    if options.infilename :
+        read_file = options.infilename
+    elif options.infilename_1 :
+        read_file = options.infilename_1
+    else :
+        error('You should at least specify -i or -1 options.')
+
+    try :
+        if read_file.endswith(".gz") : # support input file ending with ".gz"
+            read_inf = gzip.open(read_file, "rb")
+        else :
+            read_inf=open(read_file,"r")
+    except IOError :
+        print "[Error] Cannot open input file : %s" % read_file
+        exit(-1)
+    oneline = read_inf.readline()
+    oneline = read_inf.readline() # get the second line
+    read_len = min(len(oneline), (options.cutnumber2-options.cutnumber1))
+    read_inf.close()
+    # mismatch allowed: bowtie 1,build-in parameter '-m'; bowtie 2, post-filter paramter
+    # mismatch should no greater than the read length
+    no_mismatches = float(options.no_mismatches)
+    if (no_mismatches < 1) :
+        int_no_mismatches=int(no_mismatches * read_len)
+    else :
+        int_no_mismatches=int(no_mismatches)
+
+    str_no_mismatches=str(options.no_mismatches) # pass to specific mode
+
+
     # -t, directional / un-directional library
     asktag=str(options.taginfo).upper()
     if asktag not in 'YN':
@@ -121,10 +156,8 @@
         error('-a option should be: %s' % ' ,'.join(supported_aligners)+'.')
     # path for aligner
     aligner_exec = os.path.expanduser( os.path.join(options.aligner_path or aligner_path[options.aligner], options.aligner) )
-    # mismatch allowed: bowtie 1,build-in parameter '-m'; bowtie 2, post-filter paramter
-    # mismatch should no greater than the read length
-    int_no_mismatches=min(options.int_no_mismatches, options.cutnumber2-options.cutnumber1)
-    str_no_mismatches=str(int_no_mismatches)
+
+
     # -g
     if options.genome is None:
         error('-g is a required option')
@@ -149,19 +182,17 @@
 
     db_path = os.path.expanduser(os.path.join(options.dbpath, genome_subdir + '_' + options.aligner))
 
+
     if not os.path.isdir(db_path):
         error('Index DIR \"' + genome_subdir + '..\" cannot be found in ' + options.dbpath +'.\n\tPlease run the bs_seeker2-build.py '
                             'to create it with the correct parameters for -g, -r, --low, --up and --aligner.')
 
-    # handle aligner options
-    #
-
     # default aligner options
     aligner_options_defaults = {
                                 BOWTIE  : { '-e'              : 40*int_no_mismatches,
                                             '--nomaqround'    : True,
                                             '--norc'          : True,
-                                            '-k'              : 2,
+                                            #'-k'              : 2,
                                             # -k=2; report two best hits, and filter by error rates
                                             '--quiet'         : True,
                                             '--best'          : True,
@@ -179,7 +210,7 @@
                                             # run bowtie2 in local mode by default
                                             '--local' : '--end-to-end' not in aligner_options,
                                             #'--mm'            : True,
-                                            '-k'              : 2
+                                            #'-k'              : 2
                                 },
                                 SOAP    : { '-v' : int_no_mismatches,
                                             '-p' : 2,
@@ -238,13 +269,22 @@
         else:
             aligner_title = aligner_title + "-local"
 
+    if options.aligner == BOWTIE :
+        logm("Mode: Bowtie")
+    elif options.aligner == BOWTIE2 :
+        if '--end-to-end' not in aligner_options :
+            logm("Mode: Bowtie2, local alignment")
+        else :
+            logm("Mode: Bowtie2, end-to-end alignment")
+
+
     tmp_path = tempfile.mkdtemp(prefix='bs_seeker2_%s_-%s-TMP-' % (os.path.split(outfilename)[1], aligner_title ), dir = options.temp_dir)
 
 
     (XS_x, XS_y) = options.XS_filter.split(",")
     XS_pct = float(XS_x)
     XS_count = int(XS_y)
-    logm('Filter for tag XS: #(mCH)/#(all CH)>%f and #(mCH)>%d' % (XS_pct, XS_count))
+    logm('Filter for tag XS: #(mCH)/#(all CH)>%.2f%% and #(mCH)>%d' % (XS_pct*100, XS_count))
 
 
     logm('Temporary directory: %s' % tmp_path)
@@ -253,8 +293,8 @@
         logm('Single end')
 
