--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/scripts/fastx_barcode_splitter.pl	Thu Aug 14 04:52:17 2014 -0400
@@ -0,0 +1,472 @@
+#!/usr/bin/perl
+
+#    FASTX-toolkit - FASTA/FASTQ preprocessing tools.
+#    Copyright (C) 2009  A. Gordon (gordon@cshl.edu)
+#
+#   This program is free software: you can redistribute it and/or modify
+#   it under the terms of the GNU Affero General Public License as
+#   published by the Free Software Foundation, either version 3 of the
+#   License, or (at your option) any later version.
+#
+#   This program is distributed in the hope that it will be useful,
+#   but WITHOUT ANY WARRANTY; without even the implied warranty of
+#   MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+#   GNU Affero General Public License for more details.
+#
+#    You should have received a copy of the GNU Affero General Public License
+#    along with this program.  If not, see <http://www.gnu.org/licenses/>.
+
+use strict;
+use warnings;
+use IO::Handle;
+use Data::Dumper;
+use Getopt::Long;
+use Carp;
+
+##
+## This program splits a FASTQ/FASTA file into several smaller files,
+## Based on barcode matching.
+##
+## run with "--help" for usage information
+##
+## Assaf Gordon <gordon@cshl.edu> , 11sep2008
+
+# Forward declarations
+sub load_barcode_file ($);
+sub parse_command_line ;
+sub match_sequences ;
+sub mismatch_count($$) ;
+sub print_results;
+sub open_and_detect_input_format;
+sub read_record;
+sub write_record($);
+sub usage();
+
+# Global flags and arguments, 
+# Set by command line argumens
+my $barcode_file ;
+my $barcodes_at_eol = 0 ;
+my $barcodes_at_bol = 0 ;
+my $exact_match = 0 ;
+my $allow_partial_overlap = 0;
+my $allowed_mismatches = 1;
+my $newfile_suffix = '';
+my $newfile_prefix  ;
+my $quiet = 0 ;
+my $debug = 0 ;
+my $fastq_format = 1;
+
+# Global variables 
+# Populated by 'create_output_files'
+my %filenames;
+my %files;
+my %counts = ( 'unmatched' => 0 );
+my $barcodes_length;
+my @barcodes;
+my $input_file_io;
+
+
+# The Four lines per record in FASTQ format.
+# (when using FASTA format, only the first two are used)
+my $seq_name;
+my $seq_bases;
+my $seq_name2;
+my $seq_qualities;
+
+
+#
+# Start of Program
+#
+parse_command_line ;
+
+load_barcode_file ( $barcode_file ) ;
+
+open_and_detect_input_format;
+
+match_sequences ;
+
+print_results unless $quiet;
+
+#
+# End of program
+#
+
+
+
+
+
+
+
+
+sub parse_command_line {
+	my $help;
+
+	usage() if (scalar @ARGV==0);
+
+	my $result = GetOptions ( "bcfile=s" => \$barcode_file,
+				  "eol"  => \$barcodes_at_eol,
+				  "bol"  => \$barcodes_at_bol,
+				  "exact" => \$exact_match,
+				  "prefix=s" => \$newfile_prefix,
+				  "suffix=s" => \$newfile_suffix,
+				  "quiet" => \$quiet, 
+				  "partial=i" => \$allow_partial_overlap,
+				  "debug" => \$debug,
+				  "mismatches=i" => \$allowed_mismatches,
+				  "help" => \$help
+				  ) ;
+	
+	usage() if ($help);
+
+	die "Error: barcode file not specified (use '--bcfile [FILENAME]')\n" unless defined $barcode_file;
+	die "Error: prefix path/filename not specified (use '--prefix [PATH]')\n" unless defined $newfile_prefix;
+
+	if ($barcodes_at_bol == $barcodes_at_eol) {
+		die "Error: can't specify both --eol & --bol\n" if $barcodes_at_eol;
+		die "Error: must specify either --eol or --bol\n" ;
+	}
+
+	die "Error: invalid for value partial matches (valid values are 0 or greater)\n" if $allow_partial_overlap<0;
+
+	$allowed_mismatches = 0 if $exact_match;
+
+	die "Error: invalid value for mismatches (valid values are 0 or more)\n" if ($allowed_mismatches<0);
+
+	die "Error: partial overlap value ($allow_partial_overlap) bigger than " . 
