# HG changeset patch # User xilinxu # Date 1408006337 14400 # Node ID 997f5136985ffd0dc4f3ac22c272a79907138ac4 # Parent dfe9332138cfd3a79485ae5513f6a002df266099 Uploaded diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/AUTHORS --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/AUTHORS Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,4 @@ +Authors of FASTX toolkit. +See also the files THANKS and ChangeLog. + +Assaf Gordon designed and implemented FASTX toolkit. diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/COPYING --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/COPYING Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,661 @@ + GNU AFFERO GENERAL PUBLIC LICENSE + Version 3, 19 November 2007 + + Copyright (C) 2007 Free Software Foundation, Inc. + Everyone is permitted to copy and distribute verbatim copies + of this license document, but changing it is not allowed. + + Preamble + + The GNU Affero General Public License is a free, copyleft license for +software and other kinds of works, specifically designed to ensure +cooperation with the community in the case of network server software. + + The licenses for most software and other practical works are designed +to take away your freedom to share and change the works. By contrast, +our General Public Licenses are intended to guarantee your freedom to +share and change all versions of a program--to make sure it remains free +software for all its users. + + When we speak of free software, we are referring to freedom, not +price. Our General Public Licenses are designed to make sure that you +have the freedom to distribute copies of free software (and charge for +them if you wish), that you receive source code or can get it if you +want it, that you can change the software or use pieces of it in new +free programs, and that you know you can do these things. + + Developers that use our General Public Licenses protect your rights +with two steps: (1) assert copyright on the software, and (2) offer +you this License which gives you legal permission to copy, distribute +and/or modify the software. + + A secondary benefit of defending all users' freedom is that +improvements made in alternate versions of the program, if they +receive widespread use, become available for other developers to +incorporate. Many developers of free software are heartened and +encouraged by the resulting cooperation. However, in the case of +software used on network servers, this result may fail to come about. +The GNU General Public License permits making a modified version and +letting the public access it on a server without ever releasing its +source code to the public. + + The GNU Affero General Public License is designed specifically to +ensure that, in such cases, the modified source code becomes available +to the community. It requires the operator of a network server to +provide the source code of the modified version running there to the +users of that server. Therefore, public use of a modified version, on +a publicly accessible server, gives the public access to the source +code of the modified version. + + An older license, called the Affero General Public License and +published by Affero, was designed to accomplish similar goals. This is +a different license, not a version of the Affero GPL, but Affero has +released a new version of the Affero GPL which permits relicensing under +this license. + + The precise terms and conditions for copying, distribution and +modification follow. + + TERMS AND CONDITIONS + + 0. Definitions. + + "This License" refers to version 3 of the GNU Affero General Public License. + + "Copyright" also means copyright-like laws that apply to other kinds of +works, such as semiconductor masks. + + "The Program" refers to any copyrightable work licensed under this +License. Each licensee is addressed as "you". "Licensees" and +"recipients" may be individuals or organizations. + + To "modify" a work means to copy from or adapt all or part of the work +in a fashion requiring copyright permission, other than the making of an +exact copy. The resulting work is called a "modified version" of the +earlier work or a work "based on" the earlier work. + + A "covered work" means either the unmodified Program or a work based +on the Program. + + To "propagate" a work means to do anything with it that, without +permission, would make you directly or secondarily liable for +infringement under applicable copyright law, except executing it on a +computer or modifying a private copy. Propagation includes copying, +distribution (with or without modification), making available to the +public, and in some countries other activities as well. + + To "convey" a work means any kind of propagation that enables other +parties to make or receive copies. Mere interaction with a user through +a computer network, with no transfer of a copy, is not conveying. + + An interactive user interface displays "Appropriate Legal Notices" +to the extent that it includes a convenient and prominently visible +feature that (1) displays an appropriate copyright notice, and (2) +tells the user that there is no warranty for the work (except to the +extent that warranties are provided), that licensees may convey the +work under this License, and how to view a copy of this License. If +the interface presents a list of user commands or options, such as a +menu, a prominent item in the list meets this criterion. + + 1. Source Code. + + The "source code" for a work means the preferred form of the work +for making modifications to it. "Object code" means any non-source +form of a work. + + A "Standard Interface" means an interface that either is an official +standard defined by a recognized standards body, or, in the case of +interfaces specified for a particular programming language, one that +is widely used among developers working in that language. + + The "System Libraries" of an executable work include anything, other +than the work as a whole, that (a) is included in the normal form of +packaging a Major Component, but which is not part of that Major +Component, and (b) serves only to enable use of the work with that +Major Component, or to implement a Standard Interface for which an +implementation is available to the public in source code form. A +"Major Component", in this context, means a major essential component +(kernel, window system, and so on) of the specific operating system +(if any) on which the executable work runs, or a compiler used to +produce the work, or an object code interpreter used to run it. + + The "Corresponding Source" for a work in object code form means all +the source code needed to generate, install, and (for an executable +work) run the object code and to modify the work, including scripts to +control those activities. However, it does not include the work's +System Libraries, or general-purpose tools or generally available free +programs which are used unmodified in performing those activities but +which are not part of the work. For example, Corresponding Source +includes interface definition files associated with source files for +the work, and the source code for shared libraries and dynamically +linked subprograms that the work is specifically designed to require, +such as by intimate data communication or control flow between those +subprograms and other parts of the work. + + The Corresponding Source need not include anything that users +can regenerate automatically from other parts of the Corresponding +Source. + + The Corresponding Source for a work in source code form is that +same work. + + 2. Basic Permissions. + + All rights granted under this License are granted for the term of +copyright on the Program, and are irrevocable provided the stated +conditions are met. This License explicitly affirms your unlimited +permission to run the unmodified Program. The output from running a +covered work is covered by this License only if the output, given its +content, constitutes a covered work. This License acknowledges your +rights of fair use or other equivalent, as provided by copyright law. + + You may make, run and propagate covered works that you do not +convey, without conditions so long as your license otherwise remains +in force. You may convey covered works to others for the sole purpose +of having them make modifications exclusively for you, or provide you +with facilities for running those works, provided that you comply with +the terms of this License in conveying all material for which you do +not control copyright. Those thus making or running the covered works +for you must do so exclusively on your behalf, under your direction +and control, on terms that prohibit them from making any copies of +your copyrighted material outside their relationship with you. + + Conveying under any other circumstances is permitted solely under +the conditions stated below. Sublicensing is not allowed; section 10 +makes it unnecessary. + + 3. Protecting Users' Legal Rights From Anti-Circumvention Law. + + No covered work shall be deemed part of an effective technological +measure under any applicable law fulfilling obligations under article +11 of the WIPO copyright treaty adopted on 20 December 1996, or +similar laws prohibiting or restricting circumvention of such +measures. + + When you convey a covered work, you waive any legal power to forbid +circumvention of technological measures to the extent such circumvention +is effected by exercising rights under this License with respect to +the covered work, and you disclaim any intention to limit operation or +modification of the work as a means of enforcing, against the work's +users, your or third parties' legal rights to forbid circumvention of +technological measures. + + 4. Conveying Verbatim Copies. + + You may convey verbatim copies of the Program's source code as you +receive it, in any medium, provided that you conspicuously and +appropriately publish on each copy an appropriate copyright notice; +keep intact all notices stating that this License and any +non-permissive terms added in accord with section 7 apply to the code; +keep intact all notices of the absence of any warranty; and give all +recipients a copy of this License along with the Program. + + You may charge any price or no price for each copy that you convey, +and you may offer support or warranty protection for a fee. + + 5. Conveying Modified Source Versions. + + You may convey a work based on the Program, or the modifications to +produce it from the Program, in the form of source code under the +terms of section 4, provided that you also meet all of these conditions: + + a) The work must carry prominent notices stating that you modified + it, and giving a relevant date. + + b) The work must carry prominent notices stating that it is + released under this License and any conditions added under section + 7. This requirement modifies the requirement in section 4 to + "keep intact all notices". + + c) You must license the entire work, as a whole, under this + License to anyone who comes into possession of a copy. This + License will therefore apply, along with any applicable section 7 + additional terms, to the whole of the work, and all its parts, + regardless of how they are packaged. This License gives no + permission to license the work in any other way, but it does not + invalidate such permission if you have separately received it. + + d) If the work has interactive user interfaces, each must display + Appropriate Legal Notices; however, if the Program has interactive + interfaces that do not display Appropriate Legal Notices, your + work need not make them do so. + + A compilation of a covered work with other separate and independent +works, which are not by their nature extensions of the covered work, +and which are not combined with it such as to form a larger program, +in or on a volume of a storage or distribution medium, is called an +"aggregate" if the compilation and its resulting copyright are not +used to limit the access or legal rights of the compilation's users +beyond what the individual works permit. Inclusion of a covered work +in an aggregate does not cause this License to apply to the other +parts of the aggregate. + + 6. Conveying Non-Source Forms. + + You may convey a covered work in object code form under the terms +of sections 4 and 5, provided that you also convey the +machine-readable Corresponding Source under the terms of this License, +in one of these ways: + + a) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by the + Corresponding Source fixed on a durable physical medium + customarily used for software interchange. + + b) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by a + written offer, valid for at least three years and valid for as + long as you offer spare parts or customer support for that product + model, to give anyone who possesses the object code either (1) a + copy of the Corresponding Source for all the software in the + product that is covered by this License, on a durable physical + medium customarily used for software interchange, for a price no + more than your reasonable cost of physically performing this + conveying of source, or (2) access to copy the + Corresponding Source from a network server at no charge. + + c) Convey individual copies of the object code with a copy of the + written offer to provide the Corresponding Source. This + alternative is allowed only occasionally and noncommercially, and + only if you received the object code with such an offer, in accord + with subsection 6b. + + d) Convey the object code by offering access from a designated + place (gratis or for a charge), and offer equivalent access to the + Corresponding Source in the same way through the same place at no + further charge. You need not require recipients to copy the + Corresponding Source along with the object code. If the place to + copy the object code is a network server, the Corresponding Source + may be on a different server (operated by you or a third party) + that supports equivalent copying facilities, provided you maintain + clear directions next to the object code saying where to find the + Corresponding Source. Regardless of what server hosts the + Corresponding Source, you remain obligated to ensure that it is + available for as long as needed to satisfy these requirements. + + e) Convey the object code using peer-to-peer transmission, provided + you inform other peers where the object code and Corresponding + Source of the work are being offered to the general public at no + charge under subsection 6d. + + A separable portion of the object code, whose source code is excluded +from the Corresponding Source as a System Library, need not be +included in conveying the object code work. + + A "User Product" is either (1) a "consumer product", which means any +tangible personal property which is normally used for personal, family, +or household purposes, or (2) anything designed or sold for incorporation +into a dwelling. In determining whether a product is a consumer product, +doubtful cases shall be resolved in favor of coverage. For a particular +product received by a particular user, "normally used" refers to a +typical or common use of that class of product, regardless of the status +of the particular user or of the way in which the particular user +actually uses, or expects or is expected to use, the product. A product +is a consumer product regardless of whether the product has substantial +commercial, industrial or non-consumer uses, unless such uses represent +the only significant mode of use of the product. + + "Installation Information" for a User Product means any methods, +procedures, authorization keys, or other information required to install +and execute modified versions of a covered work in that User Product from +a modified version of its Corresponding Source. The information must +suffice to ensure that the continued functioning of the modified object +code is in no case prevented or interfered with solely because +modification has been made. + + If you convey an object code work under this section in, or with, or +specifically for use in, a User Product, and the conveying occurs as +part of a transaction in which the right of possession and use of the +User Product is transferred to the recipient in perpetuity or for a +fixed term (regardless of how the transaction is characterized), the +Corresponding Source conveyed under this section must be accompanied +by the Installation Information. But this requirement does not apply +if neither you nor any third party retains the ability to install +modified object code on the User Product (for example, the work has +been installed in ROM). + + The requirement to provide Installation Information does not include a +requirement to continue to provide support service, warranty, or updates +for a work that has been modified or installed by the recipient, or for +the User Product in which it has been modified or installed. Access to a +network may be denied when the modification itself materially and +adversely affects the operation of the network or violates the rules and +protocols for communication across the network. + + Corresponding Source conveyed, and Installation Information provided, +in accord with this section must be in a format that is publicly +documented (and with an implementation available to the public in +source code form), and must require no special password or key for +unpacking, reading or copying. + + 7. Additional Terms. + + "Additional permissions" are terms that supplement the terms of this +License by making exceptions from one or more of its conditions. +Additional permissions that are applicable to the entire Program shall +be treated as though they were included in this License, to the extent +that they are valid under applicable law. If additional permissions +apply only to part of the Program, that part may be used separately +under those permissions, but the entire Program remains governed by +this License without regard to the additional permissions. + + When you convey a copy of a covered work, you may at your option +remove any additional permissions from that copy, or from any part of +it. (Additional permissions may be written to require their own +removal in certain cases when you modify the work.) You may place +additional permissions on material, added by you to a covered work, +for which you have or can give appropriate copyright permission. + + Notwithstanding any other provision of this License, for material you +add to a covered work, you may (if authorized by the copyright holders of +that material) supplement the terms of this License with terms: + + a) Disclaiming warranty or limiting liability differently from the + terms of sections 15 and 16 of this License; or + + b) Requiring preservation of specified reasonable legal notices or + author attributions in that material or in the Appropriate Legal + Notices displayed by works containing it; or + + c) Prohibiting misrepresentation of the origin of that material, or + requiring that modified versions of such material be marked in + reasonable ways as different from the original version; or + + d) Limiting the use for publicity purposes of names of licensors or + authors of the material; or + + e) Declining to grant rights under trademark law for use of some + trade names, trademarks, or service marks; or + + f) Requiring indemnification of licensors and authors of that + material by anyone who conveys the material (or modified versions of + it) with contractual assumptions of liability to the recipient, for + any liability that these contractual assumptions directly impose on + those licensors and authors. + + All other non-permissive additional terms are considered "further +restrictions" within the meaning of section 10. If the Program as you +received it, or any part of it, contains a notice stating that it is +governed by this License along with a term that is a further +restriction, you may remove that term. If a license document contains +a further restriction but permits relicensing or conveying under this +License, you may add to a covered work material governed by the terms +of that license document, provided that the further restriction does +not survive such relicensing or conveying. + + If you add terms to a covered work in accord with this section, you +must place, in the relevant source files, a statement of the +additional terms that apply to those files, or a notice indicating +where to find the applicable terms. + + Additional terms, permissive or non-permissive, may be stated in the +form of a separately written license, or stated as exceptions; +the above requirements apply either way. + + 8. Termination. + + You may not propagate or modify a covered work except as expressly +provided under this License. Any attempt otherwise to propagate or +modify it is void, and will automatically terminate your rights under +this License (including any patent licenses granted under the third +paragraph of section 11). + + However, if you cease all violation of this License, then your +license from a particular copyright holder is reinstated (a) +provisionally, unless and until the copyright holder explicitly and +finally terminates your license, and (b) permanently, if the copyright +holder fails to notify you of the violation by some reasonable means +prior to 60 days after the cessation. + + Moreover, your license from a particular copyright holder is +reinstated permanently if the copyright holder notifies you of the +violation by some reasonable means, this is the first time you have +received notice of violation of this License (for any work) from that +copyright holder, and you cure the violation prior to 30 days after +your receipt of the notice. + + Termination of your rights under this section does not terminate the +licenses of parties who have received copies or rights from you under +this License. If your rights have been terminated and not permanently +reinstated, you do not qualify to receive new licenses for the same +material under section 10. + + 9. Acceptance Not Required for Having Copies. + + You are not required to accept this License in order to receive or +run a copy of the Program. Ancillary propagation of a covered work +occurring solely as a consequence of using peer-to-peer transmission +to receive a copy likewise does not require acceptance. However, +nothing other than this License grants you permission to propagate or +modify any covered work. These actions infringe copyright if you do +not accept this License. Therefore, by modifying or propagating a +covered work, you indicate your acceptance of this License to do so. + + 10. Automatic Licensing of Downstream Recipients. + + Each time you convey a covered work, the recipient automatically +receives a license from the original licensors, to run, modify and +propagate that work, subject to this License. You are not responsible +for enforcing compliance by third parties with this License. + + An "entity transaction" is a transaction transferring control of an +organization, or substantially all assets of one, or subdividing an +organization, or merging organizations. If propagation of a covered +work results from an entity transaction, each party to that +transaction who receives a copy of the work also receives whatever +licenses to the work the party's predecessor in interest had or could +give under the previous paragraph, plus a right to possession of the +Corresponding Source of the work from the predecessor in interest, if +the predecessor has it or can get it with reasonable efforts. + + You may not impose any further restrictions on the exercise of the +rights granted or affirmed under this License. For example, you may +not impose a license fee, royalty, or other charge for exercise of +rights granted under this License, and you may not initiate litigation +(including a cross-claim or counterclaim in a lawsuit) alleging that +any patent claim is infringed by making, using, selling, offering for +sale, or importing the Program or any portion of it. + + 11. Patents. + + A "contributor" is a copyright holder who authorizes use under this +License of the Program or a work on which the Program is based. The +work thus licensed is called the contributor's "contributor version". + + A contributor's "essential patent claims" are all patent claims +owned or controlled by the contributor, whether already acquired or +hereafter acquired, that would be infringed by some manner, permitted +by this License, of making, using, or selling its contributor version, +but do not include claims that would be infringed only as a +consequence of further modification of the contributor version. For +purposes of this definition, "control" includes the right to grant +patent sublicenses in a manner consistent with the requirements of +this License. + + Each contributor grants you a non-exclusive, worldwide, royalty-free +patent license under the contributor's essential patent claims, to +make, use, sell, offer for sale, import and otherwise run, modify and +propagate the contents of its contributor version. + + In the following three paragraphs, a "patent license" is any express +agreement or commitment, however denominated, not to enforce a patent +(such as an express permission to practice a patent or covenant not to +sue for patent infringement). To "grant" such a patent license to a +party means to make such an agreement or commitment not to enforce a +patent against the party. + + If you convey a covered work, knowingly relying on a patent license, +and the Corresponding Source of the work is not available for anyone +to copy, free of charge and under the terms of this License, through a +publicly available network server or other readily accessible means, +then you must either (1) cause the Corresponding Source to be so +available, or (2) arrange to deprive yourself of the benefit of the +patent license for this particular work, or (3) arrange, in a manner +consistent with the requirements of this License, to extend the patent +license to downstream recipients. "Knowingly relying" means you have +actual knowledge that, but for the patent license, your conveying the +covered work in a country, or your recipient's use of the covered work +in a country, would infringe one or more identifiable patents in that +country that you have reason to believe are valid. + + If, pursuant to or in connection with a single transaction or +arrangement, you convey, or propagate by procuring conveyance of, a +covered work, and grant a patent license to some of the parties +receiving the covered work authorizing them to use, propagate, modify +or convey a specific copy of the covered work, then the patent license +you grant is automatically extended to all recipients of the covered +work and works based on it. + + A patent license is "discriminatory" if it does not include within +the scope of its coverage, prohibits the exercise of, or is +conditioned on the non-exercise of one or more of the rights that are +specifically granted under this License. You may not convey a covered +work if you are a party to an arrangement with a third party that is +in the business of distributing software, under which you make payment +to the third party based on the extent of your activity of conveying +the work, and under which the third party grants, to any of the +parties who would receive the covered work from you, a discriminatory +patent license (a) in connection with copies of the covered work +conveyed by you (or copies made from those copies), or (b) primarily +for and in connection with specific products or compilations that +contain the covered work, unless you entered into that arrangement, +or that patent license was granted, prior to 28 March 2007. + + Nothing in this License shall be construed as excluding or limiting +any implied license or other defenses to infringement that may +otherwise be available to you under applicable patent law. + + 12. No Surrender of Others' Freedom. + + If conditions are imposed on you (whether by court order, agreement or +otherwise) that contradict the conditions of this License, they do not +excuse you from the conditions of this License. If you cannot convey a +covered work so as to satisfy simultaneously your obligations under this +License and any other pertinent obligations, then as a consequence you may +not convey it at all. For example, if you agree to terms that obligate you +to collect a royalty for further conveying from those to whom you convey +the Program, the only way you could satisfy both those terms and this +License would be to refrain entirely from conveying the Program. + + 13. Remote Network Interaction; Use with the GNU General Public License. + + Notwithstanding any other provision of this License, if you modify the +Program, your modified version must prominently offer all users +interacting with it remotely through a computer network (if your version +supports such interaction) an opportunity to receive the Corresponding +Source of your version by providing access to the Corresponding Source +from a network server at no charge, through some standard or customary +means of facilitating copying of software. This Corresponding Source +shall include the Corresponding Source for any work covered by version 3 +of the GNU General Public License that is incorporated pursuant to the +following paragraph. + + Notwithstanding any other provision of this License, you have +permission to link or combine any covered work with a work licensed +under version 3 of the GNU General Public License into a single +combined work, and to convey the resulting work. The terms of this +License will continue to apply to the part which is the covered work, +but the work with which it is combined will remain governed by version +3 of the GNU General Public License. + + 14. Revised Versions of this License. + + The Free Software Foundation may publish revised and/or new versions of +the GNU Affero General Public License from time to time. Such new versions +will be similar in spirit to the present version, but may differ in detail to +address new problems or concerns. + + Each version is given a distinguishing version number. If the +Program specifies that a certain numbered version of the GNU Affero General +Public License "or any later version" applies to it, you have the +option of following the terms and conditions either of that numbered +version or of any later version published by the Free Software +Foundation. If the Program does not specify a version number of the +GNU Affero General Public License, you may choose any version ever published +by the Free Software Foundation. + + If the Program specifies that a proxy can decide which future +versions of the GNU Affero General Public License can be used, that proxy's +public statement of acceptance of a version permanently authorizes you +to choose that version for the Program. + + Later license versions may give you additional or different +permissions. However, no additional obligations are imposed on any +author or copyright holder as a result of your choosing to follow a +later version. + + 15. Disclaimer of Warranty. + + THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY +APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT +HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY +OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, +THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR +PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM +IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF +ALL NECESSARY SERVICING, REPAIR OR CORRECTION. + + 16. Limitation of Liability. + + IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING +WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS +THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY +GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE +USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF +DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD +PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS), +EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF +SUCH DAMAGES. + + 17. Interpretation of Sections 15 and 16. + + If the disclaimer of warranty and limitation of liability provided +above cannot be given local legal effect according to their terms, +reviewing courts shall apply local law that most closely approximates +an absolute waiver of all civil liability in connection with the +Program, unless a warranty or assumption of liability accompanies a +copy of the Program in return for a fee. + + END OF TERMS AND CONDITIONS + + How to Apply These Terms to Your New Programs + + If you develop a new program, and you want it to be of the greatest +possible use to the public, the best way to achieve this is to make it +free software which everyone can redistribute and change under these terms. + + To do so, attach the following notices to the program. It is safest +to attach them to the start of each source file to most effectively +state the exclusion of warranty; and each file should have at least +the "copyright" line and a pointer to where the full notice is found. + + + Copyright (C) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU Affero General Public License as published by + the Free Software Foundation, either version 3 of the License, or + (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU Affero General Public License for more details. + + You should have received a copy of the GNU Affero General Public License + along with this program. If not, see . + +Also add information on how to contact you by electronic and paper mail. + + If your software can interact with users remotely through a computer +network, you should also make sure that it provides a way for users to +get its source. For example, if your program is a web application, its +interface could display a "Source" link that leads users to an archive +of the code. There are many ways you could offer source, and different +solutions will be better for different programs; see section 13 for the +specific requirements. + + You should also get your employer (if you work as a programmer) or school, +if any, to sign a "copyright disclaimer" for the program, if necessary. +For more information on this, and how to apply and follow the GNU AGPL, see +. diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/ChangeLog diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/INSTALL --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/INSTALL Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,237 @@ +Installation Instructions +************************* + +Copyright (C) 1994, 1995, 1996, 1999, 2000, 2001, 2002, 2004, 2005, +2006, 2007 Free Software Foundation, Inc. + +This file is free documentation; the Free Software Foundation gives +unlimited permission to copy, distribute and modify it. + +Basic Installation +================== + +Briefly, the shell commands `./configure; make; make install' should +configure, build, and install this package. The following +more-detailed instructions are generic; see the `README' file for +instructions specific to this package. + + The `configure' shell script attempts to guess correct values for +various system-dependent variables used during compilation. It uses +those values to create a `Makefile' in each directory of the package. +It may also create one or more `.h' files containing system-dependent +definitions. Finally, it creates a shell script `config.status' that +you can run in the future to recreate the current configuration, and a +file `config.log' containing compiler output (useful mainly for +debugging `configure'). + + It can also use an optional file (typically called `config.cache' +and enabled with `--cache-file=config.cache' or simply `-C') that saves +the results of its tests to speed up reconfiguring. Caching is +disabled by default to prevent problems with accidental use of stale +cache files. + + If you need to do unusual things to compile the package, please try +to figure out how `configure' could check whether to do them, and mail +diffs or instructions to the address given in the `README' so they can +be considered for the next release. If you are using the cache, and at +some point `config.cache' contains results you don't want to keep, you +may remove or edit it. + + The file `configure.ac' (or `configure.in') is used to create +`configure' by a program called `autoconf'. You need `configure.ac' if +you want to change it or regenerate `configure' using a newer version +of `autoconf'. + +The simplest way to compile this package is: + + 1. `cd' to the directory containing the package's source code and type + `./configure' to configure the package for your system. + + Running `configure' might take a while. While running, it prints + some messages telling which features it is checking for. + + 2. Type `make' to compile the package. + + 3. Optionally, type `make check' to run any self-tests that come with + the package. + + 4. Type `make install' to install the programs and any data files and + documentation. + + 5. You can remove the program binaries and object files from the + source code directory by typing `make clean'. To also remove the + files that `configure' created (so you can compile the package for + a different kind of computer), type `make distclean'. There is + also a `make maintainer-clean' target, but that is intended mainly + for the package's developers. If you use it, you may have to get + all sorts of other programs in order to regenerate files that came + with the distribution. + + 6. Often, you can also type `make uninstall' to remove the installed + files again. + +Compilers and Options +===================== + +Some systems require unusual options for compilation or linking that the +`configure' script does not know about. Run `./configure --help' for +details on some of the pertinent environment variables. + + You can give `configure' initial values for configuration parameters +by setting variables in the command line or in the environment. Here +is an example: + + ./configure CC=c99 CFLAGS=-g LIBS=-lposix + + *Note Defining Variables::, for more details. + +Compiling For Multiple Architectures +==================================== + +You can compile the package for more than one kind of computer at the +same time, by placing the object files for each architecture in their +own directory. To do this, you can use GNU `make'. `cd' to the +directory where you want the object files and executables to go and run +the `configure' script. `configure' automatically checks for the +source code in the directory that `configure' is in and in `..'. + + With a non-GNU `make', it is safer to compile the package for one +architecture at a time in the source code directory. After you have +installed the package for one architecture, use `make distclean' before +reconfiguring for another architecture. + +Installation Names +================== + +By default, `make install' installs the package's commands under +`/usr/local/bin', include files under `/usr/local/include', etc. You +can specify an installation prefix other than `/usr/local' by giving +`configure' the option `--prefix=PREFIX'. + + You can specify separate installation prefixes for +architecture-specific files and architecture-independent files. If you +pass the option `--exec-prefix=PREFIX' to `configure', the package uses +PREFIX as the prefix for installing programs and libraries. +Documentation and other data files still use the regular prefix. + + In addition, if you use an unusual directory layout you can give +options like `--bindir=DIR' to specify different values for particular +kinds of files. Run `configure --help' for a list of the directories +you can set and what kinds of files go in them. + + If the package supports it, you can cause programs to be installed +with an extra prefix or suffix on their names by giving `configure' the +option `--program-prefix=PREFIX' or `--program-suffix=SUFFIX'. + +Optional Features +================= + +Some packages pay attention to `--enable-FEATURE' options to +`configure', where FEATURE indicates an optional part of the package. +They may also pay attention to `--with-PACKAGE' options, where PACKAGE +is something like `gnu-as' or `x' (for the X Window System). The +`README' should mention any `--enable-' and `--with-' options that the +package recognizes. + + For packages that use the X Window System, `configure' can usually +find the X include and library files automatically, but if it doesn't, +you can use the `configure' options `--x-includes=DIR' and +`--x-libraries=DIR' to specify their locations. + +Specifying the System Type +========================== + +There may be some features `configure' cannot figure out automatically, +but needs to determine by the type of machine the package will run on. +Usually, assuming the package is built to be run on the _same_ +architectures, `configure' can figure that out, but if it prints a +message saying it cannot guess the machine type, give it the +`--build=TYPE' option. TYPE can either be a short name for the system +type, such as `sun4', or a canonical name which has the form: + + CPU-COMPANY-SYSTEM + +where SYSTEM can have one of these forms: + + OS KERNEL-OS + + See the file `config.sub' for the possible values of each field. If +`config.sub' isn't included in this package, then this package doesn't +need to know the machine type. + + If you are _building_ compiler tools for cross-compiling, you should +use the option `--target=TYPE' to select the type of system they will +produce code for. + + If you want to _use_ a cross compiler, that generates code for a +platform different from the build platform, you should specify the +"host" platform (i.e., that on which the generated programs will +eventually be run) with `--host=TYPE'. + +Sharing Defaults +================ + +If you want to set default values for `configure' scripts to share, you +can create a site shell script called `config.site' that gives default +values for variables like `CC', `cache_file', and `prefix'. +`configure' looks for `PREFIX/share/config.site' if it exists, then +`PREFIX/etc/config.site' if it exists. Or, you can set the +`CONFIG_SITE' environment variable to the location of the site script. +A warning: not all `configure' scripts look for a site script. + +Defining Variables +================== + +Variables not defined in a site shell script can be set in the +environment passed to `configure'. However, some packages may run +configure again during the build, and the customized values of these +variables may be lost. In order to avoid this problem, you should set +them in the `configure' command line, using `VAR=value'. For example: + + ./configure CC=/usr/local2/bin/gcc + +causes the specified `gcc' to be used as the C compiler (unless it is +overridden in the site shell script). + +Unfortunately, this technique does not work for `CONFIG_SHELL' due to +an Autoconf bug. Until the bug is fixed you can use this workaround: + + CONFIG_SHELL=/bin/bash /bin/bash ./configure CONFIG_SHELL=/bin/bash + +`configure' Invocation +====================== + +`configure' recognizes the following options to control how it operates. + +`--help' +`-h' + Print a summary of the options to `configure', and exit. + +`--version' +`-V' + Print the version of Autoconf used to generate the `configure' + script, and exit. + +`--cache-file=FILE' + Enable the cache: use and save the results of the tests in FILE, + traditionally `config.cache'. FILE defaults to `/dev/null' to + disable caching. + +`--config-cache' +`-C' + Alias for `--cache-file=config.cache'. + +`--quiet' +`--silent' +`-q' + Do not print messages saying which checks are being made. To + suppress all normal output, redirect it to `/dev/null' (any error + messages will still be shown). + +`--srcdir=DIR' + Look for the package's source code in directory DIR. Usually + `configure' can determine that directory automatically. + +`configure' also accepts some other, not widely useful, options. Run +`configure --help' for more details. + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/Makefile.am --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/Makefile.am Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,16 @@ +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +EXTRA_DIST = reconf configure README install_galaxy_files.sh + +SUBDIRS = m4 src doc galaxy scripts + +AUTOMAKE_OPTIONS = dist-bzip2 no-dist-gzip + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/Makefile.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/Makefile.