         aligner_command = aligner_exec  + aligner_options_string() + \
-                              { BOWTIE   : ' %(reference_genome)s  -f %(input_file)s %(output_file)s',
-                                BOWTIE2  : ' -x %(reference_genome)s -f -U %(input_file)s -S %(output_file)s',
+                              { BOWTIE   : ' -k 2 %(reference_genome)s  -f %(input_file)s %(output_file)s',
+                                BOWTIE2  : ' -k 2 -x %(reference_genome)s -f -U %(input_file)s -S %(output_file)s',
                                 SOAP     : ' -D %(reference_genome)s.fa.index -o %(output_file)s -a %(input_file)s',
                                 RMAP     : ' -c %(reference_genome)s.fa -o %(output_file)s %(input_file)s'
                               }[options.aligner]
@@ -263,7 +303,6 @@
         if options.rrbs: # RRBS scan
             bs_rrbs(options.infilename,
                     asktag,
-            #        options.rrbs_taginfo,
                     options.adapter_file,
                     options.cutnumber1,
                     options.cutnumber2,
@@ -299,18 +338,18 @@
     else:
         logm('Pair end')
         # pair end specific default options
-        aligner_options = dict({BOWTIE: {'--ff'  : asktag == 'N',
-                                         '--fr'  : asktag == 'Y',
+        aligner_options = dict({BOWTIE: {'--fr'  : True,
                                          '-X'    : options.max_insert_size,
-                                         '-I'    : options.min_insert_size if options.min_insert_size > 0 else None
+                                         '-I'    : options.min_insert_size if options.min_insert_size > 0 else None,
+                                         '-a'    : True # "-k 2" in bowtie would not report the best two
                                 },
                                 BOWTIE2 : {
-                                         '--ff'  : asktag == 'N',
-                                         '--fr'  : asktag == 'Y',
+                                         '--fr'  : True,
                                          '-X'    : options.max_insert_size,
                                          '-I'    : options.min_insert_size if options.min_insert_size > 0 else None,
                                          '--no-discordant'  : True,
-                                         '--no-mixed'       : True
+                                         '--no-mixed'       : True,
+                                         '-k'    : 2
                                 },
                                 SOAP: {
                                         '-x' : options.max_insert_size,
@@ -328,6 +367,11 @@
 
         logm('Aligner command: %s' % aligner_command)
 
+        if '--end-to-end' not in aligner_options:
+            aligner_options_defaults[BOWTIE2].update({'-D' : 50})
+        else:
+            aligner_options_defaults[BOWTIE2].update({'-D' : 50, '-L': 15, '--score-min': 'L,-0.6,-0.6' })
+
         bs_pair_end(options.infilename_1,
                     options.infilename_2,
                     asktag,
@@ -342,6 +386,7 @@
                     outfile,
                     XS_pct,
                     XS_count,
+                    options.adapter_mismatch,
                     options.Output_multiple_hit
              )
 
--- a/BSseeker2/bs_seeker2-build.py	Fri Jul 12 18:47:28 2013 -0400
+++ b/BSseeker2/bs_seeker2-build.py	Tue Nov 05 01:55:39 2013 -0500
@@ -1,4 +1,4 @@
-#!/usr/bin/python
+#!/usr/bin/env python
 
 import os
 from optparse import OptionParser, OptionGroup
@@ -12,8 +12,8 @@
     parser = OptionParser()
 
     parser.add_option("-f", "--file", dest="filename", help="Input your reference genome file (fasta)", metavar="FILE")
-    parser.add_option("--aligner", dest="aligner", help="Aligner program to perform the analysis: " + ', '.join(supported_aligners) + " [Default: %default]", metavar="ALIGNER", default = BOWTIE2)
-    parser.add_option("-p", "--path", dest="aligner_path", help="Path to the aligner program. Defaults: " +' '*70+ '\t'.join(('%s: %s '+' '*70) % (al, aligner_path[al]) for al in sorted(supported_aligners)),
+    parser.add_option("--aligner", dest="aligner", help="Aligner program to perform the analysis: " + ', '.join(supported_aligners) + " [Default: %default]", metavar="ALIGNER", default = BOWTIE)
+    parser.add_option("-p", "--path", dest="aligner_path", help="Path to the aligner program. Detected: " +' '*70+ '\t'.join(('%s: %s '+' '*70) % (al, aligner_path[al]) for al in sorted(supported_aligners)),
                   metavar="PATH")
     parser.add_option("-d", "--db", type="string", dest="dbpath", help="Path to the reference genome library (generated in preprocessing genome) [Default: %default]", metavar="DBPATH", default = reference_genome_path)
 
@@ -23,7 +23,7 @@
     rrbs_opts = OptionGroup(parser, "Reduced Representation Bisulfite Sequencing Options",
                                 "Use this options with conjuction of -r [--rrbs]")
     rrbs_opts.add_option("-r", "--rrbs", action="store_true", dest="rrbs", help = 'Build index specially for Reduced Representation Bisulfite Sequencing experiments. Genome other than certain fragments will be masked. [Default: %default]', default = False)
-    rrbs_opts.add_option("-l", "--low",type= "int", dest="low_bound", help="lower bound of fragment length (excluding recognition sequence such as C-CGG) [Default: %default]", default = 40)
+    rrbs_opts.add_option("-l", "--low",type= "int", dest="low_bound", help="lower bound of fragment length (excluding recognition sequence such as C-CGG) [Default: %default]", default = 20)
     rrbs_opts.add_option("-u", "--up", type= "int", dest="up_bound", help="upper bound of fragment length (excluding recognition sequence such as C-CGG ends) [Default: %default]", default = 500)
     rrbs_opts.add_option("-c", "--cut-site", type= "string", dest="cut_format", help="Cut sites of restriction enzyme. Ex: MspI(C-CGG), Mael:(C-TAG), double-enzyme MspI&Mael:(C-CGG,C-TAG). [Default: %default]", default = "C-CGG")
     parser.add_option_group(rrbs_opts)
@@ -33,7 +33,7 @@
 
