Mercurial > repos > xilinxu > xilinxu
comparison fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastq_to_fasta.xml @ 3:997f5136985f draft default tip
Uploaded
author | xilinxu |
---|---|
date | Thu, 14 Aug 2014 04:52:17 -0400 |
parents | |
children |
comparison
equal
deleted
inserted
replaced
2:dfe9332138cf | 3:997f5136985f |
---|---|
1 <tool id="cshl_fastq_to_fasta" name="FASTQ to FASTA"> | |
2 <description>converter</description> | |
3 <command>gunzip -cf $input | fastq_to_fasta $SKIPN $RENAMESEQ -o $output -v </command> | |
4 | |
5 <inputs> | |
6 <param format="fastqsolexa" name="input" type="data" label="FASTQ Library to convert" /> | |
7 | |
8 <param name="SKIPN" type="select" label="Discard sequences with unknown (N) bases "> | |
9 <option value="">yes</option> | |
10 <option value="-n">no</option> | |
11 </param> | |
12 | |
13 <param name="RENAMESEQ" type="select" label="Rename sequence names in output file (reduces file size)"> | |
14 <option value="-r">yes</option> | |
15 <option value="">no</option> | |
16 </param> | |
17 | |
18 </inputs> | |
19 | |
20 <tests> | |
21 <test> | |
22 <!-- FASTQ-To-FASTA, keep N, don't rename --> | |
23 <param name="input" value="fastq_to_fasta1.fastq" /> | |
24 <param name="SKIPN" value=""/> | |
25 <param name="RENAMESEQ" value=""/> | |
26 <output name="output" file="fastq_to_fasta1a.out" /> | |
27 </test> | |
28 <test> | |
29 <!-- FASTQ-To-FASTA, discard N, rename --> | |
30 <param name="input" value="fastq_to_fasta1.fastq" /> | |
31 <param name="SKIPN" value="no"/> | |
32 <param name="RENAMESEQ" value="yes"/> | |
33 <output name="output" file="fastq_to_fasta1b.out" /> | |
34 </test> | |
35 </tests> | |
36 | |
37 <outputs> | |
38 <data format="fasta" name="output" metadata_source="input" /> | |
39 </outputs> | |
40 | |
41 <help> | |
42 | |
43 **What it does** | |
44 | |
45 This tool converts data from Solexa format to FASTA format (scroll down for format description). | |
46 | |
47 -------- | |
48 | |
49 **Example** | |
50 | |
51 The following data in Solexa-FASTQ format:: | |
52 | |
53 @CSHL_4_FC042GAMMII_2_1_517_596 | |
54 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT | |
55 +CSHL_4_FC042GAMMII_2_1_517_596 | |
56 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 | |
57 | |
58 Will be converted to FASTA (with 'rename sequence names' = NO):: | |
59 | |
60 >CSHL_4_FC042GAMMII_2_1_517_596 | |
61 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT | |
62 | |
63 Will be converted to FASTA (with 'rename sequence names' = YES):: | |
64 | |
65 >1 | |
66 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT | |
67 | |
68 </help> | |
69 </tool> | |
70 <!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> |