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,624 @@ +# Makefile.in generated by automake 1.10.1 from Makefile.am. +# @configure_input@ + +# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, +# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This Makefile.in is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +@SET_MAKE@ + +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. +VPATH = @srcdir@ +pkgdatadir = $(datadir)/@PACKAGE@ +pkglibdir = $(libdir)/@PACKAGE@ +pkgincludedir = $(includedir)/@PACKAGE@ +am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd +install_sh_DATA = $(install_sh) -c -m 644 +install_sh_PROGRAM = $(install_sh) -c +install_sh_SCRIPT = $(install_sh) -c +INSTALL_HEADER = $(INSTALL_DATA) +transform = $(program_transform_name) +NORMAL_INSTALL = : +PRE_INSTALL = : +POST_INSTALL = : +NORMAL_UNINSTALL = : +PRE_UNINSTALL = : +POST_UNINSTALL = : +build_triplet = @build@ +host_triplet = @host@ +subdir = . +DIST_COMMON = README $(am__configure_deps) $(srcdir)/Makefile.am \ + $(srcdir)/Makefile.in $(srcdir)/config.h.in \ + $(top_srcdir)/configure AUTHORS COPYING ChangeLog INSTALL NEWS \ + THANKS config/config.guess config/config.sub config/depcomp \ + config/install-sh config/missing +ACLOCAL_M4 = $(top_srcdir)/aclocal.m4 +am__aclocal_m4_deps = $(top_srcdir)/configure.ac +am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \ + $(ACLOCAL_M4) +am__CONFIG_DISTCLEAN_FILES = config.status config.cache config.log \ + configure.lineno config.status.lineno +mkinstalldirs = $(install_sh) -d +CONFIG_HEADER = config.h +CONFIG_CLEAN_FILES = +SOURCES = +DIST_SOURCES = +RECURSIVE_TARGETS = all-recursive check-recursive dvi-recursive \ + html-recursive info-recursive install-data-recursive \ + install-dvi-recursive install-exec-recursive \ + install-html-recursive install-info-recursive \ + install-pdf-recursive install-ps-recursive install-recursive \ + installcheck-recursive installdirs-recursive pdf-recursive \ + ps-recursive uninstall-recursive +RECURSIVE_CLEAN_TARGETS = mostlyclean-recursive clean-recursive \ + distclean-recursive maintainer-clean-recursive +ETAGS = etags +CTAGS = ctags +DIST_SUBDIRS = $(SUBDIRS) +DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST) +distdir = $(PACKAGE)-$(VERSION) +top_distdir = $(distdir) +am__remove_distdir = \ + { test ! -d $(distdir) \ + || { find $(distdir) -type d ! -perm -200 -exec chmod u+w {} ';' \ + && rm -fr $(distdir); }; } +GZIP_ENV = --best +DIST_ARCHIVES = $(distdir).tar.bz2 +distuninstallcheck_listfiles = find . -type f -print +distcleancheck_listfiles = find . -type f -print +ACLOCAL = @ACLOCAL@ +AMTAR = @AMTAR@ +AUTOCONF = @AUTOCONF@ +AUTOHEADER = @AUTOHEADER@ +AUTOMAKE = @AUTOMAKE@ +AWK = @AWK@ +CC = @CC@ +CCDEPMODE = @CCDEPMODE@ +CFLAGS = @CFLAGS@ +CPP = @CPP@ +CPPFLAGS = @CPPFLAGS@ +CXX = @CXX@ +CXXCPP = @CXXCPP@ +CXXDEPMODE = @CXXDEPMODE@ +CXXFLAGS = @CXXFLAGS@ +CYGPATH_W = @CYGPATH_W@ +DEFS = @DEFS@ +DEPDIR = @DEPDIR@ +ECHO_C = @ECHO_C@ +ECHO_N = @ECHO_N@ +ECHO_T = @ECHO_T@ +EGREP = @EGREP@ +EXEEXT = @EXEEXT@ +GREP = @GREP@ +INSTALL = @INSTALL@ +INSTALL_DATA = @INSTALL_DATA@ +INSTALL_PROGRAM = @INSTALL_PROGRAM@ +INSTALL_SCRIPT = @INSTALL_SCRIPT@ +INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@ +LDFLAGS = @LDFLAGS@ +LIBOBJS = @LIBOBJS@ +LIBS = @LIBS@ +LTLIBOBJS = @LTLIBOBJS@ +MAKEINFO = @MAKEINFO@ +MKDIR_P = @MKDIR_P@ +OBJEXT = @OBJEXT@ +PACKAGE = @PACKAGE@ +PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@ +PACKAGE_NAME = @PACKAGE_NAME@ +PACKAGE_STRING = @PACKAGE_STRING@ +PACKAGE_TARNAME = @PACKAGE_TARNAME@ +PACKAGE_VERSION = @PACKAGE_VERSION@ +PATH_SEPARATOR = @PATH_SEPARATOR@ +RANLIB = @RANLIB@ +SET_MAKE = @SET_MAKE@ +SHELL = @SHELL@ +STRIP = @STRIP@ +VERSION = @VERSION@ +abs_builddir = @abs_builddir@ +abs_srcdir = @abs_srcdir@ +abs_top_builddir = @abs_top_builddir@ +abs_top_srcdir = @abs_top_srcdir@ +ac_ct_CC = @ac_ct_CC@ +ac_ct_CXX = @ac_ct_CXX@ +am__include = @am__include@ +am__leading_dot = @am__leading_dot@ +am__quote = @am__quote@ +am__tar = @am__tar@ +am__untar = @am__untar@ +bindir = @bindir@ +build = @build@ +build_alias = @build_alias@ +build_cpu = @build_cpu@ +build_os = @build_os@ +build_vendor = @build_vendor@ +builddir = @builddir@ +canonical_host_type = @canonical_host_type@ +datadir = @datadir@ +datarootdir = @datarootdir@ +docdir = @docdir@ +dvidir = @dvidir@ +exec_prefix = @exec_prefix@ +host = @host@ +host_alias = @host_alias@ +host_cpu = @host_cpu@ +host_os = @host_os@ +host_vendor = @host_vendor@ +htmldir = @htmldir@ +includedir = @includedir@ +infodir = @infodir@ +install_sh = @install_sh@ +libdir = @libdir@ +libexecdir = @libexecdir@ +localedir = @localedir@ +localstatedir = @localstatedir@ +mandir = @mandir@ +mkdir_p = @mkdir_p@ +oldincludedir = @oldincludedir@ +pdfdir = @pdfdir@ +prefix = @prefix@ +program_transform_name = @program_transform_name@ +psdir = @psdir@ +sbindir = @sbindir@ +sharedstatedir = @sharedstatedir@ +srcdir = @srcdir@ +sysconfdir = @sysconfdir@ +target_alias = @target_alias@ +top_builddir = @top_builddir@ +top_srcdir = @top_srcdir@ +EXTRA_DIST = reconf configure README install_galaxy_files.sh +SUBDIRS = m4 src doc galaxy scripts +AUTOMAKE_OPTIONS = dist-bzip2 no-dist-gzip +all: config.h + $(MAKE) $(AM_MAKEFLAGS) all-recursive + +.SUFFIXES: +am--refresh: + @: +$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps) + @for dep in $?; do \ + case '$(am__configure_deps)' in \ + *$$dep*) \ + echo ' cd $(srcdir) && $(AUTOMAKE) --gnu '; \ + cd $(srcdir) && $(AUTOMAKE) --gnu \ + && exit 0; \ + exit 1;; \ + esac; \ + done; \ + echo ' cd $(top_srcdir) && $(AUTOMAKE) --gnu Makefile'; \ + cd $(top_srcdir) && \ + $(AUTOMAKE) --gnu Makefile +.PRECIOUS: Makefile +Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status + @case '$?' in \ + *config.status*) \ + echo ' $(SHELL) ./config.status'; \ + $(SHELL) ./config.status;; \ + *) \ + echo ' cd $(top_builddir) && $(SHELL) ./config.status $@ $(am__depfiles_maybe)'; \ + cd $(top_builddir) && $(SHELL) ./config.status $@ $(am__depfiles_maybe);; \ + esac; + +$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES) + $(SHELL) ./config.status --recheck + +$(top_srcdir)/configure: $(am__configure_deps) + cd $(srcdir) && $(AUTOCONF) +$(ACLOCAL_M4): $(am__aclocal_m4_deps) + cd $(srcdir) && $(ACLOCAL) $(ACLOCAL_AMFLAGS) + +config.h: stamp-h1 + @if test ! -f $@; then \ + rm -f stamp-h1; \ + $(MAKE) $(AM_MAKEFLAGS) stamp-h1; \ + else :; fi + +stamp-h1: $(srcdir)/config.h.in $(top_builddir)/config.status + @rm -f stamp-h1 + cd $(top_builddir) && $(SHELL) ./config.status config.h +$(srcdir)/config.h.in: $(am__configure_deps) + cd $(top_srcdir) && $(AUTOHEADER) + rm -f stamp-h1 + touch $@ + +distclean-hdr: + -rm -f config.h stamp-h1 + +# This directory's subdirectories are mostly independent; you can cd +# into them and run `make' without going through this Makefile. +# To change the values of `make' variables: instead of editing Makefiles, +# (1) if the variable is set in `config.status', edit `config.status' +# (which will cause the Makefiles to be regenerated when you run `make'); +# (2) otherwise, pass the desired values on the `make' command line. +$(RECURSIVE_TARGETS): + @failcom='exit 1'; \ + for f in x $$MAKEFLAGS; do \ + case $$f in \ + *=* | --[!k]*);; \ + *k*) failcom='fail=yes';; \ + esac; \ + done; \ + dot_seen=no; \ + target=`echo $@ | sed s/-recursive//`; \ + list='$(SUBDIRS)'; for subdir in $$list; do \ + echo "Making $$target in $$subdir"; \ + if test "$$subdir" = "."; then \ + dot_seen=yes; \ + local_target="$$target-am"; \ + else \ + local_target="$$target"; \ + fi; \ + (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) $$local_target) \ + || eval $$failcom; \ + done; \ + if test "$$dot_seen" = "no"; then \ + $(MAKE) $(AM_MAKEFLAGS) "$$target-am" || exit 1; \ + fi; test -z "$$fail" + +$(RECURSIVE_CLEAN_TARGETS): + @failcom='exit 1'; \ + for f in x $$MAKEFLAGS; do \ + case $$f in \ + *=* | --[!k]*);; \ + *k*) failcom='fail=yes';; \ + esac; \ + done; \ + dot_seen=no; \ + case "$@" in \ + distclean-* | maintainer-clean-*) list='$(DIST_SUBDIRS)' ;; \ + *) list='$(SUBDIRS)' ;; \ + esac; \ + rev=''; for subdir in $$list; do \ + if test "$$subdir" = "."; then :; else \ + rev="$$subdir $$rev"; \ + fi; \ + done; \ + rev="$$rev ."; \ + target=`echo $@ | sed s/-recursive//`; \ + for subdir in $$rev; do \ + echo "Making $$target in $$subdir"; \ + if test "$$subdir" = "."; then \ + local_target="$$target-am"; \ + else \ + local_target="$$target"; \ + fi; \ + (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) $$local_target) \ + || eval $$failcom; \ + done && test -z "$$fail" +tags-recursive: + list='$(SUBDIRS)'; for subdir in $$list; do \ + test "$$subdir" = . || (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) tags); \ + done +ctags-recursive: + list='$(SUBDIRS)'; for subdir in $$list; do \ + test "$$subdir" = . || (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) ctags); \ + done + +ID: $(HEADERS) $(SOURCES) $(LISP) $(TAGS_FILES) + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonemtpy = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + mkid -fID $$unique +tags: TAGS + +TAGS: tags-recursive $(HEADERS) $(SOURCES) config.h.in $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + here=`pwd`; \ + if ($(ETAGS) --etags-include --version) >/dev/null 2>&1; then \ + include_option=--etags-include; \ + empty_fix=.; \ + else \ + include_option=--include; \ + empty_fix=; \ + fi; \ + list='$(SUBDIRS)'; for subdir in $$list; do \ + if test "$$subdir" = .; then :; else \ + test ! -f $$subdir/TAGS || \ + tags="$$tags $$include_option=$$here/$$subdir/TAGS"; \ + fi; \ + done; \ + list='$(SOURCES) $(HEADERS) config.h.in $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + if test -z "$(ETAGS_ARGS)$$tags$$unique"; then :; else \ + test -n "$$unique" || unique=$$empty_fix; \ + $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \ + $$tags $$unique; \ + fi +ctags: CTAGS +CTAGS: ctags-recursive $(HEADERS) $(SOURCES) config.h.in $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + list='$(SOURCES) $(HEADERS) config.h.in $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + test -z "$(CTAGS_ARGS)$$tags$$unique" \ + || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \ + $$tags $$unique + +GTAGS: + here=`$(am__cd) $(top_builddir) && pwd` \ + && cd $(top_srcdir) \ + && gtags -i $(GTAGS_ARGS) $$here + +distclean-tags: + -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags + +distdir: $(DISTFILES) + $(am__remove_distdir) + test -d $(distdir) || mkdir $(distdir) + @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + list='$(DISTFILES)'; \ + dist_files=`for file in $$list; do echo $$file; done | \ + sed -e "s|^$$srcdirstrip/||;t" \ + -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \ + case $$dist_files in \ + */*) $(MKDIR_P) `echo "$$dist_files" | \ + sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \ + sort -u` ;; \ + esac; \ + for file in $$dist_files; do \ + if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \ + if test -d $$d/$$file; then \ + dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \ + if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \ + cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \ + fi; \ + cp -pR $$d/$$file $(distdir)$$dir || exit 1; \ + else \ + test -f $(distdir)/$$file \ + || cp -p $$d/$$file $(distdir)/$$file \ + || exit 1; \ + fi; \ + done + list='$(DIST_SUBDIRS)'; for subdir in $$list; do \ + if test "$$subdir" = .; then :; else \ + test -d "$(distdir)/$$subdir" \ + || $(MKDIR_P) "$(distdir)/$$subdir" \ + || exit 1; \ + distdir=`$(am__cd) $(distdir) && pwd`; \ + top_distdir=`$(am__cd) $(top_distdir) && pwd`; \ + (cd $$subdir && \ + $(MAKE) $(AM_MAKEFLAGS) \ + top_distdir="$$top_distdir" \ + distdir="$$distdir/$$subdir" \ + am__remove_distdir=: \ + am__skip_length_check=: \ + distdir) \ + || exit 1; \ + fi; \ + done + -find $(distdir) -type d ! -perm -777 -exec chmod a+rwx {} \; -o \ + ! -type d ! -perm -444 -links 1 -exec chmod a+r {} \; -o \ + ! -type d ! -perm -400 -exec chmod a+r {} \; -o \ + ! -type d ! -perm -444 -exec $(install_sh) -c -m a+r {} {} \; \ + || chmod -R a+r $(distdir) +dist-gzip: distdir + tardir=$(distdir) && $(am__tar) | GZIP=$(GZIP_ENV) gzip -c >$(distdir).tar.gz + $(am__remove_distdir) +dist-bzip2: distdir + tardir=$(distdir) && $(am__tar) | bzip2 -9 -c >$(distdir).tar.bz2 + $(am__remove_distdir) + +dist-lzma: distdir + tardir=$(distdir) && $(am__tar) | lzma -9 -c >$(distdir).tar.lzma + $(am__remove_distdir) + +dist-tarZ: distdir + tardir=$(distdir) && $(am__tar) | compress -c >$(distdir).tar.Z + $(am__remove_distdir) + +dist-shar: distdir + shar $(distdir) | GZIP=$(GZIP_ENV) gzip -c >$(distdir).shar.gz + $(am__remove_distdir) + +dist-zip: distdir + -rm -f $(distdir).zip + zip -rq $(distdir).zip $(distdir) + $(am__remove_distdir) + +dist dist-all: distdir + tardir=$(distdir) && $(am__tar) | bzip2 -9 -c >$(distdir).tar.bz2 + $(am__remove_distdir) + +# This target untars the dist file and tries a VPATH configuration. Then +# it guarantees that the distribution is self-contained by making another +# tarfile. +distcheck: dist + case '$(DIST_ARCHIVES)' in \ + *.tar.gz*) \ + GZIP=$(GZIP_ENV) gunzip -c $(distdir).tar.gz | $(am__untar) ;;\ + *.tar.bz2*) \ + bunzip2 -c $(distdir).tar.bz2 | $(am__untar) ;;\ + *.tar.lzma*) \ + unlzma -c $(distdir).tar.lzma | $(am__untar) ;;\ + *.tar.Z*) \ + uncompress -c $(distdir).tar.Z | $(am__untar) ;;\ + *.shar.gz*) \ + GZIP=$(GZIP_ENV) gunzip -c $(distdir).shar.gz | unshar ;;\ + *.zip*) \ + unzip $(distdir).zip ;;\ + esac + chmod -R a-w $(distdir); chmod a+w $(distdir) + mkdir $(distdir)/_build + mkdir $(distdir)/_inst + chmod a-w $(distdir) + dc_install_base=`$(am__cd) $(distdir)/_inst && pwd | sed -e 's,^[^:\\/]:[\\/],/,'` \ + && dc_destdir="$${TMPDIR-/tmp}/am-dc-$$$$/" \ + && cd $(distdir)/_build \ + && ../configure --srcdir=.. --prefix="$$dc_install_base" \ + $(DISTCHECK_CONFIGURE_FLAGS) \ + && $(MAKE) $(AM_MAKEFLAGS) \ + && $(MAKE) $(AM_MAKEFLAGS) dvi \ + && $(MAKE) $(AM_MAKEFLAGS) check \ + && $(MAKE) $(AM_MAKEFLAGS) install \ + && $(MAKE) $(AM_MAKEFLAGS) installcheck \ + && $(MAKE) $(AM_MAKEFLAGS) uninstall \ + && $(MAKE) $(AM_MAKEFLAGS) distuninstallcheck_dir="$$dc_install_base" \ + distuninstallcheck \ + && chmod -R a-w "$$dc_install_base" \ + && ({ \ + (cd ../.. && umask 077 && mkdir "$$dc_destdir") \ + && $(MAKE) $(AM_MAKEFLAGS) DESTDIR="$$dc_destdir" install \ + && $(MAKE) $(AM_MAKEFLAGS) DESTDIR="$$dc_destdir" uninstall \ + && $(MAKE) $(AM_MAKEFLAGS) DESTDIR="$$dc_destdir" \ + distuninstallcheck_dir="$$dc_destdir" distuninstallcheck; \ + } || { rm -rf "$$dc_destdir"; exit 1; }) \ + && rm -rf "$$dc_destdir" \ + && $(MAKE) $(AM_MAKEFLAGS) dist \ + && rm -rf $(DIST_ARCHIVES) \ + && $(MAKE) $(AM_MAKEFLAGS) distcleancheck + $(am__remove_distdir) + @(echo "$(distdir) archives ready for distribution: "; \ + list='$(DIST_ARCHIVES)'; for i in $$list; do echo $$i; done) | \ + sed -e 1h -e 1s/./=/g -e 1p -e 1x -e '$$p' -e '$$x' +distuninstallcheck: + @cd $(distuninstallcheck_dir) \ + && test `$(distuninstallcheck_listfiles) | wc -l` -le 1 \ + || { echo "ERROR: files left after uninstall:" ; \ + if test -n "$(DESTDIR)"; then \ + echo " (check DESTDIR support)"; \ + fi ; \ + $(distuninstallcheck_listfiles) ; \ + exit 1; } >&2 +distcleancheck: distclean + @if test '$(srcdir)' = . ; then \ + echo "ERROR: distcleancheck can only run from a VPATH build" ; \ + exit 1 ; \ + fi + @test `$(distcleancheck_listfiles) | wc -l` -eq 0 \ + || { echo "ERROR: files left in build directory after distclean:" ; \ + $(distcleancheck_listfiles) ; \ + exit 1; } >&2 +check-am: all-am +check: check-recursive +all-am: Makefile config.h +installdirs: installdirs-recursive +installdirs-am: +install: install-recursive +install-exec: install-exec-recursive +install-data: install-data-recursive +uninstall: uninstall-recursive + +install-am: all-am + @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am + +installcheck: installcheck-recursive +install-strip: + $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \ + install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \ + `test -z '$(STRIP)' || \ + echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install +mostlyclean-generic: + +clean-generic: + +distclean-generic: + -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES) + +maintainer-clean-generic: + @echo "This command is intended for maintainers to use" + @echo "it deletes files that may require special tools to rebuild." +clean: clean-recursive + +clean-am: clean-generic mostlyclean-am + +distclean: distclean-recursive + -rm -f $(am__CONFIG_DISTCLEAN_FILES) + -rm -f Makefile +distclean-am: clean-am distclean-generic distclean-hdr distclean-tags + +dvi: dvi-recursive + +dvi-am: + +html: html-recursive + +info: info-recursive + +info-am: + +install-data-am: + +install-dvi: install-dvi-recursive + +install-exec-am: + +install-html: install-html-recursive + +install-info: install-info-recursive + +install-man: + +install-pdf: install-pdf-recursive + +install-ps: install-ps-recursive + +installcheck-am: + +maintainer-clean: maintainer-clean-recursive + -rm -f $(am__CONFIG_DISTCLEAN_FILES) + -rm -rf $(top_srcdir)/autom4te.cache + -rm -f Makefile +maintainer-clean-am: distclean-am maintainer-clean-generic + +mostlyclean: mostlyclean-recursive + +mostlyclean-am: mostlyclean-generic + +pdf: pdf-recursive + +pdf-am: + +ps: ps-recursive + +ps-am: + +uninstall-am: + +.MAKE: $(RECURSIVE_CLEAN_TARGETS) $(RECURSIVE_TARGETS) install-am \ + install-strip + +.PHONY: $(RECURSIVE_CLEAN_TARGETS) $(RECURSIVE_TARGETS) CTAGS GTAGS \ + all all-am am--refresh check check-am clean clean-generic \ + ctags ctags-recursive dist dist-all dist-bzip2 dist-gzip \ + dist-lzma dist-shar dist-tarZ dist-zip distcheck distclean \ + distclean-generic distclean-hdr distclean-tags distcleancheck \ + distdir distuninstallcheck dvi dvi-am html html-am info \ + info-am install install-am install-data install-data-am \ + install-dvi install-dvi-am install-exec install-exec-am \ + install-html install-html-am install-info install-info-am \ + install-man install-pdf install-pdf-am install-ps \ + install-ps-am install-strip installcheck installcheck-am \ + installdirs installdirs-am maintainer-clean \ + maintainer-clean-generic mostlyclean mostlyclean-generic pdf \ + pdf-am ps ps-am tags tags-recursive uninstall uninstall-am + +# Tell versions [3.59,3.63) of GNU make to not export all variables. +# Otherwise a system limit (for SysV at least) may be exceeded. +.NOEXPORT: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/NEWS --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/NEWS Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,26 @@ +FASTX toolkit -- History of visible changes. + +Copyright (C) 2008, Assaf Gordon +See the end for copying conditions. + +Please send FASTX toolkit bug reports to gordon@cshl.edu. + +Version 0.0.6 + +* First public release + +------------------------------------------------------- +Copying information: + +Copyright (C) 2008, Assaf Gordon + + Permission is granted to anyone to make or distribute verbatim copies + of this document as received, in any medium, provided that the + copyright notice and this permission notice are preserved, + thus giving the recipient permission to redistribute in turn. + + Permission is granted to distribute modified versions + of this document, or of portions of it, + under the above conditions, provided also that they + carry prominent notices stating who last changed them. + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/README --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/README Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,274 @@ +FASTX-Toolkit +============= + + +Short Summary +=============== + +The FASTX-Toolkit is a collection of command line tools for Short-Reads +FASTA/FASTQ files preprocessing. + + + +More Details +============== + +Next-Generation sequencing machines usually produce FASTA or FASTQ files, +containing multiple short-reads sequences (possibly with quality information). + +The main processing of such FASTA/FASTQ files is mapping (aka aligning) +the sequences to reference genomes or other databases using specialized +programs. + +Example of such mapping programs are: +Blat (http://www.kentinformatics.com/index.asp), +SHRiMP (http://compbio.cs.toronto.edu/shrimp), +LastZ (http://www.bx.psu.edu/miller_lab), +MAQ (http://maq.sourceforge.net/) +And many many others. + +However, +It is sometimes more productive to preprocess the FASTA/FASTQ files before +mapping the sequences to the genome - manipulating the sequences to +produce better mapping results. + +The FASTX-Toolkit tools perform some of these preprocessing tasks. + + + +Available Tools +=============== + +FASTQ-to-FASTA - Converts a FASTQ file to a FASTA file.. + +FASTQ-Statistics - scans a FASTQ file, and produces some statistics about the + quality and the sequences in the file. + +FASTQ-Quality-BoxPlot, and +FASTQ-Nucleotides-Distribution - Generates charts based on the statistics + generated by FASTQ-Statistics. These charts can be used to quickly + see the quality of the sequenced library. + +FASTQ-Quality-Converter - Converts from ASCII to numeric quality scores. + +FASTQ-Quality-Filter - removes low-quality sequences from FASTQ files. + +FASTX-Artifacts-Filter - removes some sequencing artifacts from FASTA/Q files. + +FASTX-Barcode-Splitter - A common practice is to sequence multiple biological + samples in the same library (marking each sample using a dedicated + barcode). The resulting FASTA/Q file contains intermixed sequences + from those samples. This tool separates FASTA/Q files into several + individual files, based on the barcodes. + +FASTX-Clipper - Adapters (aka Linkers) are added to the library (before + sequencing), and should be removed from the resulting FASTA/Q file. + This tool removes (clips) adapters. + +FASTA-Clipping-Histogram - After clipping a FASTA file, this tool generates a + chart showing the length of the clipped sequences. + +FASTX-Reverse-Complement - Produces a reverse-complement of FASTA/Q file. + If a FASTQ file is given, the quality scores are also reversed. + +FASTX-Trimmer - Extract sub-seqeunces from FASTA/Q file. Two examples are: + Removing barcodes from the 5'-end of all sequences in a FASTQ file; + Cutting 7 nucleotides from the 3'-end of all sequences in a FASTA file. + + + +Galaxy +====== + +Galaxy (http://g2.bx.psu.edu) is web-based framework for computational biology. + +While the programs in the FASTX-Toolkit are command-line based, the package +include the necessary files to integrate the tools into a Galaxy server, +Allowing users to execute this tools from their web-browser. + +If you run your own local mirror of a Galaxy server, you can integrate the +FASTX-Toolkit into your Galaxy server. + + + +Software Requirements +===================== + +1. GCC is required to compile most tools. + +2. FASTA-Clipping-Histogram tool requires Perl, the "PerlIO::gzip", + "GD::Graph::bars" modules. + + Installing the perl modules can be accomplised by running: + + $ sudo cpan 'PerlIO::gzip' + $ sudo cpan 'GD::Graph::bars' + +3. FASTX-Barcode-Splitter requires the GNU Sed program. + +4. FASTQ-Quality-Boxplot and FASTQ-Nucleotides-Distribution requires the + 'gnuplot' program. + + +Installation +============ + +To compile to tools, run: + + $ ./configure + $ make + +To install the tools, run (as root): + + $ sudo make install + +This will install the tools into /usr/local/bin. +To install the tools to a different location, change the 'configure' step to: + + $ ./configure --prefix=/DESTINATION/DIRECTORY + + + +Command Line Usage +================== + +Most tools support "-h" argument to show a short help screen. +Better documentation is not available at this moment. +Some more details and examples are available in the section +of the XML tool files (in the 'galaxy' subdirectory). + + +Galaxy Installation +=================== + +Galaxy Installation should be done manually, and requires technical +understading of the Galaxy framework. + +1. build and install the command line tools (as described above). + +2. Make backup of your galaxy installation (better safe than sorry). + +3. Run the 'install_galaxy_files.sh' script, + and specify the galaxy root directory. + This script copies the files from the 'galaxy' sub-directory into + your galaxy mirror directory. + +4. Manually add the content of ./galaxy/fastx_toolkit_conf.xml file, + into your Galaxy's tool_conf.xml + +5. Edit [YOUR-GALAXY]/tool-data/fastx_clipper_sequences.txt file, + And add your custom adapters/linkers. + +6. Modify the "fastx_barcode_splitter_galaxy_wrapper.sh" as explained + Below (see section "Special configuration for Barcode-Splitter"). + +7. Restart Galaxy. + +Always make backup of your galaxy server files before trying to install +the FASTX-Toolkit. + + + +Galaxy Testing +============== + +The following tools support Galaxy's functional testing: +(Run from Galaxy's main directory) + $ sh run_functional_tests.sh -id cshl_fastq_qual_conv + $ sh run_functional_tests.sh -id cshl_fastq_to_fasta + $ sh run_functional_tests.sh -id cshl_fastq_qual_stat + $ sh run_functional_tests.sh -id cshl_fastx_trimmer + $ sh run_functional_tests.sh -id cshl_fastx_reverse_complement + $ sh run_functional_tests.sh -id cshl_fastx_artifacts_filter + $ sh run_functional_tests.sh -id cshl_fasta_collapser + $ sh run_functional_tests.sh -id cshl_fastx_clipper + + +Special configuration for Barcode-Splitter +========================================== + +When running the barcode-splitter tool from the command line you specify a +prefix direcotry - the output files will be written to that directory (similar +to GNU's split program usage). + +Running the barcode-splittter inside galaxy requires a special hack beacuse +(I don't know how to|Galaxy can't) create a variable number of output datasets. +The number of required output files is determined by the tool only AFTER reading +the barcodes description file. + +The Galaxy-version of Barcode-Splitter works like this: +1. A FASTA/FASTQ file, and a Barcode description file are fed to the tool. +2. The tool produces a single output dataset (inside galaxy). This output + is an HTML file, containing links to the split FASTA files. +3. Users can use the links to get the split FASTA files. + (Since Galaxy's 'upload data' tool accepts URLs, this is not a real problem). + +4. As the galaxy administrator, you'll have to edit + 'fastx_barcode_splitter_galaxy_wrapper.sh' script and change BASEPATH and + PUBLICURL to point to a publicly accesibly path on your server. + +Example: + +fastx_barcode_splitter_galaxy_wrapper.sh contains: + + BASEPATH="/media/sdb1/galaxy/barcode_splits/" + PUBLICURL="http://tango.cshl.edu/barcode_splits/" + +When a user runs the barcode splitter tool, the FASTA files will be generated in +"/media/sdb1/galaxy/barcode_splits/". +The URL "http://tango.cshl.edu/barcode_splits" is set (in an apache server) to +serve files from "/media/sdb1/galaxy/barcode_splits/", with the following +configuration: + + Alias /barcode_splits "/media/sdb1/galaxy/barcode_splits/" + + AllowOverride None + Order allow,deny + Allow from all + + + + + +Licenses +======== + +FASTX-Toolkit is distributed under the Affero GPL version 3 or later (AGPLv3), + +EXCEPT + +All files under the 'galaxy' sub-directory are distributed under the +same license as Galaxy itself (which is an MIT-style license). + + +While IANAL, these licenses basically mean that: +1. You're free to use FASTX-toolkit, + +2. You're free to integrate FASTX-toolkit in your Galaxy mirror server + (or any other server). + +3. You're free to modify the files under 'galaxy', + without making your modifications public. + +4. If you modify the FASTX-toolkit tools, and make those modifications + publicly available (either as downloadable tools, part of another product), + or as a web-based server - you must make the modified source code freely + available (free as in speech). + +See the COPYING file for the full Affero GPL. +See the GALAXY-LICENSE file for galaxy's license. + +Please remember: + THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY +APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT +HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY +OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, +THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR +PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM +IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF +ALL NECESSARY SERVICING, REPAIR OR CORRECTION. + + +============= +Please send all comments, suggestions, bug reports (or better yet - bug fixes) +to gordon@cshl.edu . diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/THANKS --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/THANKS Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,8 @@ +FASTX toolkit THANKS file + +FASTX toolkit has originally been written by Assaf Gordon. +Many people have further contributed to FASTX-Toolkit by reporting problems, +suggesting various improvements, or submitting actual code. Here is +a list of these people. Help me keep it complete and exempt of errors. + +Many Hannon-lab members at CSHL (who prefered to remain anonymous). diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/aclocal.m4 --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/aclocal.m4 Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,1255 @@ +# generated automatically by aclocal 1.10.1 -*- Autoconf -*- + +# Copyright (C) 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, +# 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This file is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +m4_ifndef([AC_AUTOCONF_VERSION], + [m4_copy([m4_PACKAGE_VERSION], [AC_AUTOCONF_VERSION])])dnl +m4_if(AC_AUTOCONF_VERSION, [2.61],, +[m4_warning([this file was generated for autoconf 2.61. +You have another version of autoconf. It may work, but is not guaranteed to. +If you have problems, you may need to regenerate the build system entirely. +To do so, use the procedure documented by the package, typically `autoreconf'.])]) + +dnl Autoconf support for C++ +dnl Copyright (C) 1988 Eleftherios Gkioulekas +dnl +dnl This program is free software; you can redistribute it and/or modify +dnl it under the terms of the GNU General Public License as published by +dnl the Free Software Foundation; either version 2 of the License, or +dnl (at your option) any later version. +dnl +dnl This program is distributed in the hope that it will be useful, +dnl but WITHOUT ANY WARRANTY; without even the implied warranty of +dnl MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the +dnl GNU General Public License for more details. +dnl +dnl You should have received a copy of the GNU General Public License +dnl along with this program; if not, write to the Free Software +dnl Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA. +dnl +dnl As a special exception to the GNU General Public License, if you +dnl distribute this file as part of a program that contains a configuration +dnl script generated by Autoconf, you may include it under the same +dnl distribution terms that you use for the rest of that program. + +# ------------------------------------------------------------------------- +# Use this macro to configure your C compiler +# When called the macro does the following things: +# 1. It finds an appropriate C compiler. +# If you passed the flag --with-cc=foo then it uses that +# particular compiler +# 2. Check whether the compiler works. +# 3. Checks whether the compiler accepts the -g +# ------------------------------------------------------------------------- + +AC_DEFUN(LF_CONFIGURE_CC,[ + dnl Sing the song + AC_PROG_CC + AC_PROG_CPP + AC_AIX + AC_ISC_POSIX + AC_MINIX + AC_HEADER_STDC +]) + + +dnl Autoconf support for C++ +dnl Copyright (C) 1988 Eleftherios Gkioulekas +dnl +dnl This program is free software; you can redistribute it and/or modify +dnl it under the terms of the GNU General Public License as published by +dnl the Free Software Foundation; either version 2 of the License, or +dnl (at your option) any later version. +dnl +dnl This program is distributed in the hope that it will be useful, +dnl but WITHOUT ANY WARRANTY; without even the implied warranty of +dnl MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the +dnl GNU General Public License for more details. +dnl +dnl You should have received a copy of the GNU General Public License +dnl along with this program; if not, write to the Free Software +dnl Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA. +dnl +dnl As a special exception to the GNU General Public License, if you +dnl distribute this file as part of a program that contains a configuration +dnl script generated by Autoconf, you may include it under the same +dnl distribution terms that you use for the rest of that program. + +# ----------------------------------------------------------------- +# This macro should be called to configure your C++ compiler. +# When called, the macro does the following things: +# 1. It finds an appropriate C++ compiler +# If you passed the flag --with-cxx=foo, then it uses that +# particular compiler +# 2. Checks whether the compiler accepts the -g +# ------------------------------------------------------------------ + +AC_DEFUN(LF_CONFIGURE_CXX,[ + AC_PROG_CXX + AC_PROG_CXXCPP + LF_CPP_PORTABILITY +]) + +# ----------------------------------------------------------------------- +# This macro tests the C++ compiler for various portability problem. +# 1. Defines CXX_HAS_NO_BOOL if the compiler does not support the bool +# data type +# 2. Defines CXX_HAS_BUGGY_FOR_LOOPS if the compiler has buggy +# scoping for the for-loop +# 3. Defines USE_ASSERT if the user wants to use assertions +# Seperately we provide some config.h.bot code to be added to acconfig.h +# that implements work-arounds for these problems. +# ----------------------------------------------------------------------- + +dnl ACCONFIG TEMPLATE +dnl #undef CXX_HAS_BUGGY_FOR_LOOPS +dnl #undef CXX_HAS_NO_BOOL +dnl #undef NDEBUG +dnl END ACCONFIG + +AC_DEFUN(LF_CPP_PORTABILITY,[ + + dnl + dnl Check for common C++ portability problems + dnl + + AC_LANG_SAVE + AC_LANG_CPLUSPLUS + + dnl Check whether we have bool + AC_MSG_CHECKING(whether C++ has bool) + AC_TRY_RUN([main() { bool b1=true; bool b2=false; }], + [ AC_MSG_RESULT(yes) ], + [ AC_MSG_RESULT(no) + AC_DEFINE(CXX_HAS_NO_BOOL) ], + [ AC_MSG_WARN(Don't cross-compile)] + ) + + dnl Test whether C++ has buggy for-loops + AC_MSG_CHECKING(whether C++ has buggy scoping in for-loops) + AC_TRY_COMPILE([#include ], [ + for (int i=0;i<10;i++) { } + for (int i=0;i<10;i++) { } +], [ AC_MSG_RESULT(no) ], + [ AC_MSG_RESULT(yes) + AC_DEFINE(CXX_HAS_BUGGY_FOR_LOOPS) ]) + + dnl Test whether the user wants to enable assertions + AC_MSG_CHECKING(whether user wants assertions) + AC_ARG_ENABLE(assert, + [ --disable-assert don't use cpp.h assert], + [ AC_DEFINE(NDEBUG) + AC_MSG_RESULT(no) ], + [ AC_MSG_RESULT(yes) ], + ) + + dnl Done with the portability checks + AC_LANG_RESTORE +]) + +dnl ACCONFIG BOTTOM +dnl +dnl // This file defines portability work-arounds for various proprietory +dnl // C++ compilers +dnl +dnl // Workaround for compilers with buggy for-loop scoping +dnl // That's quite a few compilers actually including recent versions of +dnl // Dec Alpha cxx, HP-UX CC and SGI CC. +dnl // The trivial "if" statement provides the correct scoping to the +dnl // for loop +dnl +dnl #ifdef CXX_HAS_BUGGY_FOR_LOOPS +dnl #undef for +dnl #define for if(1) for +dnl #endif +dnl +dnl // +dnl // Fortran-like integer looping macros +dnl // these critters depend on the scoping work-around above +dnl // +dnl +dnl #define loop(COUNTER,BEGIN,END) \ +dnl for (int COUNTER = BEGIN ; COUNTER <= END ; COUNTER ## ++) +dnl +dnl #define inverse_loop(COUNTER,END,BEGIN) \ +dnl for (int COUNTER = END; COUNTER >= BEGIN; COUNTER ## --) +dnl +dnl #define integer_loop(COUNTER,BEGIN,END,STEP) \ +dnl for (int COUNTER = BEGIN; COUNTER <= END; COUNTER += STEP) +dnl +dnl // +dnl // Class protection levels +dnl // addictive syntactic sugar to make coding nicer +dnl // +dnl +dnl #define pub public: +dnl #define pro protected: +dnl #define pri private: +dnl +dnl // +dnl // Every mathematician would like to know pi +dnl // so this is as good a place as any to throw it in. +dnl // +dnl +dnl #define pi 3.14159265358979324 +dnl +dnl // +dnl // If the C++ compiler we use doesn't have bool, then +dnl // the following is a near-perfect work-around. +dnl // You must make sure your code does not depend on "int" and "bool" +dnl // being two different types, in overloading for instance. +dnl // +dnl +dnl #ifdef CXX_HAS_NO_BOOL +dnl #define bool int +dnl #define true 1 +dnl #define false 0 +dnl #endif +dnl +dnl #include +dnl +dnl END ACCONFIG + + +dnl Autoconf support for C++ +dnl Copyright (C) 1988 Eleftherios Gkioulekas +dnl +dnl This program is free software; you can redistribute it and/or modify +dnl it under the terms of the GNU General Public License as published by +dnl the Free Software Foundation; either version 2 of the License, or +dnl (at your option) any later version. +dnl +dnl This program is distributed in the hope that it will be useful, +dnl but WITHOUT ANY WARRANTY; without even the implied warranty of +dnl MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the +dnl GNU General Public License for more details. +dnl +dnl You should have received a copy of the GNU General Public License +dnl along with this program; if not, write to the Free Software +dnl Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA. +dnl +dnl As a special exception to the GNU General Public License, if you +dnl distribute this file as part of a program that contains a configuration +dnl script generated by Autoconf, you may include it under the same +dnl distribution terms that you use for the rest of that program. + +# ----------------------------------------------------------------------- +# This macro determines hardware-vendor-os information and +# sets the variable ``canonical_host_type'' to that information +# ------------------------------------------------------------------------ + +dnl ACCONFIG TEMPLATE +dnl #undef YOUR_OS +dnl END ACCONFIG + +AC_DEFUN(LF_HOST_TYPE, [ + AC_CANONICAL_HOST + if test -z "$host" + then + host=unknown + fi + canonical_host_type=$host + if test "$host" = unknown + then + AC_MSG_WARN(configuring for unknown system type) + fi + AC_SUBST(canonical_host_type) + AC_DEFINE_UNQUOTED(YOUR_OS,"$canonical_host_type") +]) + +dnl Copyright (C) 1988 Eleftherios Gkioulekas +dnl +dnl This program is free software; you can redistribute it and/or modify +dnl it under the terms of the GNU General Public License as published by +dnl the Free Software Foundation; either version 2 of the License, or +dnl (at your option) any later version. +dnl +dnl This program is distributed in the hope that it will be useful, +dnl but WITHOUT ANY WARRANTY; without even the implied warranty of +dnl MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the +dnl GNU General Public License for more details. +dnl +dnl You should have received a copy of the GNU General Public License +dnl along with this program; if not, write to the Free Software +dnl Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA. +dnl +dnl As a special exception to the GNU General Public License, if you +dnl distribute this file as part of a program that contains a configuration +dnl script generated by Autoconf, you may include it under the same +dnl distribution terms that you use for the rest of that program. + +# -------------------------------------------------------------------------- +# Check whether the C++ compiler accepts a certain flag +# If it does it adds the flag to CXXFLAGS +# If it does not then it returns an error to lf_ok +# Usage: +# LF_CHECK_CXX_FLAG(-flag1 -flag2 -flag3 ...) +# ------------------------------------------------------------------------- + +AC_DEFUN(LF_CHECK_CXX_FLAG,[ + echo 'void f(){}' > conftest.cc + for i in $1 + do + AC_MSG_CHECKING([whether $CXX accepts $i]) + if test -z "`${CXX} $i -c conftest.cc 2>&1`" + then + CXXFLAGS="${CXXFLAGS} $i" + AC_MSG_RESULT(yes) + else + AC_MSG_RESULT(no) + fi + done + rm -f conftest.cc conftest.o +]) + +# -------------------------------------------------------------------------- +# Check whether the C compiler accepts a certain flag +# If it does it adds the flag to CFLAGS +# If it does not then it returns an error to lf_ok +# Usage: +# LF_CHECK_CC_FLAG(-flag1 -flag2 -flag3 ...) +# ------------------------------------------------------------------------- + +AC_DEFUN(LF_CHECK_CC_FLAG,[ + echo 'void f(){}' > conftest.c + for i in $1 + do + AC_MSG_CHECKING([whether $CC accepts $i]) + if test -z "`${CC} $i -c conftest.c 2>&1`" + then + CFLAGS="${CFLAGS} $i" + AC_MSG_RESULT(yes) + else + AC_MSG_RESULT(no) + fi + done + rm -f conftest.c conftest.o +]) + +# -------------------------------------------------------------------------- +# Check whether the Fortran compiler accepts a certain flag +# If it does it adds the flag to FFLAGS +# If it does not then it returns an error to lf_ok +# Usage: +# LF_CHECK_F77_FLAG(-flag1 -flag2 -flag3 ...) +# ------------------------------------------------------------------------- + +AC_DEFUN(LF_CHECK_F77_FLAG,[ + cat << EOF > conftest.f +c....:++++++++++++++++++++++++ + PROGRAM MAIN + PRINT*,'Hello World!' + END +EOF + for i in $1 + do + AC_MSG_CHECKING([whether $F77 accepts $i]) + if test -z "`${F77} $i -c conftest.f 2>&1`" + then + FFLAGS="${FFLAGS} $i" + AC_MSG_RESULT(yes) + else + AC_MSG_RESULT(no) + fi + done + rm -f conftest.f conftest.o +]) + +# ---------------------------------------------------------------------- +# Provide the configure script with an --with-warnings option that +# turns on warnings. Call this command AFTER you have configured ALL your +# compilers. +# ---------------------------------------------------------------------- + +AC_DEFUN(LF_SET_WARNINGS,[ + dnl Check for --with-warnings + AC_MSG_CHECKING([whether user wants warnings]) + AC_ARG_WITH(warnings, + [ --with-warnings Turn on warnings], + [ lf_warnings=yes ], [ lf_warnings=no ]) + AC_MSG_RESULT($lf_warnings) + + dnl Warnings for the two main compilers + cc_warning_flags="-Wall" + cxx_warning_flags="-Wall -Woverloaded-virtual -Wtemplate-debugging" + if test $lf_warnings = yes + then + if test -n "${CC}" + then + LF_CHECK_CC_FLAG($cc_warning_flags) + fi + if test -n "${CXX}" + then + LF_CHECK_CXX_FLAG($cxx_warning_flags) + fi + fi +]) + +# Copyright (C) 2002, 2003, 2005, 2006, 2007 Free Software Foundation, Inc. +# +# This file is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# AM_AUTOMAKE_VERSION(VERSION) +# ---------------------------- +# Automake X.Y traces this macro to ensure aclocal.m4 has been +# generated from the m4 files accompanying Automake X.Y. +# (This private macro should not be called outside this file.) +AC_DEFUN([AM_AUTOMAKE_VERSION], +[am__api_version='1.10' +dnl Some users find AM_AUTOMAKE_VERSION and mistake it for a way to +dnl require some minimum version. Point them to the right macro. +m4_if([$1], [1.10.1], [], + [AC_FATAL([Do not call $0, use AM_INIT_AUTOMAKE([$1]).])])dnl +]) + +# _AM_AUTOCONF_VERSION(VERSION) +# ----------------------------- +# aclocal traces this macro to find the Autoconf version. +# This is a private macro too. Using m4_define simplifies +# the logic in aclocal, which can simply ignore this definition. +m4_define([_AM_AUTOCONF_VERSION], []) + +# AM_SET_CURRENT_AUTOMAKE_VERSION +# ------------------------------- +# Call AM_AUTOMAKE_VERSION and AM_AUTOMAKE_VERSION so they can be traced. +# This function is AC_REQUIREd by AC_INIT_AUTOMAKE. +AC_DEFUN([AM_SET_CURRENT_AUTOMAKE_VERSION], +[AM_AUTOMAKE_VERSION([1.10.1])dnl +m4_ifndef([AC_AUTOCONF_VERSION], + [m4_copy([m4_PACKAGE_VERSION], [AC_AUTOCONF_VERSION])])dnl +_AM_AUTOCONF_VERSION(AC_AUTOCONF_VERSION)]) + +# AM_AUX_DIR_EXPAND -*- Autoconf -*- + +# Copyright (C) 2001, 2003, 2005 Free Software Foundation, Inc. +# +# This file is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# For projects using AC_CONFIG_AUX_DIR([foo]), Autoconf sets +# $ac_aux_dir to `$srcdir/foo'. In other projects, it is set to +# `$srcdir', `$srcdir/..', or `$srcdir/../..'. +# +# Of course, Automake must honor this variable whenever it calls a +# tool from the auxiliary directory. The problem is that $srcdir (and +# therefore $ac_aux_dir as well) can be either absolute or relative, +# depending on how configure is run. This is pretty annoying, since +# it makes $ac_aux_dir quite unusable in subdirectories: in the top +# source directory, any form will work fine, but in subdirectories a +# relative path needs to be adjusted first. +# +# $ac_aux_dir/missing +# fails when called from a subdirectory if $ac_aux_dir is relative +# $top_srcdir/$ac_aux_dir/missing +# fails if $ac_aux_dir is absolute, +# fails when called from a subdirectory in a VPATH build with +# a relative $ac_aux_dir +# +# The reason of the latter failure is that $top_srcdir and $ac_aux_dir +# are both prefixed by $srcdir. In an in-source build this is usually +# harmless because $srcdir is `.', but things will broke when you +# start a VPATH build or use an absolute $srcdir. +# +# So we could use something similar to $top_srcdir/$ac_aux_dir/missing, +# iff we strip the leading $srcdir from $ac_aux_dir. That would be: +# am_aux_dir='\$(top_srcdir)/'`expr "$ac_aux_dir" : "$srcdir//*\(.