+		"max. allowed mismatches ($allowed_mismatches)\n" if ($allow_partial_overlap > $allowed_mismatches);
+
+
+	exit unless $result;
+}
+
+
+
+#
+# Read the barcode file
+#
+sub load_barcode_file ($) {
+	my $filename = shift or croak "Missing barcode file name";
+
+	open BCFILE,"<$filename" or die "Error: failed to open barcode file ($filename)\n";
+	while (<BCFILE>) {
+		next if m/^#/;
+		chomp;
+		my ($ident, $barcode) = split ;
+
+		$barcode = uc($barcode);
+
+		# Sanity checks on the barcodes
+		die "Error: bad data at barcode file ($filename) line $.\n" unless defined $barcode;
+		die "Error: bad barcode value ($barcode) at barcode file ($filename) line $.\n"
+			unless $barcode =~ m/^[AGCT]+$/;
+
+		die "Error: bad identifier value ($ident) at barcode file ($filename) line $. (must be alphanumeric)\n" 
+			unless $ident =~ m/^\w+$/;
+
+		die "Error: badcode($ident, $barcode) is shorter or equal to maximum number of " .
+		    "mismatches ($allowed_mismatches). This makes no sense. Specify fewer  mismatches.\n" 
+		    	if length($barcode)<=$allowed_mismatches;
+
+		$barcodes_length = length($barcode) unless defined $barcodes_length;
+		die "Error: found barcodes in different lengths. this feature is not supported yet.\n" 
+			unless $barcodes_length == length($barcode);
+
+	 	push @barcodes, [$ident, $barcode];
+
+		if ($allow_partial_overlap>0) {
+			foreach my $i (1 .. $allow_partial_overlap) {
+				substr $barcode, ($barcodes_at_bol)?0:-1, 1, '';
+	 			push @barcodes, [$ident, $barcode];
+			}
+		}
+	}
+	close BCFILE;
+
+	if ($debug) {
+		print STDERR "barcode\tsequence\n";
+		foreach my $barcoderef (@barcodes) {
+			my ($ident, $seq) = @{$barcoderef};
+			print STDERR $ident,"\t", $seq ,"\n";
+		}
+	}
+}
+
+# Create one output file for each barcode.
+# (Also create a file for the dummy 'unmatched' barcode)
+sub create_output_files {
+	my %barcodes = map { $_->[0] => 1 } @barcodes; #generate a uniq list of barcode identifiers;
+	$barcodes{'unmatched'} = 1 ;
+
+	foreach my $ident (keys %barcodes) {
+		my $new_filename = $newfile_prefix . $ident . $newfile_suffix; 
+		$filenames{$ident} = $new_filename;
+		open my $file, ">$new_filename" or die "Error: failed to create output file ($new_filename)\n"; 
+		$files{$ident} = $file ;
+	}
+}
+
+sub match_sequences {
+
+	my %barcodes = map { $_->[0] => 1 } @barcodes; #generate a uniq list of barcode identifiers;
+	$barcodes{'unmatched'} = 1 ;
+
+	#reset counters
+	foreach my $ident ( keys %barcodes ) {
+		$counts{$ident} = 0;
+	}
+
+	create_output_files;
+
+	# Read file FASTQ file
+	# split accotding to barcodes
+	while ( read_record ) {
+		chomp $seq_bases;
+
+		print STDERR "sequence $seq_bases: \n" if $debug;
+
+		my $best_barcode_mismatches_count = $barcodes_length;
+		my $best_barcode_ident = undef;
+
+		#Try all barcodes, find the one with the lowest mismatch count
+		foreach my $barcoderef (@barcodes) {
+			my ($ident, $barcode) = @{$barcoderef};
+
+			# Get DNA fragment (in the length of the barcodes)
+			# The barcode will be tested only against this fragment
+			# (no point in testing the barcode against the whole sequence)
+			my $sequence_fragment;
+			if ($barcodes_at_bol) {
+				$sequence_fragment = substr $seq_bases, 0, $barcodes_length;
+			} else {
+				$sequence_fragment = substr $seq_bases, - $barcodes_length;
+			}
+
+			my $mm = mismatch_count($sequence_fragment, $barcode) ; 
+
+			# if this is a partial match, add the non-overlap as a mismatch
+			# (partial barcodes are shorter than the length of the original barcodes)
+			$mm += ($barcodes_length - length($barcode)); 
+
+			if ( $mm < $best_barcode_mismatches_count ) {
+				$best_barcode_mismatches_count = $mm ;
+				$best_barcode_ident = $ident ;
+			}
+		}
+
+		$best_barcode_ident = 'unmatched' 
+			if ( (!defined $best_barcode_ident) || $best_barcode_mismatches_count>$allowed_mismatches) ;
+
+		print STDERR "sequence $seq_bases matched barcode: $best_barcode_ident\n" if $debug;
+
+		$counts{$best_barcode_ident}++;
+
+		#get the file associated with the matched barcode.