     # if no options were given by the user, print help and exit
     if len(sys.argv) == 1:
-        print parser.print_help()
+        parser.print_help()
         exit(0)
 
     if options.version :
@@ -44,7 +44,11 @@
 
     rrbs = options.rrbs
 
-    fasta_file=os.path.expanduser(options.filename)
+    if options.filename is not None :
+        fasta_file=os.path.expanduser(options.filename)
+    else :
+        error("Please specify the genome file (Fasta) using \"-f\"")
+
     if fasta_file is None:
         error('Fasta file for the reference genome must be supported')
 
@@ -69,9 +73,14 @@
 
     print "Reference genome file: %s" % fasta_file
     print "Reduced Representation Bisulfite Sequencing: %s" % rrbs
+    print "Short reads aligner you are using: %s" % options.aligner
     print "Builder path: %s" % builder_exec
+
     #---------------------------------------------------------------
 
+    if not os.path.isfile( builder_exec ) :
+        error("Cannot file program %s for execution." % builder_exec)
+
     ref_path = options.dbpath
 
     if os.path.exists(ref_path):
--- a/BSseeker2/bs_seeker2-call_methylation.py	Fri Jul 12 18:47:28 2013 -0400
+++ b/BSseeker2/bs_seeker2-call_methylation.py	Tue Nov 05 01:55:39 2013 -0500
@@ -1,4 +1,4 @@
-#!/usr/bin/python
+#!/usr/bin/env python
 
 from optparse import OptionParser, OptionGroup
 from bs_utils.utils import *
@@ -71,7 +71,7 @@
 
     # if no options were given by the user, print help and exit
     if len(sys.argv) == 1:
-        print parser.print_help()
+        parser.print_help()
         exit(0)
 
     if options.version :
@@ -133,8 +133,6 @@
         nuc, context, subcontext = context_calling(chrom_seq, col.pos)
         total_reads = 0
 
-
-
         for pr in col.pileups:
         #     print pr
              if (not pr.indel) : # skip indels
@@ -152,7 +150,6 @@
                     print 'WARNING: read %s has an invalid alignment. Discarding.. ' % pr.alignment.qname
                     continue
                 read_nuc = pr.alignment.seq[pr.qpos]
-         #       print "read_nuc=", read_nuc
                 if pr.alignment.is_reverse:
                     ATCG_rev[read_nuc] += 1
                 else:
@@ -194,7 +191,8 @@
                 wiggle.write('%d\t%f\n' % (pos, meth_level))
             else :
                 wiggle.write('%d\t-%f\n' % (pos, meth_level))
-            CGmap.write('%(chrom)s\t%(nuc)s\t%(pos)d\t%(context)s\t%(subcontext)s\t%(meth_level_string)s\t%(meth_cytosines)s\t%(all_cytosines)s\n' % locals())
+
+        CGmap.write('%(chrom)s\t%(nuc)s\t%(pos)d\t%(context)s\t%(subcontext)s\t%(meth_level_string)s\t%(meth_cytosines)s\t%(all_cytosines)s\n' % locals())
     ATCGmap.close()
     CGmap.close()
     wiggle.close()
Binary file BSseeker2/bs_utils/.___init__.py has changed
Binary file BSseeker2/bs_utils/._utils.py has changed
--- a/BSseeker2/bs_utils/utils.py	Fri Jul 12 18:47:28 2013 -0400
+++ b/BSseeker2/bs_utils/utils.py	Tue Nov 05 01:55:39 2013 -0500
@@ -23,7 +23,7 @@
 
 def show_version() :
     print ""
-    print "     BS-Seeker2 v2.0.3 - May 19, 2013     "
+    print "     BS-Seeker2 v2.0.5 - Nov 5, 2013     "
     print ""
 
 
@@ -135,14 +135,15 @@
                              SOAP    : '--soap-',
                              RMAP    : '--rmap-' }
 
-aligner_path = dict((aligner, os.path.expanduser(find_location(aligner) or default_path))
-                    for aligner, default_path in
-                           [(BOWTIE,'~/bowtie-0.12.7/'),
-                            (BOWTIE2, '~/bowtie-0.12.7/'),
-                            (SOAP, '~/soap2.21release/'),
-                            (RMAP, '~/rmap_v2.05/bin')
-                            ])
-
+#aligner_path = dict((aligner, os.path.expanduser(find_location(aligner) or default_path))
+#                    for aligner, default_path in
+#                           [(BOWTIE,'~/bowtie/'),
+#                            (BOWTIE2, '~/bowtie2/'),
+#                            (SOAP, '~/soap/'),
+#                            (RMAP, '~/rmap/bin')
+#                            ])
+aligner_path = dict((aligner, os.path.expanduser(find_location(aligner) or "None"))
+                    for aligner in [(BOWTIE), (BOWTIE2), (SOAP), (RMAP)])
 
 reference_genome_path = os.path.join(os.path.split(globals()['__file__'])[0],'reference_genomes')
 