*\)"` +# and then we would define $MISSING as +# MISSING="\${SHELL} $am_aux_dir/missing" +# This will work as long as MISSING is not called from configure, because +# unfortunately $(top_srcdir) has no meaning in configure. +# However there are other variables, like CC, which are often used in +# configure, and could therefore not use this "fixed" $ac_aux_dir. +# +# Another solution, used here, is to always expand $ac_aux_dir to an +# absolute PATH. The drawback is that using absolute paths prevent a +# configured tree to be moved without reconfiguration. + +AC_DEFUN([AM_AUX_DIR_EXPAND], +[dnl Rely on autoconf to set up CDPATH properly. +AC_PREREQ([2.50])dnl +# expand $ac_aux_dir to an absolute path +am_aux_dir=`cd $ac_aux_dir && pwd` +]) + +# AM_CONDITIONAL -*- Autoconf -*- + +# Copyright (C) 1997, 2000, 2001, 2003, 2004, 2005, 2006 +# Free Software Foundation, Inc. +# +# This file is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# serial 8 + +# AM_CONDITIONAL(NAME, SHELL-CONDITION) +# ------------------------------------- +# Define a conditional. +AC_DEFUN([AM_CONDITIONAL], +[AC_PREREQ(2.52)dnl + ifelse([$1], [TRUE], [AC_FATAL([$0: invalid condition: $1])], + [$1], [FALSE], [AC_FATAL([$0: invalid condition: $1])])dnl +AC_SUBST([$1_TRUE])dnl +AC_SUBST([$1_FALSE])dnl +_AM_SUBST_NOTMAKE([$1_TRUE])dnl +_AM_SUBST_NOTMAKE([$1_FALSE])dnl +if $2; then + $1_TRUE= + $1_FALSE='#' +else + $1_TRUE='#' + $1_FALSE= +fi +AC_CONFIG_COMMANDS_PRE( +[if test -z "${$1_TRUE}" && test -z "${$1_FALSE}"; then + AC_MSG_ERROR([[conditional "$1" was never defined. +Usually this means the macro was only invoked conditionally.]]) +fi])]) + +# Copyright (C) 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006 +# Free Software Foundation, Inc. +# +# This file is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# serial 9 + +# There are a few dirty hacks below to avoid letting `AC_PROG_CC' be +# written in clear, in which case automake, when reading aclocal.m4, +# will think it sees a *use*, and therefore will trigger all it's +# C support machinery. Also note that it means that autoscan, seeing +# CC etc. in the Makefile, will ask for an AC_PROG_CC use... + + +# _AM_DEPENDENCIES(NAME) +# ---------------------- +# See how the compiler implements dependency checking. +# NAME is "CC", "CXX", "GCJ", or "OBJC". +# We try a few techniques and use that to set a single cache variable. +# +# We don't AC_REQUIRE the corresponding AC_PROG_CC since the latter was +# modified to invoke _AM_DEPENDENCIES(CC); we would have a circular +# dependency, and given that the user is not expected to run this macro, +# just rely on AC_PROG_CC. +AC_DEFUN([_AM_DEPENDENCIES], +[AC_REQUIRE([AM_SET_DEPDIR])dnl +AC_REQUIRE([AM_OUTPUT_DEPENDENCY_COMMANDS])dnl +AC_REQUIRE([AM_MAKE_INCLUDE])dnl +AC_REQUIRE([AM_DEP_TRACK])dnl + +ifelse([$1], CC, [depcc="$CC" am_compiler_list=], + [$1], CXX, [depcc="$CXX" am_compiler_list=], + [$1], OBJC, [depcc="$OBJC" am_compiler_list='gcc3 gcc'], + [$1], UPC, [depcc="$UPC" am_compiler_list=], + [$1], GCJ, [depcc="$GCJ" am_compiler_list='gcc3 gcc'], + [depcc="$$1" am_compiler_list=]) + +AC_CACHE_CHECK([dependency style of $depcc], + [am_cv_$1_dependencies_compiler_type], +[if test -z "$AMDEP_TRUE" && test -f "$am_depcomp"; then + # We make a subdir and do the tests there. Otherwise we can end up + # making bogus files that we don't know about and never remove. For + # instance it was reported that on HP-UX the gcc test will end up + # making a dummy file named `D' -- because `-MD' means `put the output + # in D'. + mkdir conftest.dir + # Copy depcomp to subdir because otherwise we won't find it if we're + # using a relative directory. + cp "$am_depcomp" conftest.dir + cd conftest.dir + # We will build objects and dependencies in a subdirectory because + # it helps to detect inapplicable dependency modes. For instance + # both Tru64's cc and ICC support -MD to output dependencies as a + # side effect of compilation, but ICC will put the dependencies in + # the current directory while Tru64 will put them in the object + # directory. + mkdir sub + + am_cv_$1_dependencies_compiler_type=none + if test "$am_compiler_list" = ""; then + am_compiler_list=`sed -n ['s/^#*\([a-zA-Z0-9]*\))$/\1/p'] < ./depcomp` + fi + for depmode in $am_compiler_list; do + # Setup a source with many dependencies, because some compilers + # like to wrap large dependency lists on column 80 (with \), and + # we should not choose a depcomp mode which is confused by this. + # + # We need to recreate these files for each test, as the compiler may + # overwrite some of them when testing with obscure command lines. + # This happens at least with the AIX C compiler. + : > sub/conftest.c + for i in 1 2 3 4 5 6; do + echo '#include "conftst'$i'.h"' >> sub/conftest.c + # Using `: > sub/conftst$i.h' creates only sub/conftst1.h with + # Solaris 8's {/usr,}/bin/sh. + touch sub/conftst$i.h + done + echo "${am__include} ${am__quote}sub/conftest.Po${am__quote}" > confmf + + case $depmode in + nosideeffect) + # after this tag, mechanisms are not by side-effect, so they'll + # only be used when explicitly requested + if test "x$enable_dependency_tracking" = xyes; then + continue + else + break + fi + ;; + none) break ;; + esac + # We check with `-c' and `-o' for the sake of the "dashmstdout" + # mode. It turns out that the SunPro C++ compiler does not properly + # handle `-M -o', and we need to detect this. + if depmode=$depmode \ + source=sub/conftest.c object=sub/conftest.${OBJEXT-o} \ + depfile=sub/conftest.Po tmpdepfile=sub/conftest.TPo \ + $SHELL ./depcomp $depcc -c -o sub/conftest.${OBJEXT-o} sub/conftest.c \ + >/dev/null 2>conftest.err && + grep sub/conftst1.h sub/conftest.Po > /dev/null 2>&1 && + grep sub/conftst6.h sub/conftest.Po > /dev/null 2>&1 && + grep sub/conftest.${OBJEXT-o} sub/conftest.Po > /dev/null 2>&1 && + ${MAKE-make} -s -f confmf > /dev/null 2>&1; then + # icc doesn't choke on unknown options, it will just issue warnings + # or remarks (even with -Werror). So we grep stderr for any message + # that says an option was ignored or not supported. + # When given -MP, icc 7.0 and 7.1 complain thusly: + # icc: Command line warning: ignoring option '-M'; no argument required + # The diagnosis changed in icc 8.0: + # icc: Command line remark: option '-MP' not supported + if (grep 'ignoring option' conftest.err || + grep 'not supported' conftest.err) >/dev/null 2>&1; then :; else + am_cv_$1_dependencies_compiler_type=$depmode + break + fi + fi + done + + cd .. + rm -rf conftest.dir +else + am_cv_$1_dependencies_compiler_type=none +fi +]) +AC_SUBST([$1DEPMODE], [depmode=$am_cv_$1_dependencies_compiler_type]) +AM_CONDITIONAL([am__fastdep$1], [ + test "x$enable_dependency_tracking" != xno \ + && test "$am_cv_$1_dependencies_compiler_type" = gcc3]) +]) + + +# AM_SET_DEPDIR +# ------------- +# Choose a directory name for dependency files. +# This macro is AC_REQUIREd in _AM_DEPENDENCIES +AC_DEFUN([AM_SET_DEPDIR], +[AC_REQUIRE([AM_SET_LEADING_DOT])dnl +AC_SUBST([DEPDIR], ["${am__leading_dot}deps"])dnl +]) + + +# AM_DEP_TRACK +# ------------ +AC_DEFUN([AM_DEP_TRACK], +[AC_ARG_ENABLE(dependency-tracking, +[ --disable-dependency-tracking speeds up one-time build + --enable-dependency-tracking do not reject slow dependency extractors]) +if test "x$enable_dependency_tracking" != xno; then + am_depcomp="$ac_aux_dir/depcomp" + AMDEPBACKSLASH='\' +fi +AM_CONDITIONAL([AMDEP], [test "x$enable_dependency_tracking" != xno]) +AC_SUBST([AMDEPBACKSLASH])dnl +_AM_SUBST_NOTMAKE([AMDEPBACKSLASH])dnl +]) + +# Generate code to set up dependency tracking. -*- Autoconf -*- + +# Copyright (C) 1999, 2000, 2001, 2002, 2003, 2004, 2005 +# Free Software Foundation, Inc. +# +# This file is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +#serial 3 + +# _AM_OUTPUT_DEPENDENCY_COMMANDS +# ------------------------------ +AC_DEFUN([_AM_OUTPUT_DEPENDENCY_COMMANDS], +[for mf in $CONFIG_FILES; do + # Strip MF so we end up with the name of the file. + mf=`echo "$mf" | sed -e 's/:.*$//'` + # Check whether this is an Automake generated Makefile or not. + # We used to match only the files named `Makefile.in', but + # some people rename them; so instead we look at the file content. + # Grep'ing the first line is not enough: some people post-process + # each Makefile.in and add a new line on top of each file to say so. + # Grep'ing the whole file is not good either: AIX grep has a line + # limit of 2048, but all sed's we know have understand at least 4000. + if sed -n 's,^#.*generated by automake.*,X,p' "$mf" | grep X >/dev/null 2>&1; then + dirpart=`AS_DIRNAME("$mf")` + else + continue + fi + # Extract the definition of DEPDIR, am__include, and am__quote + # from the Makefile without running `make'. + DEPDIR=`sed -n 's/^DEPDIR = //p' < "$mf"` + test -z "$DEPDIR" && continue + am__include=`sed -n 's/^am__include = //p' < "$mf"` + test -z "am__include" && continue + am__quote=`sed -n 's/^am__quote = //p' < "$mf"` + # When using ansi2knr, U may be empty or an underscore; expand it + U=`sed -n 's/^U = //p' < "$mf"` + # Find all dependency output files, they are included files with + # $(DEPDIR) in their names. We invoke sed twice because it is the + # simplest approach to changing $(DEPDIR) to its actual value in the + # expansion. + for file in `sed -n " + s/^$am__include $am__quote\(.*(DEPDIR).*\)$am__quote"'$/\1/p' <"$mf" | \ + sed -e 's/\$(DEPDIR)/'"$DEPDIR"'/g' -e 's/\$U/'"$U"'/g'`; do + # Make sure the directory exists. + test -f "$dirpart/$file" && continue + fdir=`AS_DIRNAME(["$file"])` + AS_MKDIR_P([$dirpart/$fdir]) + # echo "creating $dirpart/$file" + echo '# dummy' > "$dirpart/$file" + done +done +])# _AM_OUTPUT_DEPENDENCY_COMMANDS + + +# AM_OUTPUT_DEPENDENCY_COMMANDS +# ----------------------------- +# This macro should only be invoked once -- use via AC_REQUIRE. +# +# This code is only required when automatic dependency tracking +# is enabled. FIXME. This creates each `.P' file that we will +# need in order to bootstrap the dependency handling code. +AC_DEFUN([AM_OUTPUT_DEPENDENCY_COMMANDS], +[AC_CONFIG_COMMANDS([depfiles], + [test x"$AMDEP_TRUE" != x"" || _AM_OUTPUT_DEPENDENCY_COMMANDS], + [AMDEP_TRUE="$AMDEP_TRUE" ac_aux_dir="$ac_aux_dir"]) +]) + +# Copyright (C) 1996, 1997, 2000, 2001, 2003, 2005 +# Free Software Foundation, Inc. +# +# This file is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# serial 8 + +# AM_CONFIG_HEADER is obsolete. It has been replaced by AC_CONFIG_HEADERS. +AU_DEFUN([AM_CONFIG_HEADER], [AC_CONFIG_HEADERS($@)]) + +# Do all the work for Automake. -*- Autoconf -*- + +# Copyright (C) 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, +# 2005, 2006, 2008 Free Software Foundation, Inc. +# +# This file is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# serial 13 + +# This macro actually does too much. Some checks are only needed if +# your package does certain things. But this isn't really a big deal. + +# AM_INIT_AUTOMAKE(PACKAGE, VERSION, [NO-DEFINE]) +# AM_INIT_AUTOMAKE([OPTIONS]) +# ----------------------------------------------- +# The call with PACKAGE and VERSION arguments is the old style +# call (pre autoconf-2.50), which is being phased out. PACKAGE +# and VERSION should now be passed to AC_INIT and removed from +# the call to AM_INIT_AUTOMAKE. +# We support both call styles for the transition. After +# the next Automake release, Autoconf can make the AC_INIT +# arguments mandatory, and then we can depend on a new Autoconf +# release and drop the old call support. +AC_DEFUN([AM_INIT_AUTOMAKE], +[AC_PREREQ([2.60])dnl +dnl Autoconf wants to disallow AM_ names. We explicitly allow +dnl the ones we care about. +m4_pattern_allow([^AM_[A-Z]+FLAGS$])dnl +AC_REQUIRE([AM_SET_CURRENT_AUTOMAKE_VERSION])dnl +AC_REQUIRE([AC_PROG_INSTALL])dnl +if test "`cd $srcdir && pwd`" != "`pwd`"; then + # Use -I$(srcdir) only when $(srcdir) != ., so that make's output + # is not polluted with repeated "-I." + AC_SUBST([am__isrc], [' -I$(srcdir)'])_AM_SUBST_NOTMAKE([am__isrc])dnl + # test to see if srcdir already configured + if test -f $srcdir/config.status; then + AC_MSG_ERROR([source directory already configured; run "make distclean" there first]) + fi +fi + +# test whether we have cygpath +if test -z "$CYGPATH_W"; then + if (cygpath --version) >/dev/null 2>/dev/null; then + CYGPATH_W='cygpath -w' + else + CYGPATH_W=echo + fi +fi +AC_SUBST([CYGPATH_W]) + +# Define the identity of the package. +dnl Distinguish between old-style and new-style calls. +m4_ifval([$2], +[m4_ifval([$3], [_AM_SET_OPTION([no-define])])dnl + AC_SUBST([PACKAGE], [$1])dnl + AC_SUBST([VERSION], [$2])], +[_AM_SET_OPTIONS([$1])dnl +dnl Diagnose old-style AC_INIT with new-style AM_AUTOMAKE_INIT. +m4_if(m4_ifdef([AC_PACKAGE_NAME], 1)m4_ifdef([AC_PACKAGE_VERSION], 1), 11,, + [m4_fatal([AC_INIT should be called with package and version arguments])])dnl + AC_SUBST([PACKAGE], ['AC_PACKAGE_TARNAME'])dnl + AC_SUBST([VERSION], ['AC_PACKAGE_VERSION'])])dnl + +_AM_IF_OPTION([no-define],, +[AC_DEFINE_UNQUOTED(PACKAGE, "$PACKAGE", [Name of package]) + AC_DEFINE_UNQUOTED(VERSION, "$VERSION", [Version number of package])])dnl + +# Some tools Automake needs. +AC_REQUIRE([AM_SANITY_CHECK])dnl +AC_REQUIRE([AC_ARG_PROGRAM])dnl +AM_MISSING_PROG(ACLOCAL, aclocal-${am__api_version}) +AM_MISSING_PROG(AUTOCONF, autoconf) +AM_MISSING_PROG(AUTOMAKE, automake-${am__api_version}) +AM_MISSING_PROG(AUTOHEADER, autoheader) +AM_MISSING_PROG(MAKEINFO, makeinfo) +AM_PROG_INSTALL_SH +AM_PROG_INSTALL_STRIP +AC_REQUIRE([AM_PROG_MKDIR_P])dnl +# We need awk for the "check" target. The system "awk" is bad on +# some platforms. +AC_REQUIRE([AC_PROG_AWK])dnl +AC_REQUIRE([AC_PROG_MAKE_SET])dnl +AC_REQUIRE([AM_SET_LEADING_DOT])dnl +_AM_IF_OPTION([tar-ustar], [_AM_PROG_TAR([ustar])], + [_AM_IF_OPTION([tar-pax], [_AM_PROG_TAR([pax])], + [_AM_PROG_TAR([v7])])]) +_AM_IF_OPTION([no-dependencies],, +[AC_PROVIDE_IFELSE([AC_PROG_CC], + [_AM_DEPENDENCIES(CC)], + [define([AC_PROG_CC], + defn([AC_PROG_CC])[_AM_DEPENDENCIES(CC)])])dnl +AC_PROVIDE_IFELSE([AC_PROG_CXX], + [_AM_DEPENDENCIES(CXX)], + [define([AC_PROG_CXX], + defn([AC_PROG_CXX])[_AM_DEPENDENCIES(CXX)])])dnl +AC_PROVIDE_IFELSE([AC_PROG_OBJC], + [_AM_DEPENDENCIES(OBJC)], + [define([AC_PROG_OBJC], + defn([AC_PROG_OBJC])[_AM_DEPENDENCIES(OBJC)])])dnl +]) +]) + + +# When config.status generates a header, we must update the stamp-h file. +# This file resides in the same directory as the config header +# that is generated. The stamp files are numbered to have different names. + +# Autoconf calls _AC_AM_CONFIG_HEADER_HOOK (when defined) in the +# loop where config.status creates the headers, so we can generate +# our stamp files there. +AC_DEFUN([_AC_AM_CONFIG_HEADER_HOOK], +[# Compute $1's index in $config_headers. +_am_arg=$1 +_am_stamp_count=1 +for _am_header in $config_headers :; do + case $_am_header in + $_am_arg | $_am_arg:* ) + break ;; + * ) + _am_stamp_count=`expr $_am_stamp_count + 1` ;; + esac +done +echo "timestamp for $_am_arg" >`AS_DIRNAME(["$_am_arg"])`/stamp-h[]$_am_stamp_count]) + +# Copyright (C) 2001, 2003, 2005 Free Software Foundation, Inc. +# +# This file is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# AM_PROG_INSTALL_SH +# ------------------ +# Define $install_sh. +AC_DEFUN([AM_PROG_INSTALL_SH], +[AC_REQUIRE([AM_AUX_DIR_EXPAND])dnl +install_sh=${install_sh-"\$(SHELL) $am_aux_dir/install-sh"} +AC_SUBST(install_sh)]) + +# Copyright (C) 2003, 2005 Free Software Foundation, Inc. +# +# This file is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# serial 2 + +# Check whether the underlying file-system supports filenames +# with a leading dot. For instance MS-DOS doesn't. +AC_DEFUN([AM_SET_LEADING_DOT], +[rm -rf .tst 2>/dev/null +mkdir .tst 2>/dev/null +if test -d .tst; then + am__leading_dot=. +else + am__leading_dot=_ +fi +rmdir .tst 2>/dev/null +AC_SUBST([am__leading_dot])]) + +# Check to see how 'make' treats includes. -*- Autoconf -*- + +# Copyright (C) 2001, 2002, 2003, 2005 Free Software Foundation, Inc. +# +# This file is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# serial 3 + +# AM_MAKE_INCLUDE() +# ----------------- +# Check to see how make treats includes. +AC_DEFUN([AM_MAKE_INCLUDE], +[am_make=${MAKE-make} +cat > confinc << 'END' +am__doit: + @echo done +.PHONY: am__doit +END +# If we don't find an include directive, just comment out the code. +AC_MSG_CHECKING([for style of include used by $am_make]) +am__include="#" +am__quote= +_am_result=none +# First try GNU make style include. +echo "include confinc" > confmf +# We grep out `Entering directory' and `Leaving directory' +# messages which can occur if `w' ends up in MAKEFLAGS. +# In particular we don't look at `^make:' because GNU make might +# be invoked under some other name (usually "gmake"), in which +# case it prints its new name instead of `make'. +if test "`$am_make -s -f confmf 2> /dev/null | grep -v 'ing directory'`" = "done"; then + am__include=include + am__quote= + _am_result=GNU +fi +# Now try BSD make style include. +if test "$am__include" = "#"; then + echo '.include "confinc"' > confmf + if test "`$am_make -s -f confmf 2> /dev/null`" = "done"; then + am__include=.include + am__quote="\"" + _am_result=BSD + fi +fi +AC_SUBST([am__include]) +AC_SUBST([am__quote]) +AC_MSG_RESULT([$_am_result]) +rm -f confinc confmf +]) + +# Fake the existence of programs that GNU maintainers use. -*- Autoconf -*- + +# Copyright (C) 1997, 1999, 2000, 2001, 2003, 2004, 2005 +# Free Software Foundation, Inc. +# +# This file is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# serial 5 + +# AM_MISSING_PROG(NAME, PROGRAM) +# ------------------------------ +AC_DEFUN([AM_MISSING_PROG], +[AC_REQUIRE([AM_MISSING_HAS_RUN]) +$1=${$1-"${am_missing_run}$2"} +AC_SUBST($1)]) + + +# AM_MISSING_HAS_RUN +# ------------------ +# Define MISSING if not defined so far and test if it supports --run. +# If it does, set am_missing_run to use it, otherwise, to nothing. +AC_DEFUN([AM_MISSING_HAS_RUN], +[AC_REQUIRE([AM_AUX_DIR_EXPAND])dnl +AC_REQUIRE_AUX_FILE([missing])dnl +test x"${MISSING+set}" = xset || MISSING="\${SHELL} $am_aux_dir/missing" +# Use eval to expand $SHELL +if eval "$MISSING --run true"; then + am_missing_run="$MISSING --run " +else + am_missing_run= + AC_MSG_WARN([`missing' script is too old or missing]) +fi +]) + +# Copyright (C) 2003, 2004, 2005, 2006 Free Software Foundation, Inc. +# +# This file is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# AM_PROG_MKDIR_P +# --------------- +# Check for `mkdir -p'. +AC_DEFUN([AM_PROG_MKDIR_P], +[AC_PREREQ([2.60])dnl +AC_REQUIRE([AC_PROG_MKDIR_P])dnl +dnl Automake 1.8 to 1.9.6 used to define mkdir_p. We now use MKDIR_P, +dnl while keeping a definition of mkdir_p for backward compatibility. +dnl @MKDIR_P@ is magic: AC_OUTPUT adjusts its value for each Makefile. +dnl However we cannot define mkdir_p as $(MKDIR_P) for the sake of +dnl Makefile.ins that do not define MKDIR_P, so we do our own +dnl adjustment using top_builddir (which is defined more often than +dnl MKDIR_P). +AC_SUBST([mkdir_p], ["$MKDIR_P"])dnl +case $mkdir_p in + [[\\/$]]* | ?:[[\\/]]*) ;; + */*) mkdir_p="\$(top_builddir)/$mkdir_p" ;; +esac +]) + +# Helper functions for option handling. -*- Autoconf -*- + +# Copyright (C) 2001, 2002, 2003, 2005 Free Software Foundation, Inc. +# +# This file is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# serial 3 + +# _AM_MANGLE_OPTION(NAME) +# ----------------------- +AC_DEFUN([_AM_MANGLE_OPTION], +[[_AM_OPTION_]m4_bpatsubst($1, [[^a-zA-Z0-9_]], [_])]) + +# _AM_SET_OPTION(NAME) +# ------------------------------ +# Set option NAME. Presently that only means defining a flag for this option. +AC_DEFUN([_AM_SET_OPTION], +[m4_define(_AM_MANGLE_OPTION([$1]), 1)]) + +# _AM_SET_OPTIONS(OPTIONS) +# ---------------------------------- +# OPTIONS is a space-separated list of Automake options. +AC_DEFUN([_AM_SET_OPTIONS], +[AC_FOREACH([_AM_Option], [$1], [_AM_SET_OPTION(_AM_Option)])]) + +# _AM_IF_OPTION(OPTION, IF-SET, [IF-NOT-SET]) +# ------------------------------------------- +# Execute IF-SET if OPTION is set, IF-NOT-SET otherwise. +AC_DEFUN([_AM_IF_OPTION], +[m4_ifset(_AM_MANGLE_OPTION([$1]), [$2], [$3])]) + +# Check to make sure that the build environment is sane. -*- Autoconf -*- + +# Copyright (C) 1996, 1997, 2000, 2001, 2003, 2005 +# Free Software Foundation, Inc. +# +# This file is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# serial 4 + +# AM_SANITY_CHECK +# --------------- +AC_DEFUN([AM_SANITY_CHECK], +[AC_MSG_CHECKING([whether build environment is sane]) +# Just in case +sleep 1 +echo timestamp > conftest.file +# Do `set' in a subshell so we don't clobber the current shell's +# arguments. Must try -L first in case configure is actually a +# symlink; some systems play weird games with the mod time of symlinks +# (eg FreeBSD returns the mod time of the symlink's containing +# directory). +if ( + set X `ls -Lt $srcdir/configure conftest.file 2> /dev/null` + if test "$[*]" = "X"; then + # -L didn't work. + set X `ls -t $srcdir/configure conftest.file` + fi + rm -f conftest.file + if test "$[*]" != "X $srcdir/configure conftest.file" \ + && test "$[*]" != "X conftest.file $srcdir/configure"; then + + # If neither matched, then we have a broken ls. This can happen + # if, for instance, CONFIG_SHELL is bash and it inherits a + # broken ls alias from the environment. This has actually + # happened. Such a system could not be considered "sane". + AC_MSG_ERROR([ls -t appears to fail. Make sure there is not a broken +alias in your environment]) + fi + + test "$[2]" = conftest.file + ) +then + # Ok. + : +else + AC_MSG_ERROR([newly created file is older than distributed files! +Check your system clock]) +fi +AC_MSG_RESULT(yes)]) + +# Copyright (C) 2001, 2003, 2005 Free Software Foundation, Inc. +# +# This file is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# AM_PROG_INSTALL_STRIP +# --------------------- +# One issue with vendor `install' (even GNU) is that you can't +# specify the program used to strip binaries. This is especially +# annoying in cross-compiling environments, where the build's strip +# is unlikely to handle the host's binaries. +# Fortunately install-sh will honor a STRIPPROG variable, so we +# always use install-sh in `make install-strip', and initialize +# STRIPPROG with the value of the STRIP variable (set by the user). +AC_DEFUN([AM_PROG_INSTALL_STRIP], +[AC_REQUIRE([AM_PROG_INSTALL_SH])dnl +# Installed binaries are usually stripped using `strip' when the user +# run `make install-strip'. However `strip' might not be the right +# tool to use in cross-compilation environments, therefore Automake +# will honor the `STRIP' environment variable to overrule this program. +dnl Don't test for $cross_compiling = yes, because it might be `maybe'. +if test "$cross_compiling" != no; then + AC_CHECK_TOOL([STRIP], [strip], :) +fi +INSTALL_STRIP_PROGRAM="\$(install_sh) -c -s" +AC_SUBST([INSTALL_STRIP_PROGRAM])]) + +# Copyright (C) 2006 Free Software Foundation, Inc. +# +# This file is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# _AM_SUBST_NOTMAKE(VARIABLE) +# --------------------------- +# Prevent Automake from outputting VARIABLE = @VARIABLE@ in Makefile.in. +# This macro is traced by Automake. +AC_DEFUN([_AM_SUBST_NOTMAKE]) + +# Check how to create a tarball. -*- Autoconf -*- + +# Copyright (C) 2004, 2005 Free Software Foundation, Inc. +# +# This file is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# serial 2 + +# _AM_PROG_TAR(FORMAT) +# -------------------- +# Check how to create a tarball in format FORMAT. +# FORMAT should be one of `v7', `ustar', or `pax'. +# +# Substitute a variable $(am__tar) that is a command +# writing to stdout a FORMAT-tarball containing the directory +# $tardir. +# tardir=directory && $(am__tar) > result.tar +# +# Substitute a variable $(am__untar) that extract such +# a tarball read from stdin. +# $(am__untar) < result.tar +AC_DEFUN([_AM_PROG_TAR], +[# Always define AMTAR for backward compatibility. +AM_MISSING_PROG([AMTAR], [tar]) +m4_if([$1], [v7], + [am__tar='${AMTAR} chof - "$$tardir"'; am__untar='${AMTAR} xf -'], + [m4_case([$1], [ustar],, [pax],, + [m4_fatal([Unknown tar format])]) +AC_MSG_CHECKING([how to create a $1 tar archive]) +# Loop over all known methods to create a tar archive until one works. +_am_tools='gnutar m4_if([$1], [ustar], [plaintar]) pax cpio none' +_am_tools=${am_cv_prog_tar_$1-$_am_tools} +# Do not fold the above two line into one, because Tru64 sh and +# Solaris sh will not grok spaces in the rhs of `-'. +for _am_tool in $_am_tools +do + case $_am_tool in + gnutar) + for _am_tar in tar gnutar gtar; + do + AM_RUN_LOG([$_am_tar --version]) && break + done + am__tar="$_am_tar --format=m4_if([$1], [pax], [posix], [$1]) -chf - "'"$$tardir"' + am__tar_="$_am_tar --format=m4_if([$1], [pax], [posix], [$1]) -chf - "'"$tardir"' + am__untar="$_am_tar -xf -" + ;; + plaintar) + # Must skip GNU tar: if it does not support --format= it doesn't create + # ustar tarball either. + (tar --version) >/dev/null 2>&1 && continue + am__tar='tar chf - "$$tardir"' + am__tar_='tar chf - "$tardir"' + am__untar='tar xf -' + ;; + pax) + am__tar='pax -L -x $1 -w "$$tardir"' + am__tar_='pax -L -x $1 -w "$tardir"' + am__untar='pax -r' + ;; + cpio) + am__tar='find "$$tardir" -print | cpio -o -H $1 -L' + am__tar_='find "$tardir" -print | cpio -o -H $1 -L' + am__untar='cpio -i -H $1 -d' + ;; + none) + am__tar=false + am__tar_=false + am__untar=false + ;; + esac + + # If the value was cached, stop now. We just wanted to have am__tar + # and am__untar set. + test -n "${am_cv_prog_tar_$1}" && break + + # tar/untar a dummy directory, and stop if the command works + rm -rf conftest.dir + mkdir conftest.dir + echo GrepMe > conftest.dir/file + AM_RUN_LOG([tardir=conftest.dir && eval $am__tar_ >conftest.tar]) + rm -rf conftest.dir + if test -s conftest.tar; then + AM_RUN_LOG([$am__untar /dev/null 2>&1 && break + fi +done +rm -rf conftest.dir + +AC_CACHE_VAL([am_cv_prog_tar_$1], [am_cv_prog_tar_$1=$_am_tool]) +AC_MSG_RESULT([$am_cv_prog_tar_$1])]) +AC_SUBST([am__tar]) +AC_SUBST([am__untar]) +]) # _AM_PROG_TAR + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/config.h.