+		#(note: there's also a file associated with 'unmatched' barcode)
+		my $file = $files{$best_barcode_ident};
+
+		write_record($file);
+	}
+}
+
+#Quickly calculate hamming distance between two strings
+#
+#NOTE: Strings must be same length.
+#      returns number of different characters.
+#see  http://www.perlmonks.org/?node_id=500235
+sub mismatch_count($$) { length( $_[ 0 ] ) - ( ( $_[ 0 ] ^ $_[ 1 ] ) =~ tr[\0][\0] ) }
+
+
+
+sub print_results
+{
+	print "Barcode\tCount\tLocation\n";
+	my $total = 0 ;
+	foreach my $ident (sort keys %counts) {
+		print $ident, "\t", $counts{$ident},"\t",$filenames{$ident},"\n";
+		$total += $counts{$ident};
+	}
+	print "total\t",$total,"\n";
+}
+
+
+sub read_record
+{
+	$seq_name = $input_file_io->getline();
+
+	return undef unless defined $seq_name; # End of file?
+
+	$seq_bases = $input_file_io->getline();
+	die "Error: bad input file, expecting line with sequences\n" unless defined $seq_bases;
+
+	# If using FASTQ format, read two more lines
+	if ($fastq_format) {
+		$seq_name2  = $input_file_io->getline();
+		die "Error: bad input file, expecting line with sequence name2\n" unless defined $seq_name2;
+
+		$seq_qualities = $input_file_io->getline();
+		die "Error: bad input file, expecting line with quality scores\n" unless defined $seq_qualities;
+	}
+	return 1;
+}
+
+sub write_record($)
+{
+	my $file = shift;
+
+	croak "Bad file handle" unless defined $file;
+
+	print $file $seq_name;
+	print $file $seq_bases,"\n";
+
+	#if using FASTQ format, write two more lines
+	if ($fastq_format) {
+		print $file $seq_name2;
+		print $file $seq_qualities;
+	}
+}
+
+sub open_and_detect_input_format
+{
+	$input_file_io  = new IO::Handle;
+	die "Failed to open STDIN " unless $input_file_io->fdopen(fileno(STDIN),"r");
+
+	# Get the first characeter, and push it back
+	my $first_char = $input_file_io->getc();
+	$input_file_io->ungetc(ord $first_char);
+
+	if ($first_char eq '>') {
+		# FASTA format
+		$fastq_format = 0 ;
+		print STDERR "Detected FASTA format\n" if $debug;
+	} elsif ($first_char eq '@') {
+		# FASTQ format
+		$fastq_format = 1;
+		print STDERR "Detected FASTQ format\n" if $debug;
+	} else {
+		die "Error: unknown file format. First character = '$first_char' (expecting > or \@)\n";
+	}
+}
+
+sub usage()
+{
+print<<EOF;
+Barcode Splitter, by Assaf Gordon (gordon\@cshl.edu), 11sep2008
+
+This program reads FASTA/FASTQ file and splits it into several smaller files,
+Based on barcode matching.
+FASTA/FASTQ data is read from STDIN (format is auto-detected.)
+Output files will be writen to disk.
+Summary will be printed to STDOUT.
+
+usage: $0 --bcfile FILE --prefix PREFIX [--suffix SUFFIX] [--bol|--eol] 
+         [--mismatches N] [--exact] [--partial N] [--help] [--quiet] [--debug]
+
+Arguments:
+
+--bcfile FILE	- Barcodes file name. (see explanation below.)