@@ -214,7 +215,10 @@
     """ Splits a file (equivalend to UNIX split -l ) """
     fno = 0
     lno = 0
-    INPUT = open(filename, 'r')
+    if filename.endswith(".gz") :
+        INPUT = gzip.open(filename, 'rb')
+    else :
+        INPUT = open(filename, 'r')
     output = None
     for l in INPUT:
         if lno == 0:
@@ -321,7 +325,10 @@
 
     commands = [(cmd[0], open(cmd[1], 'w')) if type(cmd) is tuple else (cmd, None) for cmd in commands]
 
-    logm('Starting commands:\n' + '\n'.join([cmd for cmd, stdout in commands]))
+    #logm('Starting commands:\n' + '\n'.join([cmd for cmd, stdout in commands]))
+    logm('Starting commands:')
+    for cmd, stdout in commands :
+        logm("Launched: "+cmd)
     for i, proc in enumerate([subprocess.Popen(args = shlex.split(cmd), stdout = stdout) for cmd, stdout in commands]):
         return_code = proc.wait()
         logm('Finished: ' + commands[i][0])
Binary file BSseeker2/galaxy/.___init__.py has changed
Binary file BSseeker2/galaxy/._bs_seeker2_wrapper.py has changed
Binary file BSseeker2/galaxy/._bs_seeker2_wrapper.xml has changed
--- a/BSseeker2/galaxy/bs_seeker2_wrapper.py	Fri Jul 12 18:47:28 2013 -0400
+++ b/BSseeker2/galaxy/bs_seeker2_wrapper.py	Tue Nov 05 01:55:39 2013 -0500
@@ -114,7 +114,6 @@
                                     ('_rrbs_%s_%s' % (getopt(args[ALIGN], '-l', '--low', '40'),
                                                       getopt(args[ALIGN], '-u', '--up', '500'))
                                      if len(set(['-r', '--rrbs']) & set(args[ALIGN])) > 0 else '') +
-
                                     '_' + args[ALIGN]['--aligner'])
                                     })
     run_prog(os.path.join(path_to_bs_seeker, 'bs_seeker2-call_methylation.py'), args[CALL_METHYLATION])
--- a/BSseeker2/galaxy/bs_seeker2_wrapper.xml	Fri Jul 12 18:47:28 2013 -0400
+++ b/BSseeker2/galaxy/bs_seeker2_wrapper.xml	Tue Nov 05 01:55:39 2013 -0500
@@ -1,255 +1,270 @@
-<tool id="bs_seeker_wrapper" name="BS-Seeker2" version="2.0.0">
-  <requirements><requirement type='package'>bs_seeker2</requirement></requirements>
-  <description>Versatile aligner for bisulfite sequencing data</description>
-  <command interpreter="python">
-      bs_seeker2_wrapper.py
-      ### define exec path
-      ###    --exec-path "/u/home/galaxy/galaxy/GalaxyTools/bin"
-      ### [Please change the following path to your local directory]
-          --exec-path "/Users/weilong/Documents/program/BSseeker2"
-      ### output
-          --align--output $align_output
-          --call_methylation--wig $call_methylation_wig
-          --call_methylation--CGmap $call_methylation_CGmap
-          --call_methylation--ATCGmap $call_methylation_ATCGmap
-          --call_methylation--txt
-
-      #if $singlePaired.sPaired == "paired"
-          --align--input_1 $input1
-          --align--input_2 $singlePaired.input2
-      #end if
-
-
-      ### aligner
-      --align--aligner ${choosealigner.aligner}
-
-      ### Index from history or built-in
-      #if $choosealigner.rrbsFragments.refGenomeSource.genomeSource == "history"
-          --build--file ${choosealigner.rrbsFragments.refGenomeSource.ownFile}
-          --build--aligner ${choosealigner.aligner}
-          --align-g ${choosealigner.rrbsFragments.refGenomeSource.ownFile}
-          --align--db ${choosealigner.rrbsFragments.refGenomeSource.ownFile}
-      #else if $choosealigner.rrbsFragments.refGenomeSource.genomeSource == "indexed"
-          --align--db ${choosealigner.rrbsFragments.refGenomeSource.index.fields.path}
-          --align-g ${choosealigner.rrbsFragments.refGenomeSource.index.fields.path}/${choosealigner.rrbsFragments.refGenomeSource.index.fields.dbkey}.fa
-
-      #end if
-
-      ### RRBS or WGBS
-      #if $choosealigner.rrbsFragments.Fragmented == "Yes"
-          #if $choosealigner.rrbsFragments.refGenomeSource.genomeSource == "history"
-            --build--rrbs
-            --build--low ${choosealigner.rrbsFragments.lowerBound}
-            --build--up ${choosealigner.rrbsFragments.upperBound}
-          #end if
-          --align--rrbs
-          --align--low ${choosealigner.rrbsFragments.lowerBound}
-          --align--up ${choosealigner.rrbsFragments.upperBound}
-      #end if
-
-
-
-      ### Inputs
-      #if $singlePaired.sPaired == "single"
-          --align-i $input1
-      #end if
-
-      ### Library type
-          --align-t $tag
-
-      ### other general options
-      #if $sParams.sSettingsType == "preSet"
-          --align--start_base 1
-          --align--end_base 200
-          --align--mis 4
-      #end if
-
-      ### adapter information
-      #if $adapterInfo.useAdapter == "Yes"
-          --align--adapter ${adapterInfo.adapter_file}
-      #end if
-
-      #if $sParams.sSettingsType == "full"
-          --align--start_base ${sParams.start_base}
-          --align--end_base ${sParams.end_base}
-          --align--mis ${sParams.num_mismatch}
-      #end if
-
-  </command>
-  <inputs>
-     <param format="fastq,fasta,qseq" name="input1" type="data" label="Input your read file" help="reads file in fastq, qseq or fasta format" />
-     <conditional name="singlePaired">
-        <param name="sPaired" type="select" label="Is this library mate-paired?">
-          <option value="single">Single-end</option>
-          <option value="paired">Paired-end</option>
-        </param>
-        <when value="paired">
-          <param format="fastq,fasta,qseq" name="input2" type="data" label="Input your read file 2" help="reads in fastq, qseq or fasta format" />