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/config.h.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,81 @@ +/* config.h.in. Generated from configure.ac by autoheader. */ + +/* Description */ +#undef CXX_HAS_BUGGY_FOR_LOOPS + +/* Description */ +#undef CXX_HAS_NO_BOOL + +/* Define to 1 if you have the header file. */ +#undef HAVE_INTTYPES_H + +/* Define to 1 if you have the header file. */ +#undef HAVE_MEMORY_H + +/* Define to 1 if you have the header file. */ +#undef HAVE_STDINT_H + +/* Define to 1 if you have the header file. */ +#undef HAVE_STDLIB_H + +/* Define to 1 if you have the header file. */ +#undef HAVE_STRINGS_H + +/* Define to 1 if you have the header file. */ +#undef HAVE_STRING_H + +/* Define to 1 if you have the header file. */ +#undef HAVE_SYS_STAT_H + +/* Define to 1 if you have the header file. */ +#undef HAVE_SYS_TYPES_H + +/* Define to 1 if you have the header file. */ +#undef HAVE_UNISTD_H + +/* Description */ +#undef NDEBUG + +/* Name of package */ +#undef PACKAGE + +/* Define to the address where bug reports for this package should be sent. */ +#undef PACKAGE_BUGREPORT + +/* Define to the full name of this package. */ +#undef PACKAGE_NAME + +/* Define to the full name and version of this package. */ +#undef PACKAGE_STRING + +/* Define to the one symbol short name of this package. */ +#undef PACKAGE_TARNAME + +/* Define to the version of this package. */ +#undef PACKAGE_VERSION + +/* Define to 1 if you have the ANSI C header files. */ +#undef STDC_HEADERS + +/* Version number of package */ +#undef VERSION + +/* Description */ +#undef YOUR_OS + +/* Define to 1 if on AIX 3. + System headers sometimes define this. + We just want to avoid a redefinition error message. */ +#ifndef _ALL_SOURCE +# undef _ALL_SOURCE +#endif + +/* Define to 1 if on MINIX. */ +#undef _MINIX + +/* Define to 2 if the system does not provide POSIX.1 features except with + this defined. */ +#undef _POSIX_1_SOURCE + +/* Define to 1 if you need to in order for `stat' and other things to work. */ +#undef _POSIX_SOURCE diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/config/config.guess --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/config/config.guess Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,1526 @@ +#! /bin/sh +# Attempt to guess a canonical system name. +# Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999, +# 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008 +# Free Software Foundation, Inc. + +timestamp='2008-01-23' + +# This file is free software; you can redistribute it and/or modify it +# under the terms of the GNU General Public License as published by +# the Free Software Foundation; either version 2 of the License, or +# (at your option) any later version. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY; without even the implied warranty of +# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU +# General Public License for more details. +# +# You should have received a copy of the GNU General Public License +# along with this program; if not, write to the Free Software +# Foundation, Inc., 51 Franklin Street - Fifth Floor, Boston, MA +# 02110-1301, USA. +# +# As a special exception to the GNU General Public License, if you +# distribute this file as part of a program that contains a +# configuration script generated by Autoconf, you may include it under +# the same distribution terms that you use for the rest of that program. + + +# Originally written by Per Bothner . +# Please send patches to . Submit a context +# diff and a properly formatted ChangeLog entry. +# +# This script attempts to guess a canonical system name similar to +# config.sub. If it succeeds, it prints the system name on stdout, and +# exits with 0. Otherwise, it exits with 1. +# +# The plan is that this can be called by configure scripts if you +# don't specify an explicit build system type. + +me=`echo "$0" | sed -e 's,.*/,,'` + +usage="\ +Usage: $0 [OPTION] + +Output the configuration name of the system \`$me' is run on. + +Operation modes: + -h, --help print this help, then exit + -t, --time-stamp print date of last modification, then exit + -v, --version print version number, then exit + +Report bugs and patches to ." + +version="\ +GNU config.guess ($timestamp) + +Originally written by Per Bothner. +Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, +2002, 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. + +This is free software; see the source for copying conditions. There is NO +warranty; not even for MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE." + +help=" +Try \`$me --help' for more information." + +# Parse command line +while test $# -gt 0 ; do + case $1 in + --time-stamp | --time* | -t ) + echo "$timestamp" ; exit ;; + --version | -v ) + echo "$version" ; exit ;; + --help | --h* | -h ) + echo "$usage"; exit ;; + -- ) # Stop option processing + shift; break ;; + - ) # Use stdin as input. + break ;; + -* ) + echo "$me: invalid option $1$help" >&2 + exit 1 ;; + * ) + break ;; + esac +done + +if test $# != 0; then + echo "$me: too many arguments$help" >&2 + exit 1 +fi + +trap 'exit 1' 1 2 15 + +# CC_FOR_BUILD -- compiler used by this script. Note that the use of a +# compiler to aid in system detection is discouraged as it requires +# temporary files to be created and, as you can see below, it is a +# headache to deal with in a portable fashion. + +# Historically, `CC_FOR_BUILD' used to be named `HOST_CC'. We still +# use `HOST_CC' if defined, but it is deprecated. + +# Portable tmp directory creation inspired by the Autoconf team. + +set_cc_for_build=' +trap "exitcode=\$?; (rm -f \$tmpfiles 2>/dev/null; rmdir \$tmp 2>/dev/null) && exit \$exitcode" 0 ; +trap "rm -f \$tmpfiles 2>/dev/null; rmdir \$tmp 2>/dev/null; exit 1" 1 2 13 15 ; +: ${TMPDIR=/tmp} ; + { tmp=`(umask 077 && mktemp -d "$TMPDIR/cgXXXXXX") 2>/dev/null` && test -n "$tmp" && test -d "$tmp" ; } || + { test -n "$RANDOM" && tmp=$TMPDIR/cg$$-$RANDOM && (umask 077 && mkdir $tmp) ; } || + { tmp=$TMPDIR/cg-$$ && (umask 077 && mkdir $tmp) && echo "Warning: creating insecure temp directory" >&2 ; } || + { echo "$me: cannot create a temporary directory in $TMPDIR" >&2 ; exit 1 ; } ; +dummy=$tmp/dummy ; +tmpfiles="$dummy.c $dummy.o $dummy.rel $dummy" ; +case $CC_FOR_BUILD,$HOST_CC,$CC in + ,,) echo "int x;" > $dummy.c ; + for c in cc gcc c89 c99 ; do + if ($c -c -o $dummy.o $dummy.c) >/dev/null 2>&1 ; then + CC_FOR_BUILD="$c"; break ; + fi ; + done ; + if test x"$CC_FOR_BUILD" = x ; then + CC_FOR_BUILD=no_compiler_found ; + fi + ;; + ,,*) CC_FOR_BUILD=$CC ;; + ,*,*) CC_FOR_BUILD=$HOST_CC ;; +esac ; set_cc_for_build= ;' + +# This is needed to find uname on a Pyramid OSx when run in the BSD universe. +# (ghazi@noc.rutgers.edu 1994-08-24) +if (test -f /.attbin/uname) >/dev/null 2>&1 ; then + PATH=$PATH:/.attbin ; export PATH +fi + +UNAME_MACHINE=`(uname -m) 2>/dev/null` || UNAME_MACHINE=unknown +UNAME_RELEASE=`(uname -r) 2>/dev/null` || UNAME_RELEASE=unknown +UNAME_SYSTEM=`(uname -s) 2>/dev/null` || UNAME_SYSTEM=unknown +UNAME_VERSION=`(uname -v) 2>/dev/null` || UNAME_VERSION=unknown + +# Note: order is significant - the case branches are not exclusive. + +case "${UNAME_MACHINE}:${UNAME_SYSTEM}:${UNAME_RELEASE}:${UNAME_VERSION}" in + *:NetBSD:*:*) + # NetBSD (nbsd) targets should (where applicable) match one or + # more of the tupples: *-*-netbsdelf*, *-*-netbsdaout*, + # *-*-netbsdecoff* and *-*-netbsd*. For targets that recently + # switched to ELF, *-*-netbsd* would select the old + # object file format. This provides both forward + # compatibility and a consistent mechanism for selecting the + # object file format. + # + # Note: NetBSD doesn't particularly care about the vendor + # portion of the name. We always set it to "unknown". + sysctl="sysctl -n hw.machine_arch" + UNAME_MACHINE_ARCH=`(/sbin/$sysctl 2>/dev/null || \ + /usr/sbin/$sysctl 2>/dev/null || echo unknown)` + case "${UNAME_MACHINE_ARCH}" in + armeb) machine=armeb-unknown ;; + arm*) machine=arm-unknown ;; + sh3el) machine=shl-unknown ;; + sh3eb) machine=sh-unknown ;; + sh5el) machine=sh5le-unknown ;; + *) machine=${UNAME_MACHINE_ARCH}-unknown ;; + esac + # The Operating System including object format, if it has switched + # to ELF recently, or will in the future. + case "${UNAME_MACHINE_ARCH}" in + arm*|i386|m68k|ns32k|sh3*|sparc|vax) + eval $set_cc_for_build + if echo __ELF__ | $CC_FOR_BUILD -E - 2>/dev/null \ + | grep __ELF__ >/dev/null + then + # Once all utilities can be ECOFF (netbsdecoff) or a.out (netbsdaout). + # Return netbsd for either. FIX? + os=netbsd + else + os=netbsdelf + fi + ;; + *) + os=netbsd + ;; + esac + # The OS release + # Debian GNU/NetBSD machines have a different userland, and + # thus, need a distinct triplet. However, they do not need + # kernel version information, so it can be replaced with a + # suitable tag, in the style of linux-gnu. + case "${UNAME_VERSION}" in + Debian*) + release='-gnu' + ;; + *) + release=`echo ${UNAME_RELEASE}|sed -e 's/[-_].*/\./'` + ;; + esac + # Since CPU_TYPE-MANUFACTURER-KERNEL-OPERATING_SYSTEM: + # contains redundant information, the shorter form: + # CPU_TYPE-MANUFACTURER-OPERATING_SYSTEM is used. + echo "${machine}-${os}${release}" + exit ;; + *:OpenBSD:*:*) + UNAME_MACHINE_ARCH=`arch | sed 's/OpenBSD.//'` + echo ${UNAME_MACHINE_ARCH}-unknown-openbsd${UNAME_RELEASE} + exit ;; + *:ekkoBSD:*:*) + echo ${UNAME_MACHINE}-unknown-ekkobsd${UNAME_RELEASE} + exit ;; + *:SolidBSD:*:*) + echo ${UNAME_MACHINE}-unknown-solidbsd${UNAME_RELEASE} + exit ;; + macppc:MirBSD:*:*) + echo powerpc-unknown-mirbsd${UNAME_RELEASE} + exit ;; + *:MirBSD:*:*) + echo ${UNAME_MACHINE}-unknown-mirbsd${UNAME_RELEASE} + exit ;; + alpha:OSF1:*:*) + case $UNAME_RELEASE in + *4.0) + UNAME_RELEASE=`/usr/sbin/sizer -v | awk '{print $3}'` + ;; + *5.*) + UNAME_RELEASE=`/usr/sbin/sizer -v | awk '{print $4}'` + ;; + esac + # According to Compaq, /usr/sbin/psrinfo has been available on + # OSF/1 and Tru64 systems produced since 1995. I hope that + # covers most systems running today. This code pipes the CPU + # types through head -n 1, so we only detect the type of CPU 0. + ALPHA_CPU_TYPE=`/usr/sbin/psrinfo -v | sed -n -e 's/^ The alpha \(.*\) processor.*$/\1/p' | head -n 1` + case "$ALPHA_CPU_TYPE" in + "EV4 (21064)") + UNAME_MACHINE="alpha" ;; + "EV4.5 (21064)") + UNAME_MACHINE="alpha" ;; + "LCA4 (21066/21068)") + UNAME_MACHINE="alpha" ;; + "EV5 (21164)") + UNAME_MACHINE="alphaev5" ;; + "EV5.6 (21164A)") + UNAME_MACHINE="alphaev56" ;; + "EV5.6 (21164PC)") + UNAME_MACHINE="alphapca56" ;; + "EV5.7 (21164PC)") + UNAME_MACHINE="alphapca57" ;; + "EV6 (21264)") + UNAME_MACHINE="alphaev6" ;; + "EV6.7 (21264A)") + UNAME_MACHINE="alphaev67" ;; + "EV6.8CB (21264C)") + UNAME_MACHINE="alphaev68" ;; + "EV6.8AL (21264B)") + UNAME_MACHINE="alphaev68" ;; + "EV6.8CX (21264D)") + UNAME_MACHINE="alphaev68" ;; + "EV6.9A (21264/EV69A)") + UNAME_MACHINE="alphaev69" ;; + "EV7 (21364)") + UNAME_MACHINE="alphaev7" ;; + "EV7.9 (21364A)") + UNAME_MACHINE="alphaev79" ;; + esac + # A Pn.n version is a patched version. + # A Vn.n version is a released version. + # A Tn.n version is a released field test version. + # A Xn.n version is an unreleased experimental baselevel. + # 1.2 uses "1.2" for uname -r. + echo ${UNAME_MACHINE}-dec-osf`echo ${UNAME_RELEASE} | sed -e 's/^[PVTX]//' | tr 'ABCDEFGHIJKLMNOPQRSTUVWXYZ' 'abcdefghijklmnopqrstuvwxyz'` + exit ;; + Alpha\ *:Windows_NT*:*) + # How do we know it's Interix rather than the generic POSIX subsystem? + # Should we change UNAME_MACHINE based on the output of uname instead + # of the specific Alpha model? + echo alpha-pc-interix + exit ;; + 21064:Windows_NT:50:3) + echo alpha-dec-winnt3.5 + exit ;; + Amiga*:UNIX_System_V:4.0:*) + echo m68k-unknown-sysv4 + exit ;; + *:[Aa]miga[Oo][Ss]:*:*) + echo ${UNAME_MACHINE}-unknown-amigaos + exit ;; + *:[Mm]orph[Oo][Ss]:*:*) + echo ${UNAME_MACHINE}-unknown-morphos + exit ;; + *:OS/390:*:*) + echo i370-ibm-openedition + exit ;; + *:z/VM:*:*) + echo s390-ibm-zvmoe + exit ;; + *:OS400:*:*) + echo powerpc-ibm-os400 + exit ;; + arm:RISC*:1.[012]*:*|arm:riscix:1.[012]*:*) + echo arm-acorn-riscix${UNAME_RELEASE} + exit ;; + arm:riscos:*:*|arm:RISCOS:*:*) + echo arm-unknown-riscos + exit ;; + SR2?01:HI-UX/MPP:*:* | SR8000:HI-UX/MPP:*:*) + echo hppa1.1-hitachi-hiuxmpp + exit ;; + Pyramid*:OSx*:*:* | MIS*:OSx*:*:* | MIS*:SMP_DC-OSx*:*:*) + # akee@wpdis03.wpafb.af.mil (Earle F. Ake) contributed MIS and NILE. + if test "`(/bin/universe) 2>/dev/null`" = att ; then + echo pyramid-pyramid-sysv3 + else + echo pyramid-pyramid-bsd + fi + exit ;; + NILE*:*:*:dcosx) + echo pyramid-pyramid-svr4 + exit ;; + DRS?6000:unix:4.0:6*) + echo sparc-icl-nx6 + exit ;; + DRS?6000:UNIX_SV:4.2*:7* | DRS?6000:isis:4.2*:7*) + case `/usr/bin/uname -p` in + sparc) echo sparc-icl-nx7; exit ;; + esac ;; + sun4H:SunOS:5.*:*) + echo sparc-hal-solaris2`echo ${UNAME_RELEASE}|sed -e 's/[^.]*//'` + exit ;; + sun4*:SunOS:5.*:* | tadpole*:SunOS:5.*:*) + echo sparc-sun-solaris2`echo ${UNAME_RELEASE}|sed -e 's/[^.]*//'` + exit ;; + i86pc:SunOS:5.*:* | i86xen:SunOS:5.*:*) + echo i386-pc-solaris2`echo ${UNAME_RELEASE}|sed -e 's/[^.]*//'` + exit ;; + sun4*:SunOS:6*:*) + # According to config.sub, this is the proper way to canonicalize + # SunOS6. Hard to guess exactly what SunOS6 will be like, but + # it's likely to be more like Solaris than SunOS4. + echo sparc-sun-solaris3`echo ${UNAME_RELEASE}|sed -e 's/[^.]*//'` + exit ;; + sun4*:SunOS:*:*) + case "`/usr/bin/arch -k`" in + Series*|S4*) + UNAME_RELEASE=`uname -v` + ;; + esac + # Japanese Language versions have a version number like `4.1.3-JL'. + echo sparc-sun-sunos`echo ${UNAME_RELEASE}|sed -e 's/-/_/'` + exit ;; + sun3*:SunOS:*:*) + echo m68k-sun-sunos${UNAME_RELEASE} + exit ;; + sun*:*:4.2BSD:*) + UNAME_RELEASE=`(sed 1q /etc/motd | awk '{print substr($5,1,3)}') 2>/dev/null` + test "x${UNAME_RELEASE}" = "x" && UNAME_RELEASE=3 + case "`/bin/arch`" in + sun3) + echo m68k-sun-sunos${UNAME_RELEASE} + ;; + sun4) + echo sparc-sun-sunos${UNAME_RELEASE} + ;; + esac + exit ;; + aushp:SunOS:*:*) + echo sparc-auspex-sunos${UNAME_RELEASE} + exit ;; + # The situation for MiNT is a little confusing. The machine name + # can be virtually everything (everything which is not + # "atarist" or "atariste" at least should have a processor + # > m68000). The system name ranges from "MiNT" over "FreeMiNT" + # to the lowercase version "mint" (or "freemint"). Finally + # the system name "TOS" denotes a system which is actually not + # MiNT. But MiNT is downward compatible to TOS, so this should + # be no problem. + atarist[e]:*MiNT:*:* | atarist[e]:*mint:*:* | atarist[e]:*TOS:*:*) + echo m68k-atari-mint${UNAME_RELEASE} + exit ;; + atari*:*MiNT:*:* | atari*:*mint:*:* | atarist[e]:*TOS:*:*) + echo m68k-atari-mint${UNAME_RELEASE} + exit ;; + *falcon*:*MiNT:*:* | *falcon*:*mint:*:* | *falcon*:*TOS:*:*) + echo m68k-atari-mint${UNAME_RELEASE} + exit ;; + milan*:*MiNT:*:* | milan*:*mint:*:* | *milan*:*TOS:*:*) + echo m68k-milan-mint${UNAME_RELEASE} + exit ;; + hades*:*MiNT:*:* | hades*:*mint:*:* | *hades*:*TOS:*:*) + echo m68k-hades-mint${UNAME_RELEASE} + exit ;; + *:*MiNT:*:* | *:*mint:*:* | *:*TOS:*:*) + echo m68k-unknown-mint${UNAME_RELEASE} + exit ;; + m68k:machten:*:*) + echo m68k-apple-machten${UNAME_RELEASE} + exit ;; + powerpc:machten:*:*) + echo powerpc-apple-machten${UNAME_RELEASE} + exit ;; + RISC*:Mach:*:*) + echo mips-dec-mach_bsd4.3 + exit ;; + RISC*:ULTRIX:*:*) + echo mips-dec-ultrix${UNAME_RELEASE} + exit ;; + VAX*:ULTRIX*:*:*) + echo vax-dec-ultrix${UNAME_RELEASE} + exit ;; + 2020:CLIX:*:* | 2430:CLIX:*:*) + echo clipper-intergraph-clix${UNAME_RELEASE} + exit ;; + mips:*:*:UMIPS | mips:*:*:RISCos) + eval $set_cc_for_build + sed 's/^ //' << EOF >$dummy.c +#ifdef __cplusplus +#include /* for printf() prototype */ + int main (int argc, char *argv[]) { +#else + int main (argc, argv) int argc; char *argv[]; { +#endif + #if defined (host_mips) && defined (MIPSEB) + #if defined (SYSTYPE_SYSV) + printf ("mips-mips-riscos%ssysv\n", argv[1]); exit (0); + #endif + #if defined (SYSTYPE_SVR4) + printf ("mips-mips-riscos%ssvr4\n", argv[1]); exit (0); + #endif + #if defined (SYSTYPE_BSD43) || defined(SYSTYPE_BSD) + printf ("mips-mips-riscos%sbsd\n", argv[1]); exit (0); + #endif + #endif + exit (-1); + } +EOF + $CC_FOR_BUILD -o $dummy $dummy.c && + dummyarg=`echo "${UNAME_RELEASE}" | sed -n 's/\([0-9]*\).*/\1/p'` && + SYSTEM_NAME=`$dummy $dummyarg` && + { echo "$SYSTEM_NAME"; exit; } + echo mips-mips-riscos${UNAME_RELEASE} + exit ;; + Motorola:PowerMAX_OS:*:*) + echo powerpc-motorola-powermax + exit ;; + Motorola:*:4.3:PL8-*) + echo powerpc-harris-powermax + exit ;; + Night_Hawk:*:*:PowerMAX_OS | Synergy:PowerMAX_OS:*:*) + echo powerpc-harris-powermax + exit ;; + Night_Hawk:Power_UNIX:*:*) + echo powerpc-harris-powerunix + exit ;; + m88k:CX/UX:7*:*) + echo m88k-harris-cxux7 + exit ;; + m88k:*:4*:R4*) + echo m88k-motorola-sysv4 + exit ;; + m88k:*:3*:R3*) + echo m88k-motorola-sysv3 + exit ;; + AViiON:dgux:*:*) + # DG/UX returns AViiON for all architectures + UNAME_PROCESSOR=`/usr/bin/uname -p` + if [ $UNAME_PROCESSOR = mc88100 ] || [ $UNAME_PROCESSOR = mc88110 ] + then + if [ ${TARGET_BINARY_INTERFACE}x = m88kdguxelfx ] || \ + [ ${TARGET_BINARY_INTERFACE}x = x ] + then + echo m88k-dg-dgux${UNAME_RELEASE} + else + echo m88k-dg-dguxbcs${UNAME_RELEASE} + fi + else + echo i586-dg-dgux${UNAME_RELEASE} + fi + exit ;; + M88*:DolphinOS:*:*) # DolphinOS (SVR3) + echo m88k-dolphin-sysv3 + exit ;; + M88*:*:R3*:*) + # Delta 88k system running SVR3 + echo m88k-motorola-sysv3 + exit ;; + XD88*:*:*:*) # Tektronix XD88 system running UTekV (SVR3) + echo m88k-tektronix-sysv3 + exit ;; + Tek43[0-9][0-9]:UTek:*:*) # Tektronix 4300 system running UTek (BSD) + echo m68k-tektronix-bsd + exit ;; + *:IRIX*:*:*) + echo mips-sgi-irix`echo ${UNAME_RELEASE}|sed -e 's/-/_/g'` + exit ;; + ????????:AIX?:[12].1:2) # AIX 2.2.1 or AIX 2.1.1 is RT/PC AIX. + echo romp-ibm-aix # uname -m gives an 8 hex-code CPU id + exit ;; # Note that: echo "'`uname -s`'" gives 'AIX ' + i*86:AIX:*:*) + echo i386-ibm-aix + exit ;; + ia64:AIX:*:*) + if [ -x /usr/bin/oslevel ] ; then + IBM_REV=`/usr/bin/oslevel` + else + IBM_REV=${UNAME_VERSION}.${UNAME_RELEASE} + fi + echo ${UNAME_MACHINE}-ibm-aix${IBM_REV} + exit ;; + *:AIX:2:3) + if grep bos325 /usr/include/stdio.h >/dev/null 2>&1; then + eval $set_cc_for_build + sed 's/^ //' << EOF >$dummy.c + #include + + main() + { + if (!__power_pc()) + exit(1); + puts("powerpc-ibm-aix3.2.5"); + exit(0); + } +EOF + if $CC_FOR_BUILD -o $dummy $dummy.c && SYSTEM_NAME=`$dummy` + then + echo "$SYSTEM_NAME" + else + echo rs6000-ibm-aix3.2.5 + fi + elif grep bos324 /usr/include/stdio.h >/dev/null 2>&1; then + echo rs6000-ibm-aix3.2.4 + else + echo rs6000-ibm-aix3.2 + fi + exit ;; + *:AIX:*:[456]) + IBM_CPU_ID=`/usr/sbin/lsdev -C -c processor -S available | sed 1q | awk '{ print $1 }'` + if /usr/sbin/lsattr -El ${IBM_CPU_ID} | grep ' POWER' >/dev/null 2>&1; then + IBM_ARCH=rs6000 + else + IBM_ARCH=powerpc + fi + if [ -x /usr/bin/oslevel ] ; then + IBM_REV=`/usr/bin/oslevel` + else + IBM_REV=${UNAME_VERSION}.${UNAME_RELEASE} + fi + echo ${IBM_ARCH}-ibm-aix${IBM_REV} + exit ;; + *:AIX:*:*) + echo rs6000-ibm-aix + exit ;; + ibmrt:4.4BSD:*|romp-ibm:BSD:*) + echo romp-ibm-bsd4.4 + exit ;; + ibmrt:*BSD:*|romp-ibm:BSD:*) # covers RT/PC BSD and + echo romp-ibm-bsd${UNAME_RELEASE} # 4.3 with uname added to + exit ;; # report: romp-ibm BSD 4.3 + *:BOSX:*:*) + echo rs6000-bull-bosx + exit ;; + DPX/2?00:B.O.S.:*:*) + echo m68k-bull-sysv3 + exit ;; + 9000/[34]??:4.3bsd:1.*:*) + echo m68k-hp-bsd + exit ;; + hp300:4.4BSD:*:* | 9000/[34]??:4.3bsd:2.*:*) + echo m68k-hp-bsd4.4 + exit ;; + 9000/[34678]??:HP-UX:*:*) + HPUX_REV=`echo ${UNAME_RELEASE}|sed -e 's/[^.]*.[0B]*//'` + case "${UNAME_MACHINE}" in + 9000/31? ) HP_ARCH=m68000 ;; + 9000/[34]?? ) HP_ARCH=m68k ;; + 9000/[678][0-9][0-9]) + if [ -x /usr/bin/getconf ]; then + sc_cpu_version=`/usr/bin/getconf SC_CPU_VERSION 2>/dev/null` + sc_kernel_bits=`/usr/bin/getconf SC_KERNEL_BITS 2>/dev/null` + case "${sc_cpu_version}" in + 523) HP_ARCH="hppa1.0" ;; # CPU_PA_RISC1_0 + 528) HP_ARCH="hppa1.1" ;; # CPU_PA_RISC1_1 + 532) # CPU_PA_RISC2_0 + case "${sc_kernel_bits}" in + 32) HP_ARCH="hppa2.0n" ;; + 64) HP_ARCH="hppa2.0w" ;; + '') HP_ARCH="hppa2.0" ;; # HP-UX 10.20 + esac ;; + esac + fi + if [ "${HP_ARCH}" = "" ]; then + eval $set_cc_for_build + sed 's/^ //' << EOF >$dummy.c + + #define _HPUX_SOURCE + #include + #include + + int main () + { + #if defined(_SC_KERNEL_BITS) + long bits = sysconf(_SC_KERNEL_BITS); + #endif + long cpu = sysconf (_SC_CPU_VERSION); + + switch (cpu) + { + case CPU_PA_RISC1_0: puts ("hppa1.0"); break; + case CPU_PA_RISC1_1: puts ("hppa1.1"); break; + case CPU_PA_RISC2_0: + #if defined(_SC_KERNEL_BITS) + switch (bits) + { + case 64: puts ("hppa2.0w"); break; + case 32: puts ("hppa2.0n"); break; + default: puts ("hppa2.0"); break; + } break; + #else /* !defined(_SC_KERNEL_BITS) */ + puts ("hppa2.0"); break; + #endif + default: puts ("hppa1.0"); break; + } + exit (0); + } +EOF + (CCOPTS= $CC_FOR_BUILD -o $dummy $dummy.c 2>/dev/null) && HP_ARCH=`$dummy` + test -z "$HP_ARCH" && HP_ARCH=hppa + fi ;; + esac + if [ ${HP_ARCH} = "hppa2.0w" ] + then + eval $set_cc_for_build + + # hppa2.0w-hp-hpux* has a 64-bit kernel and a compiler generating + # 32-bit code. hppa64-hp-hpux* has the same kernel and a compiler + # generating 64-bit code. GNU and HP use different nomenclature: + # + # $ CC_FOR_BUILD=cc ./config.guess + # => hppa2.0w-hp-hpux11.23 + # $ CC_FOR_BUILD="cc +DA2.0w" ./config.guess + # => hppa64-hp-hpux11.23 + + if echo __LP64__ | (CCOPTS= $CC_FOR_BUILD -E - 2>/dev/null) | + grep __LP64__ >/dev/null + then + HP_ARCH="hppa2.0w" + else + HP_ARCH="hppa64" + fi + fi + echo ${HP_ARCH}-hp-hpux${HPUX_REV} + exit ;; + ia64:HP-UX:*:*) + HPUX_REV=`echo ${UNAME_RELEASE}|sed -e 's/[^.]