+--prefix PREFIX	- File prefix. will be added to the output files. Can be used
+		  to specify output directories.
+--suffix SUFFIX	- File suffix (optional). Can be used to specify file
+		  extensions.
+--bol		- Try to match barcodes at the BEGINNING of sequences.
+		  (What biologists would call the 5' end, and programmers
+		  would call index 0.)
+--eol		- Try to match barcodes at the END of sequences.
+		  (What biologists would call the 3' end, and programmers
+		  would call the end of the string.)
+		  NOTE: one of --bol, --eol must be specified, but not both.
+--mismatches N	- Max. number of mismatches allowed. default is 1.
+--exact		- Same as '--mismatches 0'. If both --exact and --mismatches 
+		  are specified, '--exact' takes precedence.
+--partial N	- Allow partial overlap of barcodes. (see explanation below.)
+		  (Default is not partial matching)
+--quiet		- Don't print counts and summary at the end of the run.
+		  (Default is to print.)
+--debug		- Print lots of useless debug information to STDERR.
+--help		- This helpful help screen.
+
+Example (Assuming 's_2_100.txt' is a FASTQ file, 'mybarcodes.txt' is 
+the barcodes file):
+
+   \$ cat s_2_100.txt | $0 --bcfile mybarcodes.txt --bol --mismatches 2 \\
+   	--prefix /tmp/bla_ --suffix ".txt"
+
+Barcode file format
+-------------------
+Barcode files are simple text files. Each line should contain an identifier 
+(descriptive name for the barcode), and the barcode itself (A/C/G/T), 
+separated by a TAB character. Example:
+
+    #This line is a comment (starts with a 'number' sign)
+    BC1 GATCT
+    BC2 ATCGT
+    BC3 GTGAT
+    BC4 TGTCT
+
+For each barcode, a new FASTQ file will be created (with the barcode's 
+identifier as part of the file name). Sequences matching the barcode 
+will be stored in the appropriate file.
+
+Running the above example (assuming "mybarcodes.txt" contains the above 
+barcodes), will create the following files:
+	/tmp/bla_BC1.txt
+	/tmp/bla_BC2.txt
+	/tmp/bla_BC3.txt
+	/tmp/bla_BC4.txt
+	/tmp/bla_unmatched.txt
+The 'unmatched' file will contain all sequences that didn't match any barcode.
+
+Barcode matching
+----------------
+
+** Without partial matching:
+
+Count mismatches between the FASTA/Q sequences and the barcodes.
+The barcode which matched with the lowest mismatches count (providing the
+count is small or equal to '--mismatches N') 'gets' the sequences.
+
+Example (using the above barcodes):
+Input Sequence:
+    GATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG
+
+Matching with '--bol --mismatches 1':
+   GATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG
+   GATCT (1 mismatch, BC1)
+   ATCGT (4 mismatches, BC2)
+   GTGAT (3 mismatches, BC3)
+   TGTCT (3 mismatches, BC4)
+
+This sequence will be classified as 'BC1' (it has the lowest mismatch count).
+If '--exact' or '--mismatches 0' were specified, this sequence would be 
+classified as 'unmatched' (because, although BC1 had the lowest mismatch count,
+it is above the maximum allowed mismatches).
+
+Matching with '--eol' (end of line) does the same, but from the other side
+of the sequence.
+
+** With partial matching (very similar to indels):
+
+Same as above, with the following addition: barcodes are also checked for
+partial overlap (number of allowed non-overlapping bases is '--partial N').
+
+Example:
+Input sequence is ATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG
+(Same as above, but note the missing 'G' at the beginning.)
+
+Matching (without partial overlapping) against BC1 yields 4 mismatches:
+   ATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG
+   GATCT (4 mismatches)
+
+Partial overlapping would also try the following match:
+   -ATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG
+   GATCT (1 mismatch)
+
+Note: scoring counts a missing base as a mismatch, so the final
+mismatch count is 2 (1 'real' mismatch, 1 'missing base' mismatch).
+If running with '--mismatches 2' (meaning allowing upto 2 mismatches) - this 
+seqeunce will be classified as BC1.
+
+EOF
+
+exit 1;
+}