-          <param name="min_ins_distance" type="integer" value="-1" label=" Minimum insert size for valid paired-end alignments" />
-          <param name="max_ins_distance" type="integer" value="400" label="Maximum insert size for valid paired-end alignments" />
-        </when>
-     </conditional> 
-     <param name="tag" type="select" label="Type of libraries">
-        <option value="N">directional libraries</option>
-        <option value="Y">undirectional libraries</option>
-     </param>
-     <conditional name="choosealigner">
-         <param name="aligner" type="select" label="Short reads aligner">
-             <option value="bowtie">bowtie</option>
-             <option value="bowtie2">bowtie2</option>
-         </param>
-         <when value="bowtie">
-             <conditional name="rrbsFragments">
-                 <param name="Fragmented" type="select" label="RRBS-seq reads" help="">
-                     <option value="No">No</option>
-                     <option value="Yes">Yes</option>
-                 </param>
-                 <when value="Yes">
-                     <param name="lowerBound" type="integer" value="40" label="The lower bound for RRBS fragments" help="Default: 40" />
-                     <param name="upperBound" type="integer" value="500" label="The upper bound for RRBS fragments" help="Default: 500" />
-                     <conditional name="refGenomeSource">
-                         <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="">
-                             <option value="indexed">Use a built-in index</option>
-                             <option value="history">Use one from the history</option>
-                         </param>
-                         <when value="indexed">
-                             <param name="index" type="select" label="Select a reference genome (RRBS, bowtie)">
-                                 <options from_data_table="bs_seeker2_indexes_RRBS_bowtie">
-                                     <filter type="sort_by" column="2"/>
-                                     <validator type="no_options" message="No indexes are available for the selected input dataset"/>
-                                 </options>
-                             </param>
-                         </when>
-                         <when value="history">
-                             <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" />
-                         </when>
-                     </conditional>
-                 </when>
-                 <when value="No">
-                     <conditional name="refGenomeSource">
-                         <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="">
-                             <option value="indexed">Use a built-in index</option>
-                             <option value="history">Use one from the history</option>
-                         </param>
-                         <when value="indexed">
-                             <param name="index" type="select" label="Select a reference genome (WGBS, bowtie)">
-                                 <options from_data_table="bs_seeker2_indexes_WGBS_bowtie">
-                                     <filter type="sort_by" column="2"/>
-                                     <validator type="no_options" message="No indexes are available for the selected input dataset"/>
-                                 </options>
-                             </param>
-                         </when>
-                         <when value="history">
-                             <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" />
-                         </when>
-                     </conditional>
-                 </when>
-             </conditional>
-         </when>
-
-         <when value="bowtie2">
-             <conditional name="rrbsFragments">
-                 <param name="Fragmented" type="select" label="RRBS-seq reads" help="">
-                     <option value="No">No</option>
-                     <option value="Yes">Yes</option>
-                 </param>
-                 <when value="Yes">
-                     <param name="lowerBound" type="integer" value="40" label="The lower bound for RRBS fragments" help="Default: 40" />
-                     <param name="upperBound" type="integer" value="500" label="The upper bound for RRBS fragments" help="Default: 500" />
-                     <conditional name="refGenomeSource">
-                         <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="">
-                             <option value="indexed">Use a built-in index</option>
-                             <option value="history">Use one from the history</option>
-                         </param>
-                         <when value="indexed">
-                             <param name="index" type="select" label="Select a reference genome (RRBS, bowtie2)">
-                                 <options from_data_table="bs_seeker2_indexes_RRBS_bowtie2">
-                                     <filter type="sort_by" column="2"/>
-                                     <validator type="no_options" message="No indexes are available for the selected input dataset"/>
-                                 </options>
-                             </param>
-                         </when>
-                         <when value="history">
-                             <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" />
-                         </when>
-                     </conditional>
-                 </when>
-                 <when value="No">
-                     <conditional name="refGenomeSource">