*.[0B]*//'` + echo ia64-hp-hpux${HPUX_REV} + exit ;; + 3050*:HI-UX:*:*) + eval $set_cc_for_build + sed 's/^ //' << EOF >$dummy.c + #include + int + main () + { + long cpu = sysconf (_SC_CPU_VERSION); + /* The order matters, because CPU_IS_HP_MC68K erroneously returns + true for CPU_PA_RISC1_0. CPU_IS_PA_RISC returns correct + results, however. */ + if (CPU_IS_PA_RISC (cpu)) + { + switch (cpu) + { + case CPU_PA_RISC1_0: puts ("hppa1.0-hitachi-hiuxwe2"); break; + case CPU_PA_RISC1_1: puts ("hppa1.1-hitachi-hiuxwe2"); break; + case CPU_PA_RISC2_0: puts ("hppa2.0-hitachi-hiuxwe2"); break; + default: puts ("hppa-hitachi-hiuxwe2"); break; + } + } + else if (CPU_IS_HP_MC68K (cpu)) + puts ("m68k-hitachi-hiuxwe2"); + else puts ("unknown-hitachi-hiuxwe2"); + exit (0); + } +EOF + $CC_FOR_BUILD -o $dummy $dummy.c && SYSTEM_NAME=`$dummy` && + { echo "$SYSTEM_NAME"; exit; } + echo unknown-hitachi-hiuxwe2 + exit ;; + 9000/7??:4.3bsd:*:* | 9000/8?[79]:4.3bsd:*:* ) + echo hppa1.1-hp-bsd + exit ;; + 9000/8??:4.3bsd:*:*) + echo hppa1.0-hp-bsd + exit ;; + *9??*:MPE/iX:*:* | *3000*:MPE/iX:*:*) + echo hppa1.0-hp-mpeix + exit ;; + hp7??:OSF1:*:* | hp8?[79]:OSF1:*:* ) + echo hppa1.1-hp-osf + exit ;; + hp8??:OSF1:*:*) + echo hppa1.0-hp-osf + exit ;; + i*86:OSF1:*:*) + if [ -x /usr/sbin/sysversion ] ; then + echo ${UNAME_MACHINE}-unknown-osf1mk + else + echo ${UNAME_MACHINE}-unknown-osf1 + fi + exit ;; + parisc*:Lites*:*:*) + echo hppa1.1-hp-lites + exit ;; + C1*:ConvexOS:*:* | convex:ConvexOS:C1*:*) + echo c1-convex-bsd + exit ;; + C2*:ConvexOS:*:* | convex:ConvexOS:C2*:*) + if getsysinfo -f scalar_acc + then echo c32-convex-bsd + else echo c2-convex-bsd + fi + exit ;; + C34*:ConvexOS:*:* | convex:ConvexOS:C34*:*) + echo c34-convex-bsd + exit ;; + C38*:ConvexOS:*:* | convex:ConvexOS:C38*:*) + echo c38-convex-bsd + exit ;; + C4*:ConvexOS:*:* | convex:ConvexOS:C4*:*) + echo c4-convex-bsd + exit ;; + CRAY*Y-MP:*:*:*) + echo ymp-cray-unicos${UNAME_RELEASE} | sed -e 's/\.[^.]*$/.X/' + exit ;; + CRAY*[A-Z]90:*:*:*) + echo ${UNAME_MACHINE}-cray-unicos${UNAME_RELEASE} \ + | sed -e 's/CRAY.*\([A-Z]90\)/\1/' \ + -e y/ABCDEFGHIJKLMNOPQRSTUVWXYZ/abcdefghijklmnopqrstuvwxyz/ \ + -e 's/\.[^.]*$/.X/' + exit ;; + CRAY*TS:*:*:*) + echo t90-cray-unicos${UNAME_RELEASE} | sed -e 's/\.[^.]*$/.X/' + exit ;; + CRAY*T3E:*:*:*) + echo alphaev5-cray-unicosmk${UNAME_RELEASE} | sed -e 's/\.[^.]*$/.X/' + exit ;; + CRAY*SV1:*:*:*) + echo sv1-cray-unicos${UNAME_RELEASE} | sed -e 's/\.[^.]*$/.X/' + exit ;; + *:UNICOS/mp:*:*) + echo craynv-cray-unicosmp${UNAME_RELEASE} | sed -e 's/\.[^.]*$/.X/' + exit ;; + F30[01]:UNIX_System_V:*:* | F700:UNIX_System_V:*:*) + FUJITSU_PROC=`uname -m | tr 'ABCDEFGHIJKLMNOPQRSTUVWXYZ' 'abcdefghijklmnopqrstuvwxyz'` + FUJITSU_SYS=`uname -p | tr 'ABCDEFGHIJKLMNOPQRSTUVWXYZ' 'abcdefghijklmnopqrstuvwxyz' | sed -e 's/\///'` + FUJITSU_REL=`echo ${UNAME_RELEASE} | sed -e 's/ /_/'` + echo "${FUJITSU_PROC}-fujitsu-${FUJITSU_SYS}${FUJITSU_REL}" + exit ;; + 5000:UNIX_System_V:4.*:*) + FUJITSU_SYS=`uname -p | tr 'ABCDEFGHIJKLMNOPQRSTUVWXYZ' 'abcdefghijklmnopqrstuvwxyz' | sed -e 's/\///'` + FUJITSU_REL=`echo ${UNAME_RELEASE} | tr 'ABCDEFGHIJKLMNOPQRSTUVWXYZ' 'abcdefghijklmnopqrstuvwxyz' | sed -e 's/ /_/'` + echo "sparc-fujitsu-${FUJITSU_SYS}${FUJITSU_REL}" + exit ;; + i*86:BSD/386:*:* | i*86:BSD/OS:*:* | *:Ascend\ Embedded/OS:*:*) + echo ${UNAME_MACHINE}-pc-bsdi${UNAME_RELEASE} + exit ;; + sparc*:BSD/OS:*:*) + echo sparc-unknown-bsdi${UNAME_RELEASE} + exit ;; + *:BSD/OS:*:*) + echo ${UNAME_MACHINE}-unknown-bsdi${UNAME_RELEASE} + exit ;; + *:FreeBSD:*:*) + case ${UNAME_MACHINE} in + pc98) + echo i386-unknown-freebsd`echo ${UNAME_RELEASE}|sed -e 's/[-(].*//'` ;; + amd64) + echo x86_64-unknown-freebsd`echo ${UNAME_RELEASE}|sed -e 's/[-(].*//'` ;; + *) + echo ${UNAME_MACHINE}-unknown-freebsd`echo ${UNAME_RELEASE}|sed -e 's/[-(].*//'` ;; + esac + exit ;; + i*:CYGWIN*:*) + echo ${UNAME_MACHINE}-pc-cygwin + exit ;; + *:MINGW*:*) + echo ${UNAME_MACHINE}-pc-mingw32 + exit ;; + i*:windows32*:*) + # uname -m includes "-pc" on this system. + echo ${UNAME_MACHINE}-mingw32 + exit ;; + i*:PW*:*) + echo ${UNAME_MACHINE}-pc-pw32 + exit ;; + *:Interix*:[3456]*) + case ${UNAME_MACHINE} in + x86) + echo i586-pc-interix${UNAME_RELEASE} + exit ;; + EM64T | authenticamd) + echo x86_64-unknown-interix${UNAME_RELEASE} + exit ;; + IA64) + echo ia64-unknown-interix${UNAME_RELEASE} + exit ;; + esac ;; + [345]86:Windows_95:* | [345]86:Windows_98:* | [345]86:Windows_NT:*) + echo i${UNAME_MACHINE}-pc-mks + exit ;; + i*:Windows_NT*:* | Pentium*:Windows_NT*:*) + # How do we know it's Interix rather than the generic POSIX subsystem? + # It also conflicts with pre-2.0 versions of AT&T UWIN. Should we + # UNAME_MACHINE based on the output of uname instead of i386? + echo i586-pc-interix + exit ;; + i*:UWIN*:*) + echo ${UNAME_MACHINE}-pc-uwin + exit ;; + amd64:CYGWIN*:*:* | x86_64:CYGWIN*:*:*) + echo x86_64-unknown-cygwin + exit ;; + p*:CYGWIN*:*) + echo powerpcle-unknown-cygwin + exit ;; + prep*:SunOS:5.*:*) + echo powerpcle-unknown-solaris2`echo ${UNAME_RELEASE}|sed -e 's/[^.]*//'` + exit ;; + *:GNU:*:*) + # the GNU system + echo `echo ${UNAME_MACHINE}|sed -e 's,[-/].*$,,'`-unknown-gnu`echo ${UNAME_RELEASE}|sed -e 's,/.*$,,'` + exit ;; + *:GNU/*:*:*) + # other systems with GNU libc and userland + echo ${UNAME_MACHINE}-unknown-`echo ${UNAME_SYSTEM} | sed 's,^[^/]*/,,' | tr '[A-Z]' '[a-z]'``echo ${UNAME_RELEASE}|sed -e 's/[-(].*//'`-gnu + exit ;; + i*86:Minix:*:*) + echo ${UNAME_MACHINE}-pc-minix + exit ;; + arm*:Linux:*:*) + eval $set_cc_for_build + if echo __ARM_EABI__ | $CC_FOR_BUILD -E - 2>/dev/null \ + | grep -q __ARM_EABI__ + then + echo ${UNAME_MACHINE}-unknown-linux-gnu + else + echo ${UNAME_MACHINE}-unknown-linux-gnueabi + fi + exit ;; + avr32*:Linux:*:*) + echo ${UNAME_MACHINE}-unknown-linux-gnu + exit ;; + cris:Linux:*:*) + echo cris-axis-linux-gnu + exit ;; + crisv32:Linux:*:*) + echo crisv32-axis-linux-gnu + exit ;; + frv:Linux:*:*) + echo frv-unknown-linux-gnu + exit ;; + ia64:Linux:*:*) + echo ${UNAME_MACHINE}-unknown-linux-gnu + exit ;; + m32r*:Linux:*:*) + echo ${UNAME_MACHINE}-unknown-linux-gnu + exit ;; + m68*:Linux:*:*) + echo ${UNAME_MACHINE}-unknown-linux-gnu + exit ;; + mips:Linux:*:*) + eval $set_cc_for_build + sed 's/^ //' << EOF >$dummy.c + #undef CPU + #undef mips + #undef mipsel + #if defined(__MIPSEL__) || defined(__MIPSEL) || defined(_MIPSEL) || defined(MIPSEL) + CPU=mipsel + #else + #if defined(__MIPSEB__) || defined(__MIPSEB) || defined(_MIPSEB) || defined(MIPSEB) + CPU=mips + #else + CPU= + #endif + #endif +EOF + eval "`$CC_FOR_BUILD -E $dummy.c 2>/dev/null | sed -n ' + /^CPU/{ + s: ::g + p + }'`" + test x"${CPU}" != x && { echo "${CPU}-unknown-linux-gnu"; exit; } + ;; + mips64:Linux:*:*) + eval $set_cc_for_build + sed 's/^ //' << EOF >$dummy.c + #undef CPU + #undef mips64 + #undef mips64el + #if defined(__MIPSEL__) || defined(__MIPSEL) || defined(_MIPSEL) || defined(MIPSEL) + CPU=mips64el + #else + #if defined(__MIPSEB__) || defined(__MIPSEB) || defined(_MIPSEB) || defined(MIPSEB) + CPU=mips64 + #else + CPU= + #endif + #endif +EOF + eval "`$CC_FOR_BUILD -E $dummy.c 2>/dev/null | sed -n ' + /^CPU/{ + s: ::g + p + }'`" + test x"${CPU}" != x && { echo "${CPU}-unknown-linux-gnu"; exit; } + ;; + or32:Linux:*:*) + echo or32-unknown-linux-gnu + exit ;; + ppc:Linux:*:*) + echo powerpc-unknown-linux-gnu + exit ;; + ppc64:Linux:*:*) + echo powerpc64-unknown-linux-gnu + exit ;; + alpha:Linux:*:*) + case `sed -n '/^cpu model/s/^.*: \(.*\)/\1/p' < /proc/cpuinfo` in + EV5) UNAME_MACHINE=alphaev5 ;; + EV56) UNAME_MACHINE=alphaev56 ;; + PCA56) UNAME_MACHINE=alphapca56 ;; + PCA57) UNAME_MACHINE=alphapca56 ;; + EV6) UNAME_MACHINE=alphaev6 ;; + EV67) UNAME_MACHINE=alphaev67 ;; + EV68*) UNAME_MACHINE=alphaev68 ;; + esac + objdump --private-headers /bin/sh | grep ld.so.1 >/dev/null + if test "$?" = 0 ; then LIBC="libc1" ; else LIBC="" ; fi + echo ${UNAME_MACHINE}-unknown-linux-gnu${LIBC} + exit ;; + parisc:Linux:*:* | hppa:Linux:*:*) + # Look for CPU level + case `grep '^cpu[^a-z]*:' /proc/cpuinfo 2>/dev/null | cut -d' ' -f2` in + PA7*) echo hppa1.1-unknown-linux-gnu ;; + PA8*) echo hppa2.0-unknown-linux-gnu ;; + *) echo hppa-unknown-linux-gnu ;; + esac + exit ;; + parisc64:Linux:*:* | hppa64:Linux:*:*) + echo hppa64-unknown-linux-gnu + exit ;; + s390:Linux:*:* | s390x:Linux:*:*) + echo ${UNAME_MACHINE}-ibm-linux + exit ;; + sh64*:Linux:*:*) + echo ${UNAME_MACHINE}-unknown-linux-gnu + exit ;; + sh*:Linux:*:*) + echo ${UNAME_MACHINE}-unknown-linux-gnu + exit ;; + sparc:Linux:*:* | sparc64:Linux:*:*) + echo ${UNAME_MACHINE}-unknown-linux-gnu + exit ;; + vax:Linux:*:*) + echo ${UNAME_MACHINE}-dec-linux-gnu + exit ;; + x86_64:Linux:*:*) + echo x86_64-unknown-linux-gnu + exit ;; + xtensa*:Linux:*:*) + echo ${UNAME_MACHINE}-unknown-linux-gnu + exit ;; + i*86:Linux:*:*) + # The BFD linker knows what the default object file format is, so + # first see if it will tell us. cd to the root directory to prevent + # problems with other programs or directories called `ld' in the path. + # Set LC_ALL=C to ensure ld outputs messages in English. + ld_supported_targets=`cd /; LC_ALL=C ld --help 2>&1 \ + | sed -ne '/supported targets:/!d + s/[ ][ ]*/ /g + s/.*supported targets: *// + s/ .*// + p'` + case "$ld_supported_targets" in + elf32-i386) + TENTATIVE="${UNAME_MACHINE}-pc-linux-gnu" + ;; + a.out-i386-linux) + echo "${UNAME_MACHINE}-pc-linux-gnuaout" + exit ;; + coff-i386) + echo "${UNAME_MACHINE}-pc-linux-gnucoff" + exit ;; + "") + # Either a pre-BFD a.out linker (linux-gnuoldld) or + # one that does not give us useful --help. + echo "${UNAME_MACHINE}-pc-linux-gnuoldld" + exit ;; + esac + # Determine whether the default compiler is a.out or elf + eval $set_cc_for_build + sed 's/^ //' << EOF >$dummy.c + #include + #ifdef __ELF__ + # ifdef __GLIBC__ + # if __GLIBC__ >= 2 + LIBC=gnu + # else + LIBC=gnulibc1 + # endif + # else + LIBC=gnulibc1 + # endif + #else + #if defined(__INTEL_COMPILER) || defined(__PGI) || defined(__SUNPRO_C) || defined(__SUNPRO_CC) + LIBC=gnu + #else + LIBC=gnuaout + #endif + #endif + #ifdef __dietlibc__ + LIBC=dietlibc + #endif +EOF + eval "`$CC_FOR_BUILD -E $dummy.c 2>/dev/null | sed -n ' + /^LIBC/{ + s: ::g + p + }'`" + test x"${LIBC}" != x && { + echo "${UNAME_MACHINE}-pc-linux-${LIBC}" + exit + } + test x"${TENTATIVE}" != x && { echo "${TENTATIVE}"; exit; } + ;; + i*86:DYNIX/ptx:4*:*) + # ptx 4.0 does uname -s correctly, with DYNIX/ptx in there. + # earlier versions are messed up and put the nodename in both + # sysname and nodename. + echo i386-sequent-sysv4 + exit ;; + i*86:UNIX_SV:4.2MP:2.*) + # Unixware is an offshoot of SVR4, but it has its own version + # number series starting with 2... + # I am not positive that other SVR4 systems won't match this, + # I just have to hope. -- rms. + # Use sysv4.2uw... so that sysv4* matches it. + echo ${UNAME_MACHINE}-pc-sysv4.2uw${UNAME_VERSION} + exit ;; + i*86:OS/2:*:*) + # If we were able to find `uname', then EMX Unix compatibility + # is probably installed. + echo ${UNAME_MACHINE}-pc-os2-emx + exit ;; + i*86:XTS-300:*:STOP) + echo ${UNAME_MACHINE}-unknown-stop + exit ;; + i*86:atheos:*:*) + echo ${UNAME_MACHINE}-unknown-atheos + exit ;; + i*86:syllable:*:*) + echo ${UNAME_MACHINE}-pc-syllable + exit ;; + i*86:LynxOS:2.*:* | i*86:LynxOS:3.[01]*:* | i*86:LynxOS:4.0*:*) + echo i386-unknown-lynxos${UNAME_RELEASE} + exit ;; + i*86:*DOS:*:*) + echo ${UNAME_MACHINE}-pc-msdosdjgpp + exit ;; + i*86:*:4.*:* | i*86:SYSTEM_V:4.*:*) + UNAME_REL=`echo ${UNAME_RELEASE} | sed 's/\/MP$//'` + if grep Novell /usr/include/link.h >/dev/null 2>/dev/null; then + echo ${UNAME_MACHINE}-univel-sysv${UNAME_REL} + else + echo ${UNAME_MACHINE}-pc-sysv${UNAME_REL} + fi + exit ;; + i*86:*:5:[678]*) + # UnixWare 7.x, OpenUNIX and OpenServer 6. + case `/bin/uname -X | grep "^Machine"` in + *486*) UNAME_MACHINE=i486 ;; + *Pentium) UNAME_MACHINE=i586 ;; + *Pent*|*Celeron) UNAME_MACHINE=i686 ;; + esac + echo ${UNAME_MACHINE}-unknown-sysv${UNAME_RELEASE}${UNAME_SYSTEM}${UNAME_VERSION} + exit ;; + i*86:*:3.2:*) + if test -f /usr/options/cb.name; then + UNAME_REL=`sed -n 's/.*Version //p' /dev/null >/dev/null ; then + UNAME_REL=`(/bin/uname -X|grep Release|sed -e 's/.*= //')` + (/bin/uname -X|grep i80486 >/dev/null) && UNAME_MACHINE=i486 + (/bin/uname -X|grep '^Machine.*Pentium' >/dev/null) \ + && UNAME_MACHINE=i586 + (/bin/uname -X|grep '^Machine.*Pent *II' >/dev/null) \ + && UNAME_MACHINE=i686 + (/bin/uname -X|grep '^Machine.*Pentium Pro' >/dev/null) \ + && UNAME_MACHINE=i686 + echo ${UNAME_MACHINE}-pc-sco$UNAME_REL + else + echo ${UNAME_MACHINE}-pc-sysv32 + fi + exit ;; + pc:*:*:*) + # Left here for compatibility: + # uname -m prints for DJGPP always 'pc', but it prints nothing about + # the processor, so we play safe by assuming i386. + echo i386-pc-msdosdjgpp + exit ;; + Intel:Mach:3*:*) + echo i386-pc-mach3 + exit ;; + paragon:*:*:*) + echo i860-intel-osf1 + exit ;; + i860:*:4.*:*) # i860-SVR4 + if grep Stardent /usr/include/sys/uadmin.h >/dev/null 2>&1 ; then + echo i860-stardent-sysv${UNAME_RELEASE} # Stardent Vistra i860-SVR4 + else # Add other i860-SVR4 vendors below as they are discovered. + echo i860-unknown-sysv${UNAME_RELEASE} # Unknown i860-SVR4 + fi + exit ;; + mini*:CTIX:SYS*5:*) + # "miniframe" + echo m68010-convergent-sysv + exit ;; + mc68k:UNIX:SYSTEM5:3.51m) + echo m68k-convergent-sysv + exit ;; + M680?0:D-NIX:5.3:*) + echo m68k-diab-dnix + exit ;; + M68*:*:R3V[5678]*:*) + test -r /sysV68 && { echo 'm68k-motorola-sysv'; exit; } ;; + 3[345]??:*:4.0:3.0 | 3[34]??A:*:4.0:3.0 | 3[34]??,*:*:4.0:3.0 | 3[34]??/*:*:4.0:3.0 | 4400:*:4.0:3.0 | 4850:*:4.0:3.0 | SKA40:*:4.0:3.0 | SDS2:*:4.0:3.0 | SHG2:*:4.0:3.0 | S7501*:*:4.0:3.0) + OS_REL='' + test -r /etc/.relid \ + && OS_REL=.`sed -n 's/[^ ]* [^ ]* \([0-9][0-9]\).*/\1/p' < /etc/.relid` + /bin/uname -p 2>/dev/null | grep 86 >/dev/null \ + && { echo i486-ncr-sysv4.3${OS_REL}; exit; } + /bin/uname -p 2>/dev/null | /bin/grep entium >/dev/null \ + && { echo i586-ncr-sysv4.3${OS_REL}; exit; } ;; + 3[34]??:*:4.0:* | 3[34]??,*:*:4.0:*) + /bin/uname -p 2>/dev/null | grep 86 >/dev/null \ + && { echo i486-ncr-sysv4; exit; } ;; + m68*:LynxOS:2.*:* | m68*:LynxOS:3.0*:*) + echo m68k-unknown-lynxos${UNAME_RELEASE} + exit ;; + mc68030:UNIX_System_V:4.*:*) + echo m68k-atari-sysv4 + exit ;; + TSUNAMI:LynxOS:2.*:*) + echo sparc-unknown-lynxos${UNAME_RELEASE} + exit ;; + rs6000:LynxOS:2.*:*) + echo rs6000-unknown-lynxos${UNAME_RELEASE} + exit ;; + PowerPC:LynxOS:2.*:* | PowerPC:LynxOS:3.[01]*:* | PowerPC:LynxOS:4.0*:*) + echo powerpc-unknown-lynxos${UNAME_RELEASE} + exit ;; + SM[BE]S:UNIX_SV:*:*) + echo mips-dde-sysv${UNAME_RELEASE} + exit ;; + RM*:ReliantUNIX-*:*:*) + echo mips-sni-sysv4 + exit ;; + RM*:SINIX-*:*:*) + echo mips-sni-sysv4 + exit ;; + *:SINIX-*:*:*) + if uname -p 2>/dev/null >/dev/null ; then + UNAME_MACHINE=`(uname -p) 2>/dev/null` + echo ${UNAME_MACHINE}-sni-sysv4 + else + echo ns32k-sni-sysv + fi + exit ;; + PENTIUM:*:4.0*:*) # Unisys `ClearPath HMP IX 4000' SVR4/MP effort + # says + echo i586-unisys-sysv4 + exit ;; + *:UNIX_System_V:4*:FTX*) + # From Gerald Hewes . + # How about differentiating between stratus architectures? -djm + echo hppa1.1-stratus-sysv4 + exit ;; + *:*:*:FTX*) + # From seanf@swdc.stratus.com. + echo i860-stratus-sysv4 + exit ;; + i*86:VOS:*:*) + # From Paul.Green@stratus.com. + echo ${UNAME_MACHINE}-stratus-vos + exit ;; + *:VOS:*:*) + # From Paul.Green@stratus.com. + echo hppa1.1-stratus-vos + exit ;; + mc68*:A/UX:*:*) + echo m68k-apple-aux${UNAME_RELEASE} + exit ;; + news*:NEWS-OS:6*:*) + echo mips-sony-newsos6 + exit ;; + R[34]000:*System_V*:*:* | R4000:UNIX_SYSV:*:* | R*000:UNIX_SV:*:*) + if [ -d /usr/nec ]; then + echo mips-nec-sysv${UNAME_RELEASE} + else + echo mips-unknown-sysv${UNAME_RELEASE} + fi + exit ;; + BeBox:BeOS:*:*) # BeOS running on hardware made by Be, PPC only. + echo powerpc-be-beos + exit ;; + BeMac:BeOS:*:*) # BeOS running on Mac or Mac clone, PPC only. + echo powerpc-apple-beos + exit ;; + BePC:BeOS:*:*) # BeOS running on Intel PC compatible. + echo i586-pc-beos + exit ;; + SX-4:SUPER-UX:*:*) + echo sx4-nec-superux${UNAME_RELEASE} + exit ;; + SX-5:SUPER-UX:*:*) + echo sx5-nec-superux${UNAME_RELEASE} + exit ;; + SX-6:SUPER-UX:*:*) + echo sx6-nec-superux${UNAME_RELEASE} + exit ;; + SX-7:SUPER-UX:*:*) + echo sx7-nec-superux${UNAME_RELEASE} + exit ;; + SX-8:SUPER-UX:*:*) + echo sx8-nec-superux${UNAME_RELEASE} + exit ;; + SX-8R:SUPER-UX:*:*) + echo sx8r-nec-superux${UNAME_RELEASE} + exit ;; + Power*:Rhapsody:*:*) + echo powerpc-apple-rhapsody${UNAME_RELEASE} + exit ;; + *:Rhapsody:*:*) + echo ${UNAME_MACHINE}-apple-rhapsody${UNAME_RELEASE} + exit ;; + *:Darwin:*:*) + UNAME_PROCESSOR=`uname -p` || UNAME_PROCESSOR=unknown + case $UNAME_PROCESSOR in + unknown) UNAME_PROCESSOR=powerpc ;; + esac + echo ${UNAME_PROCESSOR}-apple-darwin${UNAME_RELEASE} + exit ;; + *:procnto*:*:* | *:QNX:[0123456789]*:*) + UNAME_PROCESSOR=`uname -p` + if test "$UNAME_PROCESSOR" = "x86"; then + UNAME_PROCESSOR=i386 + UNAME_MACHINE=pc + fi + echo ${UNAME_PROCESSOR}-${UNAME_MACHINE}-nto-qnx${UNAME_RELEASE} + exit ;; + *:QNX:*:4*) + echo i386-pc-qnx + exit ;; + NSE-?:NONSTOP_KERNEL:*:*) + echo nse-tandem-nsk${UNAME_RELEASE} + exit ;; + NSR-?:NONSTOP_KERNEL:*:*) + echo nsr-tandem-nsk${UNAME_RELEASE} + exit ;; + *:NonStop-UX:*:*) + echo mips-compaq-nonstopux + exit ;; + BS2000:POSIX*:*:*) + echo bs2000-siemens-sysv + exit ;; + DS/*:UNIX_System_V:*:*) + echo ${UNAME_MACHINE}-${UNAME_SYSTEM}-${UNAME_RELEASE} + exit ;; + *:Plan9:*:*) + # "uname -m" is not consistent, so use $cputype instead. 386 + # is converted to i386 for consistency with other x86 + # operating systems. + if test "$cputype" = "386"; then + UNAME_MACHINE=i386 + else + UNAME_MACHINE="$cputype" + fi + echo ${UNAME_MACHINE}-unknown-plan9 + exit ;; + *:TOPS-10:*:*) + echo pdp10-unknown-tops10 + exit ;; + *:TENEX:*:*) + echo pdp10-unknown-tenex + exit ;; + KS10:TOPS-20:*:* | KL10:TOPS-20:*:* | TYPE4:TOPS-20:*:*) + echo pdp10-dec-tops20 + exit ;; + XKL-1:TOPS-20:*:* | TYPE5:TOPS-20:*:*) + echo pdp10-xkl-tops20 + exit ;; + *:TOPS-20:*:*) + echo pdp10-unknown-tops20 + exit ;; + *:ITS:*:*) + echo pdp10-unknown-its + exit ;; + SEI:*:*:SEIUX) + echo mips-sei-seiux${UNAME_RELEASE} + exit ;; + *:DragonFly:*:*) + echo ${UNAME_MACHINE}-unknown-dragonfly`echo ${UNAME_RELEASE}|sed -e 's/[-(].*//'` + exit ;; + *:*VMS:*:*) + UNAME_MACHINE=`(uname -p) 2>/dev/null` + case "${UNAME_MACHINE}" in + A*) echo alpha-dec-vms ; exit ;; + I*) echo ia64-dec-vms ; exit ;; + V*) echo vax-dec-vms ; exit ;; + esac ;; + *:XENIX:*:SysV) + echo i386-pc-xenix + exit ;; + i*86:skyos:*:*) + echo ${UNAME_MACHINE}-pc-skyos`echo ${UNAME_RELEASE}` | sed -e 's/ .*$//' + exit ;; + i*86:rdos:*:*) + echo ${UNAME_MACHINE}-pc-rdos + exit ;; +esac + +#echo '(No uname command or uname output not recognized.)' 1>&2 +#echo "${UNAME_MACHINE}:${UNAME_SYSTEM}:${UNAME_RELEASE}:${UNAME_VERSION}" 1>&2 + +eval $set_cc_for_build +cat >$dummy.c < +# include +#endif +main () +{ +#if defined (sony) +#if defined (MIPSEB) + /* BFD wants "bsd" instead of "newsos". Perhaps BFD should be changed, + I don't know.... */ + printf ("mips-sony-bsd\n"); exit (0); +#else +#include + printf ("m68k-sony-newsos%s\n", +#ifdef NEWSOS4 + "4" +#else + "" +#endif + ); exit (0); +#endif +#endif + +#if defined (__arm) && defined (__acorn) && defined (__unix) + printf ("arm-acorn-riscix\n"); exit (0); +#endif + +#if defined (hp300) && !defined (hpux) + printf ("m68k-hp-bsd\n"); exit (0); +#endif + +#if defined (NeXT) +#if !defined (__ARCHITECTURE__) +#define __ARCHITECTURE__ "m68k" +#endif + int version; + version=`(hostinfo | sed -n 's/.*NeXT Mach \([0-9]*\).