-                         <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="">
-                             <option value="indexed">Use a built-in index</option>
-                             <option value="history">Use one from the history</option>
-                         </param>
-                         <when value="indexed">
-                             <param name="index" type="select" label="Select a reference genome (WGBS, bowtie2)">
-                                 <options from_data_table="bs_seeker2_indexes_WGBS_bowtie2">
-                                     <filter type="sort_by" column="2"/>
-                                     <validator type="no_options" message="No indexes are available for the selected input dataset"/>
-                                 </options>
-                             </param>
-                         </when>
-                         <when value="history">
-                             <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" />
-                         </when>
-                     </conditional>
-                 </when>
-             </conditional>
-         </when>
-     </conditional>
-     <conditional name="adapterInfo">
-        <param name="useAdapter" type="select" label="adapter sequence">
-           <option value="noAdapter">No</option>
-           <option value="withAdapter">Yes</option>
-        </param>
-        <when value="withAdapter">
-           <param format="txt" name="adapter_file" type="data" label="Input file of your adaptor sequences" help="Input text file of your adaptor sequences" />
-        </when>
-     </conditional>
-
-     <conditional name="sParams">
-       <param name="sSettingsType" type="select" label="BS Seeker2 settings to use" help="You can use the default settings or set customer values for the BS Seeker2 parameters.">
-         <option value="preSet">User Defaults</option>
-         <option value="full">Full parameter list</option>
-       </param>
-       <when value="preSet" /> 
-       <when value="full">
-           <param name="start_base" type="integer" value="1" label="The start base of the read to be mapped" help="" />
-           <param name="end_base" type="integer" value="200" label="The end base of the read to be mapped" help="" />
-
-           <param name="num_mismatch" type="integer" value="4" label="Number of mismatches" help="(INT) Default: 4" />
-       </when>   
-     </conditional>
-
-</inputs>
-
-  <outputs>
-    <data format="bam" name="align_output"  label="BAM Alignments"> </data>
-    <data format="wig" name="call_methylation_wig"  label="Methylation Levels"> </data>
-    <data format="tabular" name="call_methylation_CGmap"  label="CGmap file"> </data>
-    <data format="tabular" name="call_methylation_ATCGmap"  label="ATCGmap file"> </data>
-
-  </outputs>
-  <help>
-**What it does**
-
-BS-Seeker2 is a seamlessly pipeline for mapping bisulfite sequencing data and generating detailed DNA methylome. BS-Seeker2 improves mappability by using local alignment, and is tailored for RRBS library by building special index, with higher efficiency and accuracy. This is the Galaxy version of BS-Seeker2.
-
-------
-
-**Resources**
-
-The homepage for BS-Seeker2 is http://pellegrini.mcdb.ucla.edu/BS_Seeker2/.
-
-For more information of BS-Seeker2, please refer to https://github.com/BSSeeker/BSseeker2.
-
-------
-
-**Example**
-
-- Adapter file::
-
-      AGATCGGAAGAGCACACGTC
-
-
-  </help>
-</tool>
+<tool id="bs_seeker_wrapper" name="BS-Seeker2" version="2.0.0">
+  <requirements><requirement type='package'>bs_seeker2</requirement></requirements>
+  <description>Versatile aligner for bisulfite sequencing data</description>
+  <command interpreter="python">
+      bs_seeker2_wrapper.py
+      ### define exec path
+      ###    --exec-path "/u/home/galaxy/galaxy/GalaxyTools/bin"
+      ### [Please change the following path to your local directory]
+          --exec-path "/Users/weilong/Documents/program/BSseeker2"
+      ### output
+          --align--output $align_output
+          --call_methylation--wig $call_methylation_wig
+          --call_methylation--CGmap $call_methylation_CGmap
+          --call_methylation--ATCGmap $call_methylation_ATCGmap
+          --call_methylation--txt
+
+      #if $singlePaired.sPaired == "paired"
+          --align--input_1 $input1
+          --align--input_2 $singlePaired.input2
+      #end if
+
+
+      ### aligner
+      --align--aligner ${choosealigner.aligner}
+      #if $choosealigner.aligner == "bowtie2"
+          #if $choosealigner.mode_type == "local"
+              --align--bt2--local
+          #else
+              --align--bt2--end-to-end
+          #end if
+      #end if
+
+      ### Index from history or built-in
+      #if $choosealigner.rrbsFragments.refGenomeSource.genomeSource == "history"
+          --build--file ${choosealigner.rrbsFragments.refGenomeSource.ownFile}
+          --build--aligner ${choosealigner.aligner}
+          --align-g ${choosealigner.rrbsFragments.refGenomeSource.ownFile}
+          --align--db ${choosealigner.rrbsFragments.refGenomeSource.ownFile}
+      #else if $choosealigner.rrbsFragments.refGenomeSource.genomeSource == "indexed"
+          --align--db ${choosealigner.rrbsFragments.refGenomeSource.index.fields.path}
+          --align-g ${choosealigner.rrbsFragments.refGenomeSource.index.fields.path}/${choosealigner.rrbsFragments.refGenomeSource.index.fields.dbkey}.fa
+
+      #end if
+
+      ### RRBS or WGBS
+      #if $choosealigner.rrbsFragments.Fragmented == "Yes"
+          #if $choosealigner.rrbsFragments.refGenomeSource.genomeSource == "history"
+            --build--rrbs
+            --build--low ${choosealigner.rrbsFragments.lowerBound}
+            --build--up ${choosealigner.rrbsFragments.upperBound}
+          #end if
+          --align--rrbs
+          --align--low ${choosealigner.rrbsFragments.lowerBound}
+          --align--up ${choosealigner.rrbsFragments.upperBound}
+      #end if
+
+
+
+      ### Inputs
+      #if $singlePaired.sPaired == "single"
+          --align-i $input1
+      #end if
+
+      ### Library type
+          --align-t $tag
+
+      ### other general options
+      #if $sParams.sSettingsType == "preSet"
+          --align--start_base 1
+          --align--end_base 200
+          --align--mis 4
+      #end if
+
+      ### adapter information
+      #if $adapterInfo.useAdapter == "Yes"
+          --align--adapter ${adapterInfo.adapter_file}
+      #end if
+
+      #if $sParams.sSettingsType == "full"
+          --align--start_base ${sParams.start_base}
+          --align--end_base ${sParams.end_base}
+          --align--mis ${sParams.num_mismatch}
+      #end if
+
+  </command>
+  <inputs>
+     <param format="fastq,fasta,qseq" name="input1" type="data" label="Input your read file" help="reads file in fastq, qseq or fasta format" />
+     <conditional name="singlePaired">
+        <param name="sPaired" type="select" label="Is this library mate-paired?">
+          <option value="single">Single-end</option>
+          <option value="paired">Paired-end</option>
+        </param>
+        <when value="paired">
+          <param format="fastq,fasta,qseq" name="input2" type="data" label="Input your read file 2" help="reads in fastq, qseq or fasta format" />
+          <param name="min_ins_distance" type="integer" value="-1" label=" Minimum insert size for valid paired-end alignments" />
+          <param name="max_ins_distance" type="integer" value="400" label="Maximum insert size for valid paired-end alignments" />
+        </when>
+     </conditional> 
+     <param name="tag" type="select" label="Type of libraries">
+        <option value="N">directional libraries</option>
+        <option value="Y">undirectional libraries</option>
+     </param>
+     <conditional name="choosealigner">
+         <param name="aligner" type="select" label="Short reads aligner">
+             <option value="bowtie">bowtie</option>
+             <option value="bowtie2">bowtie2</option>
+         </param>
+         <when value="bowtie">
+             <conditional name="rrbsFragments">
+                 <param name="Fragmented" type="select" label="RRBS-seq reads" help="">
+                     <option value="No">No</option>
+                     <option value="Yes">Yes</option>
+                 </param>
+                 <when value="Yes">
+                     <param name="lowerBound" type="integer" value="40" label="The lower bound for RRBS fragments" help="Default: 40" />
+                     <param name="upperBound" type="integer" value="500" label="The upper bound for RRBS fragments" help="Default: 500" />
+                     <conditional name="refGenomeSource">
+                         <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="">
+                             <option value="indexed">Use a built-in index</option>
+                             <option value="history">Use one from the history</option>
+                         </param>
+                         <when value="indexed">
+                             <param name="index" type="select" label="Select a reference genome (RRBS, bowtie)">
+                                 <options from_data_table="bs_seeker2_indexes_RRBS_bowtie">
+                                     <filter type="sort_by" column="2"/>
+                                     <validator type="no_options" message="No indexes are available for the selected input dataset"/>
+                                 </options>
+                             </param>
+                         </when>
+                         <when value="history">
+                             <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" />
+                         </when>
+                     </conditional>
+                 </when>
+                 <when value="No">
+                     <conditional name="refGenomeSource">
+                         <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="">
+                             <option value="indexed">Use a built-in index</option>
+                             <option value="history">Use one from the history</option>
+                         </param>
+                         <when value="indexed">
+                             <param name="index" type="select" label="Select a reference genome (WGBS, bowtie)">
+                                 <options from_data_table="bs_seeker2_indexes_WGBS_bowtie">
+                                     <filter type="sort_by" column="2"/>
+                                     <validator type="no_options" message="No indexes are available for the selected input dataset"/>
+                                 </options>
+                             </param>
+                         </when>
+                         <when value="history">
+                             <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" />
+                         </when>
+                     </conditional>
+                 </when>
+             </conditional>
+         </when>
+
+         <when value="bowtie2">
+             <conditional name="rrbsFragments">
+                 <param name="Fragmented" type="select" label="RRBS-seq reads" help="">
+                     <option value="No">No</option>
+                     <option value="Yes">Yes</option>
+                 </param>
+                 <when value="Yes">
+                     <param name="lowerBound" type="integer" value="40" label="The lower bound for RRBS fragments" help="Default: 40" />
+                     <param name="upperBound" type="integer" value="500" label="The upper bound for RRBS fragments" help="Default: 500" />
+                     <conditional name="refGenomeSource">
+                         <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="">
+                             <option value="indexed">Use a built-in index</option>
+                             <option value="history">Use one from the history</option>
+                         </param>
+                         <when value="indexed">
+                             <param name="index" type="select" label="Select a reference genome (RRBS, bowtie2)">
+                                 <options from_data_table="bs_seeker2_indexes_RRBS_bowtie2">
+                                     <filter type="sort_by" column="2"/>
+                                     <validator type="no_options" message="No indexes are available for the selected input dataset"/>
+                                 </options>
+                             </param>
+                         </when>
+                         <when value="history">
+                             <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" />
+                         </when>
+                     </conditional>
+                 </when>
+                 <when value="No">
+                     <conditional name="refGenomeSource">
+                         <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="">
+                             <option value="indexed">Use a built-in index</option>
+                             <option value="history">Use one from the history</option>
+                         </param>
+                         <when value="indexed">
+                             <param name="index" type="select" label="Select a reference genome (WGBS, bowtie2)">
+                                 <options from_data_table="bs_seeker2_indexes_WGBS_bowtie2">
+                                     <filter type="sort_by" column="2"/>
+                                     <validator type="no_options" message="No indexes are available for the selected input dataset"/>
+                                 </options>
+                             </param>
+                         </when>
+                         <when value="history">
+                             <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" />
+                         </when>
+                     </conditional>
+                 </when>
+             </conditional>
+
+
+             <conditional name="mode_type">
+                 <param name="mode" type="select" label="Select the mode of Bowtie2">
+                     <option value="local" selected="true"> local alignment </option>
+                     <option value="end_to_end" > end-to-end alignment </option>
+                 </param>
+             </conditional>
+         </when>
+     </conditional>
+     <conditional name="adapterInfo">
+        <param name="useAdapter" type="select" label="adapter sequence">
+           <option value="noAdapter">No</option>
+           <option value="withAdapter">Yes</option>
+        </param>
+        <when value="withAdapter">
+           <param format="txt" name="adapter_file" type="data" label="Input file of your adaptor sequences" help="Input text file of your adaptor sequences" />
+        </when>
+     </conditional>
+
+     <conditional name="sParams">
+       <param name="sSettingsType" type="select" label="BS Seeker2 settings to use" help="You can use the default settings or set customer values for the BS Seeker2 parameters.">
+         <option value="preSet">User Defaults</option>
+         <option value="full">Full parameter list</option>
+       </param>
+       <when value="preSet" /> 
+       <when value="full">
+           <param name="start_base" type="integer" value="1" label="The start base of the read to be mapped" help="" />
+           <param name="end_base" type="integer" value="200" label="The end base of the read to be mapped" help="" />
+
+           <param name="num_mismatch" type="integer" value="4" label="Number of mismatches" help="(INT) Default: 4" />
+       </when>   
+     </conditional>
+
+</inputs>
+
+  <outputs>
+    <data format="bam" name="align_output"  label="BAM Alignments"> </data>
+    <data format="wig" name="call_methylation_wig"  label="Methylation Levels"> </data>
+    <data format="tabular" name="call_methylation_CGmap"  label="CGmap file"> </data>
+    <data format="tabular" name="call_methylation_ATCGmap"  label="ATCGmap file"> </data>
+
+  </outputs>
+  <help>
+**What it does**
+
+BS-Seeker2 is a seamlessly pipeline for mapping bisulfite sequencing data and generating detailed DNA methylome. BS-Seeker2 improves mappability by using local alignment, and is tailored for RRBS library by building special index, with higher efficiency and accuracy. This is the Galaxy version of BS-Seeker2.
+
+------
+
+**Resources**
+
+The homepage for BS-Seeker2 is http://pellegrini.mcdb.ucla.edu/BS_Seeker2/.
+
+For more information of BS-Seeker2, please refer to https://github.com/BSSeeker/BSseeker2.
+
+------
+
+**Example**
+
+- Adapter file::
+
+      AGATCGGAAGAGCACACGTC
+
+
+  </help>
+</tool>