*/\1/p') 2>/dev/null`; + if (version < 4) + printf ("%s-next-nextstep%d\n", __ARCHITECTURE__, version); + else + printf ("%s-next-openstep%d\n", __ARCHITECTURE__, version); + exit (0); +#endif + +#if defined (MULTIMAX) || defined (n16) +#if defined (UMAXV) + printf ("ns32k-encore-sysv\n"); exit (0); +#else +#if defined (CMU) + printf ("ns32k-encore-mach\n"); exit (0); +#else + printf ("ns32k-encore-bsd\n"); exit (0); +#endif +#endif +#endif + +#if defined (__386BSD__) + printf ("i386-pc-bsd\n"); exit (0); +#endif + +#if defined (sequent) +#if defined (i386) + printf ("i386-sequent-dynix\n"); exit (0); +#endif +#if defined (ns32000) + printf ("ns32k-sequent-dynix\n"); exit (0); +#endif +#endif + +#if defined (_SEQUENT_) + struct utsname un; + + uname(&un); + + if (strncmp(un.version, "V2", 2) == 0) { + printf ("i386-sequent-ptx2\n"); exit (0); + } + if (strncmp(un.version, "V1", 2) == 0) { /* XXX is V1 correct? */ + printf ("i386-sequent-ptx1\n"); exit (0); + } + printf ("i386-sequent-ptx\n"); exit (0); + +#endif + +#if defined (vax) +# if !defined (ultrix) +# include +# if defined (BSD) +# if BSD == 43 + printf ("vax-dec-bsd4.3\n"); exit (0); +# else +# if BSD == 199006 + printf ("vax-dec-bsd4.3reno\n"); exit (0); +# else + printf ("vax-dec-bsd\n"); exit (0); +# endif +# endif +# else + printf ("vax-dec-bsd\n"); exit (0); +# endif +# else + printf ("vax-dec-ultrix\n"); exit (0); +# endif +#endif + +#if defined (alliant) && defined (i860) + printf ("i860-alliant-bsd\n"); exit (0); +#endif + + exit (1); +} +EOF + +$CC_FOR_BUILD -o $dummy $dummy.c 2>/dev/null && SYSTEM_NAME=`$dummy` && + { echo "$SYSTEM_NAME"; exit; } + +# Apollos put the system type in the environment. + +test -d /usr/apollo && { echo ${ISP}-apollo-${SYSTYPE}; exit; } + +# Convex versions that predate uname can use getsysinfo(1) + +if [ -x /usr/convex/getsysinfo ] +then + case `getsysinfo -f cpu_type` in + c1*) + echo c1-convex-bsd + exit ;; + c2*) + if getsysinfo -f scalar_acc + then echo c32-convex-bsd + else echo c2-convex-bsd + fi + exit ;; + c34*) + echo c34-convex-bsd + exit ;; + c38*) + echo c38-convex-bsd + exit ;; + c4*) + echo c4-convex-bsd + exit ;; + esac +fi + +cat >&2 < in order to provide the needed +information to handle your system. + +config.guess timestamp = $timestamp + +uname -m = `(uname -m) 2>/dev/null || echo unknown` +uname -r = `(uname -r) 2>/dev/null || echo unknown` +uname -s = `(uname -s) 2>/dev/null || echo unknown` +uname -v = `(uname -v) 2>/dev/null || echo unknown` + +/usr/bin/uname -p = `(/usr/bin/uname -p) 2>/dev/null` +/bin/uname -X = `(/bin/uname -X) 2>/dev/null` + +hostinfo = `(hostinfo) 2>/dev/null` +/bin/universe = `(/bin/universe) 2>/dev/null` +/usr/bin/arch -k = `(/usr/bin/arch -k) 2>/dev/null` +/bin/arch = `(/bin/arch) 2>/dev/null` +/usr/bin/oslevel = `(/usr/bin/oslevel) 2>/dev/null` +/usr/convex/getsysinfo = `(/usr/convex/getsysinfo) 2>/dev/null` + +UNAME_MACHINE = ${UNAME_MACHINE} +UNAME_RELEASE = ${UNAME_RELEASE} +UNAME_SYSTEM = ${UNAME_SYSTEM} +UNAME_VERSION = ${UNAME_VERSION} +EOF + +exit 1 + +# Local variables: +# eval: (add-hook 'write-file-hooks 'time-stamp) +# time-stamp-start: "timestamp='" +# time-stamp-format: "%:y-%02m-%02d" +# time-stamp-end: "'" +# End: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/config/config.sub --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/config/config.sub Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,1658 @@ +#! /bin/sh +# Configuration validation subroutine script. +# Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999, +# 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008 +# Free Software Foundation, Inc. + +timestamp='2008-01-16' + +# This file is (in principle) common to ALL GNU software. +# The presence of a machine in this file suggests that SOME GNU software +# can handle that machine. It does not imply ALL GNU software can. +# +# This file is free software; you can redistribute it and/or modify +# it under the terms of the GNU General Public License as published by +# the Free Software Foundation; either version 2 of the License, or +# (at your option) any later version. +# +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY; without even the implied warranty of +# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the +# GNU General Public License for more details. +# +# You should have received a copy of the GNU General Public License +# along with this program; if not, write to the Free Software +# Foundation, Inc., 51 Franklin Street - Fifth Floor, Boston, MA +# 02110-1301, USA. +# +# As a special exception to the GNU General Public License, if you +# distribute this file as part of a program that contains a +# configuration script generated by Autoconf, you may include it under +# the same distribution terms that you use for the rest of that program. + + +# Please send patches to . Submit a context +# diff and a properly formatted ChangeLog entry. +# +# Configuration subroutine to validate and canonicalize a configuration type. +# Supply the specified configuration type as an argument. +# If it is invalid, we print an error message on stderr and exit with code 1. +# Otherwise, we print the canonical config type on stdout and succeed. + +# This file is supposed to be the same for all GNU packages +# and recognize all the CPU types, system types and aliases +# that are meaningful with *any* GNU software. +# Each package is responsible for reporting which valid configurations +# it does not support. The user should be able to distinguish +# a failure to support a valid configuration from a meaningless +# configuration. + +# The goal of this file is to map all the various variations of a given +# machine specification into a single specification in the form: +# CPU_TYPE-MANUFACTURER-OPERATING_SYSTEM +# or in some cases, the newer four-part form: +# CPU_TYPE-MANUFACTURER-KERNEL-OPERATING_SYSTEM +# It is wrong to echo any other type of specification. + +me=`echo "$0" | sed -e 's,.*/,,'` + +usage="\ +Usage: $0 [OPTION] CPU-MFR-OPSYS + $0 [OPTION] ALIAS + +Canonicalize a configuration name. + +Operation modes: + -h, --help print this help, then exit + -t, --time-stamp print date of last modification, then exit + -v, --version print version number, then exit + +Report bugs and patches to ." + +version="\ +GNU config.sub ($timestamp) + +Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, +2002, 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. + +This is free software; see the source for copying conditions. There is NO +warranty; not even for MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE." + +help=" +Try \`$me --help' for more information." + +# Parse command line +while test $# -gt 0 ; do + case $1 in + --time-stamp | --time* | -t ) + echo "$timestamp" ; exit ;; + --version | -v ) + echo "$version" ; exit ;; + --help | --h* | -h ) + echo "$usage"; exit ;; + -- ) # Stop option processing + shift; break ;; + - ) # Use stdin as input. + break ;; + -* ) + echo "$me: invalid option $1$help" + exit 1 ;; + + *local*) + # First pass through any local machine types. + echo $1 + exit ;; + + * ) + break ;; + esac +done + +case $# in + 0) echo "$me: missing argument$help" >&2 + exit 1;; + 1) ;; + *) echo "$me: too many arguments$help" >&2 + exit 1;; +esac + +# Separate what the user gave into CPU-COMPANY and OS or KERNEL-OS (if any). +# Here we must recognize all the valid KERNEL-OS combinations. +maybe_os=`echo $1 | sed 's/^\(.*\)-\([^-]*-[^-]*\)$/\2/'` +case $maybe_os in + nto-qnx* | linux-gnu* | linux-dietlibc | linux-newlib* | linux-uclibc* | \ + uclinux-uclibc* | uclinux-gnu* | kfreebsd*-gnu* | knetbsd*-gnu* | netbsd*-gnu* | \ + storm-chaos* | os2-emx* | rtmk-nova*) + os=-$maybe_os + basic_machine=`echo $1 | sed 's/^\(.*\)-\([^-]*-[^-]*\)$/\1/'` + ;; + *) + basic_machine=`echo $1 | sed 's/-[^-]*$//'` + if [ $basic_machine != $1 ] + then os=`echo $1 | sed 's/.*-/-/'` + else os=; fi + ;; +esac + +### Let's recognize common machines as not being operating systems so +### that things like config.sub decstation-3100 work. We also +### recognize some manufacturers as not being operating systems, so we +### can provide default operating systems below. +case $os in + -sun*os*) + # Prevent following clause from handling this invalid input. + ;; + -dec* | -mips* | -sequent* | -encore* | -pc532* | -sgi* | -sony* | \ + -att* | -7300* | -3300* | -delta* | -motorola* | -sun[234]* | \ + -unicom* | -ibm* | -next | -hp | -isi* | -apollo | -altos* | \ + -convergent* | -ncr* | -news | -32* | -3600* | -3100* | -hitachi* |\ + -c[123]* | -convex* | -sun | -crds | -omron* | -dg | -ultra | -tti* | \ + -harris | -dolphin | -highlevel | -gould | -cbm | -ns | -masscomp | \ + -apple | -axis | -knuth | -cray) + os= + basic_machine=$1 + ;; + -sim | -cisco | -oki | -wec | -winbond) + os= + basic_machine=$1 + ;; + -scout) + ;; + -wrs) + os=-vxworks + basic_machine=$1 + ;; + -chorusos*) + os=-chorusos + basic_machine=$1 + ;; + -chorusrdb) + os=-chorusrdb + basic_machine=$1 + ;; + -hiux*) + os=-hiuxwe2 + ;; + -sco6) + os=-sco5v6 + basic_machine=`echo $1 | sed -e 's/86-.*/86-pc/'` + ;; + -sco5) + os=-sco3.2v5 + basic_machine=`echo $1 | sed -e 's/86-.*/86-pc/'` + ;; + -sco4) + os=-sco3.2v4 + basic_machine=`echo $1 | sed -e 's/86-.*/86-pc/'` + ;; + -sco3.2.[4-9]*) + os=`echo $os | sed -e 's/sco3.2./sco3.2v/'` + basic_machine=`echo $1 | sed -e 's/86-.*/86-pc/'` + ;; + -sco3.2v[4-9]*) + # Don't forget version if it is 3.2v4 or newer. + basic_machine=`echo $1 | sed -e 's/86-.*/86-pc/'` + ;; + -sco5v6*) + # Don't forget version if it is 3.2v4 or newer. + basic_machine=`echo $1 | sed -e 's/86-.*/86-pc/'` + ;; + -sco*) + os=-sco3.2v2 + basic_machine=`echo $1 | sed -e 's/86-.*/86-pc/'` + ;; + -udk*) + basic_machine=`echo $1 | sed -e 's/86-.*/86-pc/'` + ;; + -isc) + os=-isc2.2 + basic_machine=`echo $1 | sed -e 's/86-.*/86-pc/'` + ;; + -clix*) + basic_machine=clipper-intergraph + ;; + -isc*) + basic_machine=`echo $1 | sed -e 's/86-.*/86-pc/'` + ;; + -lynx*) + os=-lynxos + ;; + -ptx*) + basic_machine=`echo $1 | sed -e 's/86-.*/86-sequent/'` + ;; + -windowsnt*) + os=`echo $os | sed -e 's/windowsnt/winnt/'` + ;; + -psos*) + os=-psos + ;; + -mint | -mint[0-9]*) + basic_machine=m68k-atari + os=-mint + ;; +esac + +# Decode aliases for certain CPU-COMPANY combinations. +case $basic_machine in + # Recognize the basic CPU types without company name. + # Some are omitted here because they have special meanings below. + 1750a | 580 \ + | a29k \ + | alpha | alphaev[4-8] | alphaev56 | alphaev6[78] | alphapca5[67] \ + | alpha64 | alpha64ev[4-8] | alpha64ev56 | alpha64ev6[78] | alpha64pca5[67] \ + | am33_2.0 \ + | arc | arm | arm[bl]e | arme[lb] | armv[2345] | armv[345][lb] | avr | avr32 \ + | bfin \ + | c4x | clipper \ + | d10v | d30v | dlx | dsp16xx \ + | fido | fr30 | frv \ + | h8300 | h8500 | hppa | hppa1.[01] | hppa2.0 | hppa2.0[nw] | hppa64 \ + | i370 | i860 | i960 | ia64 \ + | ip2k | iq2000 \ + | m32c | m32r | m32rle | m68000 | m68k | m88k \ + | maxq | mb | microblaze | mcore | mep \ + | mips | mipsbe | mipseb | mipsel | mipsle \ + | mips16 \ + | mips64 | mips64el \ + | mips64vr | mips64vrel \ + | mips64orion | mips64orionel \ + | mips64vr4100 | mips64vr4100el \ + | mips64vr4300 | mips64vr4300el \ + | mips64vr5000 | mips64vr5000el \ + | mips64vr5900 | mips64vr5900el \ + | mipsisa32 | mipsisa32el \ + | mipsisa32r2 | mipsisa32r2el \ + | mipsisa64 | mipsisa64el \ + | mipsisa64r2 | mipsisa64r2el \ + | mipsisa64sb1 | mipsisa64sb1el \ + | mipsisa64sr71k | mipsisa64sr71kel \ + | mipstx39 | mipstx39el \ + | mn10200 | mn10300 \ + | mt \ + | msp430 \ + | nios | nios2 \ + | ns16k | ns32k \ + | or32 \ + | pdp10 | pdp11 | pj | pjl \ + | powerpc | powerpc64 | powerpc64le | powerpcle | ppcbe \ + | pyramid \ + | score \ + | sh | sh[1234] | sh[24]a | sh[23]e | sh[34]eb | sheb | shbe | shle | sh[1234]le | sh3ele \ + | sh64 | sh64le \ + | sparc | sparc64 | sparc64b | sparc64v | sparc86x | sparclet | sparclite \ + | sparcv8 | sparcv9 | sparcv9b | sparcv9v \ + | spu | strongarm \ + | tahoe | thumb | tic4x | tic80 | tron \ + | v850 | v850e \ + | we32k \ + | x86 | xc16x | xscale | xscalee[bl] | xstormy16 | xtensa \ + | z8k) + basic_machine=$basic_machine-unknown + ;; + m6811 | m68hc11 | m6812 | m68hc12) + # Motorola 68HC11/12. + basic_machine=$basic_machine-unknown + os=-none + ;; + m88110 | m680[12346]0 | m683?2 | m68360 | m5200 | v70 | w65 | z8k) + ;; + ms1) + basic_machine=mt-unknown + ;; + + # We use `pc' rather than `unknown' + # because (1) that's what they normally are, and + # (2) the word "unknown" tends to confuse beginning users. + i*86 | x86_64) + basic_machine=$basic_machine-pc + ;; + # Object if more than one company name word. + *-*-*) + echo Invalid configuration \`$1\': machine \`$basic_machine\' not recognized 1>&2 + exit 1 + ;; + # Recognize the basic CPU types with company name. + 580-* \ + | a29k-* \ + | alpha-* | alphaev[4-8]-* | alphaev56-* | alphaev6[78]-* \ + | alpha64-* | alpha64ev[4-8]-* | alpha64ev56-* | alpha64ev6[78]-* \ + | alphapca5[67]-* | alpha64pca5[67]-* | arc-* \ + | arm-* | armbe-* | armle-* | armeb-* | armv*-* \ + | avr-* | avr32-* \ + | bfin-* | bs2000-* \ + | c[123]* | c30-* | [cjt]90-* | c4x-* | c54x-* | c55x-* | c6x-* \ + | clipper-* | craynv-* | cydra-* \ + | d10v-* | d30v-* | dlx-* \ + | elxsi-* \ + | f30[01]-* | f700-* | fido-* | fr30-* | frv-* | fx80-* \ + | h8300-* | h8500-* \ + | hppa-* | hppa1.[01]-* | hppa2.0-* | hppa2.0[nw]-* | hppa64-* \ + | i*86-* | i860-* | i960-* | ia64-* \ + | ip2k-* | iq2000-* \ + | m32c-* | m32r-* | m32rle-* \ + | m68000-* | m680[012346]0-* | m68360-* | m683?2-* | m68k-* \ + | m88110-* | m88k-* | maxq-* | mcore-* \ + | mips-* | mipsbe-* | mipseb-* | mipsel-* | mipsle-* \ + | mips16-* \ + | mips64-* | mips64el-* \ + | mips64vr-* | mips64vrel-* \ + | mips64orion-* | mips64orionel-* \ + | mips64vr4100-* | mips64vr4100el-* \ + | mips64vr4300-* | mips64vr4300el-* \ + | mips64vr5000-* | mips64vr5000el-* \ + | mips64vr5900-* | mips64vr5900el-* \ + | mipsisa32-* | mipsisa32el-* \ + | mipsisa32r2-* | mipsisa32r2el-* \ + | mipsisa64-* | mipsisa64el-* \ + | mipsisa64r2-* | mipsisa64r2el-* \ + | mipsisa64sb1-* | mipsisa64sb1el-* \ + | mipsisa64sr71k-* | mipsisa64sr71kel-* \ + | mipstx39-* | mipstx39el-* \ + | mmix-* \ + | mt-* \ + | msp430-* \ + | nios-* | nios2-* \ + | none-* | np1-* | ns16k-* | ns32k-* \ + | orion-* \ + | pdp10-* | pdp11-* | pj-* | pjl-* | pn-* | power-* \ + | powerpc-* | powerpc64-* | powerpc64le-* | powerpcle-* | ppcbe-* \ + | pyramid-* \ + | romp-* | rs6000-* \ + | sh-* | sh[1234]-* | sh[24]a-* | sh[23]e-* | sh[34]eb-* | sheb-* | shbe-* \ + | shle-* | sh[1234]le-* | sh3ele-* | sh64-* | sh64le-* \ + | sparc-* | sparc64-* | sparc64b-* | sparc64v-* | sparc86x-* | sparclet-* \ + | sparclite-* \ + | sparcv8-* | sparcv9-* | sparcv9b-* | sparcv9v-* | strongarm-* | sv1-* | sx?-* \ + | tahoe-* | thumb-* \ + | tic30-* | tic4x-* | tic54x-* | tic55x-* | tic6x-* | tic80-* \ + | tron-* \ + | v850-* | v850e-* | vax-* \ + | we32k-* \ + | x86-* | x86_64-* | xc16x-* | xps100-* | xscale-* | xscalee[bl]-* \ + | xstormy16-* | xtensa*-* \ + | ymp-* \ + | z8k-*) + ;; + # Recognize the basic CPU types without company name, with glob match. + xtensa*) + basic_machine=$basic_machine-unknown + ;; + # Recognize the various machine names and aliases which stand + # for a CPU type and a company and sometimes even an OS. + 386bsd) + basic_machine=i386-unknown + os=-bsd + ;; + 3b1 | 7300 | 7300-att | att-7300 | pc7300 | safari | unixpc) + basic_machine=m68000-att + ;; + 3b*) + basic_machine=we32k-att + ;; + a29khif) + basic_machine=a29k-amd + os=-udi + ;; + abacus) + basic_machine=abacus-unknown + ;; + adobe68k) + basic_machine=m68010-adobe + os=-scout + ;; + alliant | fx80) + basic_machine=fx80-alliant + ;; + altos | altos3068) + basic_machine=m68k-altos + ;; + am29k) + basic_machine=a29k-none + os=-bsd + ;; + amd64) + basic_machine=x86_64-pc + ;; + amd64-*) + basic_machine=x86_64-`echo $basic_machine | sed 's/^[^-]*-//'` + ;; + amdahl) + basic_machine=580-amdahl + os=-sysv + ;; + amiga | amiga-*) + basic_machine=m68k-unknown + ;; + amigaos | amigados) + basic_machine=m68k-unknown + os=-amigaos + ;; + amigaunix | amix) + basic_machine=m68k-unknown + os=-sysv4 + ;; + apollo68) + basic_machine=m68k-apollo + os=-sysv + ;; + apollo68bsd) + basic_machine=m68k-apollo + os=-bsd + ;; + aux) + basic_machine=m68k-apple + os=-aux + ;; + balance) + basic_machine=ns32k-sequent + os=-dynix + ;; + blackfin) + basic_machine=bfin-unknown + os=-linux + ;; + blackfin-*) + basic_machine=bfin-`echo $basic_machine | sed 's/^[^-]*-//'` + os=-linux + ;; + c90) + basic_machine=c90-cray + os=-unicos + ;; + convex-c1) + basic_machine=c1-convex + os=-bsd + ;; + convex-c2) + basic_machine=c2-convex + os=-bsd + ;; + convex-c32) + basic_machine=c32-convex + os=-bsd + ;; + convex-c34) + basic_machine=c34-convex + os=-bsd + ;; + convex-c38) + basic_machine=c38-convex + os=-bsd + ;; + cray | j90) + basic_machine=j90-cray + os=-unicos + ;; + craynv) + basic_machine=craynv-cray + os=-unicosmp + ;; + cr16) + basic_machine=cr16-unknown + os=-elf + ;; + crds | unos) + basic_machine=m68k-crds + ;; + crisv32 | crisv32-* | etraxfs*) + basic_machine=crisv32-axis + ;; + cris | cris-* | etrax*) + basic_machine=cris-axis + ;; + crx) + basic_machine=crx-unknown + os=-elf + ;; + da30 | da30-*) + basic_machine=m68k-da30 + ;; + decstation | decstation-3100 | pmax | pmax-* | pmin | dec3100 | decstatn) + basic_machine=mips-dec + ;; + decsystem10* | dec10*) + basic_machine=pdp10-dec + os=-tops10 + ;; + decsystem20* | dec20*) + basic_machine=pdp10-dec + os=-tops20 + ;; + delta | 3300 | motorola-3300 | motorola-delta \ + | 3300-motorola | delta-motorola) + basic_machine=m68k-motorola + ;; + delta88) + basic_machine=m88k-motorola + os=-sysv3 + ;; + djgpp) + basic_machine=i586-pc + os=-msdosdjgpp + ;; + dpx20 | dpx20-*) + basic_machine=rs6000-bull + os=-bosx + ;; + dpx2* | dpx2*-bull) + basic_machine=m68k-bull + os=-sysv3 + ;; + ebmon29k) + basic_machine=a29k-amd + os=-ebmon + ;; + elxsi) + basic_machine=elxsi-elxsi + os=-bsd + ;; + encore | umax | mmax) + basic_machine=ns32k-encore + ;; + es1800 | OSE68k | ose68k | ose | OSE) + basic_machine=m68k-ericsson + os=-ose + ;; + fx2800) + basic_machine=i860-alliant + ;; + genix) + basic_machine=ns32k-ns + ;; + gmicro) + basic_machine=tron-gmicro + os=-sysv + ;; + go32) + basic_machine=i386-pc + os=-go32 + ;; + h3050r* | hiux*) + basic_machine=hppa1.1-hitachi + os=-hiuxwe2 + ;; + h8300hms) + basic_machine=h8300-hitachi + os=-hms + ;; + h8300xray) + basic_machine=h8300-hitachi + os=-xray + ;; + h8500hms) + basic_machine=h8500-hitachi + os=-hms + ;; + harris) + basic_machine=m88k-harris + os=-sysv3 + ;; + hp300-*) + basic_machine=m68k-hp + ;; + hp300bsd) + basic_machine=m68k-hp + os=-bsd + ;; + hp300hpux) + basic_machine=m68k-hp + os=-hpux + ;; + hp3k9[0-9][0-9] | hp9[0-9][0-9]) + basic_machine=hppa1.0-hp + ;; + hp9k2[0-9][0-9] | hp9k31[0-9]) + basic_machine=m68000-hp + ;; + hp9k3[2-9][0-9]) + basic_machine=m68k-hp + ;; + hp9k6[0-9][0-9] | hp6[0-9][0-9]) + basic_machine=hppa1.0-hp + ;; + hp9k7[0-79][0-9] | hp7[0-79][0-9]) + basic_machine=hppa1.1-hp + ;; + hp9k78[0-9] | hp78[0-9]) + # FIXME: really hppa2.0-hp + basic_machine=hppa1.1-hp + ;; + hp9k8[67]1 | hp8[67]1 | hp9k80[24] | hp80[24] | hp9k8[78]9 | hp8[78]9 | hp9k893 | hp893) + # FIXME: really hppa2.0-hp + basic_machine=hppa1.1-hp + ;; + hp9k8[0-9][13679] | hp8[0-9][13679]) + basic_machine=hppa1.1-hp + ;; + hp9k8[0-9][0-9] | hp8[0-9][0-9]) + basic_machine=hppa1.0-hp + ;; + hppa-next) + os=-nextstep3 + ;; + hppaosf) + basic_machine=hppa1.1-hp + os=-osf + ;; + hppro) + basic_machine=hppa1.1-hp + os=-proelf + ;; + i370-ibm* | ibm*) + basic_machine=i370-ibm + ;; +# I'm not sure what "Sysv32" means. Should this be sysv3.2? + i*86v32) + basic_machine=`echo $1 | sed -e 's/86.*/86-pc/'` + os=-sysv32 + ;; + i*86v4*) + basic_machine=`echo $1 | sed -e 's/86.*/86-pc/'` + os=-sysv4 + ;; + i*86v) + basic_machine=`echo $1 | sed -e 's/86.*/86-pc/'` + os=-sysv + ;; + i*86sol2) + basic_machine=`echo $1 | sed -e 's/86.*/86-pc/'` + os=-solaris2 + ;; + i386mach) + basic_machine=i386-mach + os=-mach + ;; + i386-vsta | vsta) + basic_machine=i386-unknown + os=-vsta + ;; + iris | iris4d) + basic_machine=mips-sgi + case $os in + -irix*) + ;; + *) + os=-irix4 + ;; + esac + ;; + isi68 | isi) + basic_machine=m68k-isi + os=-sysv + ;; + m68knommu) + basic_machine=m68k-unknown + os=-linux + ;; + m68knommu-*) + basic_machine=m68k-`echo $basic_machine | sed 's/^[^-]*-//'` + os=-linux + ;; + m88k-omron*) + basic_machine=m88k-omron + ;; + magnum | m3230) + basic_machine=mips-mips + os=-sysv + ;; + merlin) + basic_machine=ns32k-utek + os=-sysv + ;; + mingw32) + basic_machine=i386-pc + os=-mingw32 + ;; + mingw32ce) + basic_machine=arm-unknown + os=-mingw32ce + ;; + miniframe) + basic_machine=m68000-convergent + ;; + *mint | -mint[0-9]* | *MiNT | *MiNT[0-9]*) + basic_machine=m68k-atari + os=-mint + ;; + mips3*-*) + basic_machine=`echo $basic_machine | sed -e 's/mips3/mips64/'` + ;; + mips3*) + basic_machine=`echo $basic_machine | sed -e 's/mips3/mips64/'`-unknown + ;; + monitor) + basic_machine=m68k-rom68k + os=-coff + ;; + morphos) + basic_machine=powerpc-unknown + os=-morphos + ;; + msdos) + basic_machine=i386-pc + os=-msdos + ;; + ms1-*) + basic_machine=`echo $basic_machine | sed -e 's/ms1-/mt-/'` + ;; + mvs) + basic_machine=i370-ibm + os=-mvs + ;; + ncr3000) + basic_machine=i486-ncr + os=-sysv4 + ;; + netbsd386) + basic_machine=i386-unknown + os=-netbsd + ;; + netwinder) + basic_machine=armv4l-rebel + os=-linux + ;; + news | news700 | news800 | news900) + basic_machine=m68k-sony + os=-newsos + ;; + news1000) + basic_machine=m68030-sony + os=-newsos + ;; + news-3600 | risc-news) + basic_machine=mips-sony + os=-newsos + ;; + necv70) + basic_machine=v70-nec + os=-sysv + ;; + next | m*-next ) + basic_machine=m68k-next + case $os in + -nextstep* ) + ;; + -ns2*) + os=-nextstep2 + ;; + *) + os=-nextstep3 + ;; + esac + ;; + nh3000) + basic_machine=m68k-harris + os=-cxux + ;; + nh[45]000) + basic_machine=m88k-harris + os=-cxux + ;; + nindy960) + basic_machine=i960-intel + os=-nindy + ;; + mon960) + basic_machine=i960-intel + os=-mon960 + ;; + nonstopux) + basic_machine=mips-compaq + os=-nonstopux + ;; + np1) + basic_machine=np1-gould + ;; + nsr-tandem) + basic_machine=nsr-tandem + ;; + op50n-* | op60c-*) + basic_machine=hppa1.1-oki + os=-proelf + ;; + openrisc | openrisc-*) + basic_machine=or32-unknown + ;; + os400) + basic_machine=powerpc-ibm + os=-os400 + ;; + OSE68000 | ose68000) + basic_machine=m68000-ericsson + os=-ose + ;; + os68k) + basic_machine=m68k-none + os=-os68k + ;; + pa-hitachi) + basic_machine=hppa1.1-hitachi + os=-hiuxwe2 + ;; + paragon) + basic_machine=i860-intel + os=-osf + ;; + parisc) + basic_machine=hppa-unknown + os=-linux + ;; + parisc-*) + basic_machine=hppa-`echo $basic_machine | sed 's/^[^-]*-//'` + os=-linux + ;; + pbd) + basic_machine=sparc-tti + ;; + pbb) + basic_machine=m68k-tti + ;; + pc532 | pc532-*) + basic_machine=ns32k-pc532 + ;; + pc98) + basic_machine=i386-pc + ;; + pc98-*) + basic_machine=i386-`echo $basic_machine | sed 's/^[^-]*-//'` + ;; + pentium | p5 | k5 | k6 | nexgen | viac3) + basic_machine=i586-pc + ;; + pentiumpro | p6 | 6x86 | athlon | athlon_*) + basic_machine=i686-pc + ;; + pentiumii | pentium2 | pentiumiii | pentium3) + basic_machine=i686-pc + ;; + pentium4) + basic_machine=i786-pc + ;; + pentium-* | p5-* | k5-* | k6-* | nexgen-* | viac3-*) + basic_machine=i586-`echo $basic_machine | sed 's/^[^-]*-//'` + ;; + pentiumpro-* | p6-* | 6x86-* | athlon-*) + basic_machine=i686-`echo $basic_machine | sed 's/^[^-]*-//'` + ;; + pentiumii-* | pentium2-* | pentiumiii-* | pentium3-*) + basic_machine=i686-`echo $basic_machine | sed 's/^[^-]*-//'` + ;; + pentium4-*) + basic_machine=i786-`echo $basic_machine | sed 's/^[^-]*-//'` + ;; + pn) + basic_machine=pn-gould + ;; + power) basic_machine=power-ibm + ;; + ppc) basic_machine=powerpc-unknown + ;; + ppc-*) basic_machine=powerpc-`echo $basic_machine | sed 's/^[^-]*-//'` + ;; + ppcle | powerpclittle | ppc-le | powerpc-little) + basic_machine=powerpcle-unknown + ;; + ppcle-* | powerpclittle-*) + basic_machine=powerpcle-`echo $basic_machine | sed 's/^[^-]*-//'` + ;; + ppc64) basic_machine=powerpc64-unknown + ;; + ppc64-*) basic_machine=powerpc64-`echo $basic_machine | sed 's/^[^-]*-//'` + ;; + ppc64le | powerpc64little | ppc64-le | powerpc64-little) + basic_machine=powerpc64le-unknown + ;; + ppc64le-* | powerpc64little-*) + basic_machine=powerpc64le-`echo $basic_machine | sed 's/^[^-]*-//'` + ;; + ps2) + basic_machine=i386-ibm + ;; + pw32) + basic_machine=i586-unknown + os=-pw32 + ;; + rdos) + basic_machine=i386-pc + os=-rdos + ;; + rom68k) + basic_machine=m68k-rom68k + os=-coff + ;; + rm[46]00) + basic_machine=mips-siemens + ;; + rtpc | rtpc-*) + basic_machine=romp-ibm + ;; + s390 | s390-*) + basic_machine=s390-ibm + ;; + s390x | s390x-*) + basic_machine=s390x-ibm + ;; + sa29200) + basic_machine=a29k-amd + os=-udi + ;; + sb1) + basic_machine=mipsisa64sb1-unknown + ;; + sb1el) + basic_machine=mipsisa64sb1el-unknown + ;; + sde) + basic_machine=mipsisa32-sde + os=-elf + ;; + sei) + basic_machine=mips-sei + os=-seiux + ;; + sequent) + basic_machine=i386-sequent + ;; + sh) + basic_machine=sh-hitachi + os=-hms + ;; + sh5el) + basic_machine=sh5le-unknown + ;; + sh64) + basic_machine=sh64-unknown + ;; + sparclite-wrs | simso-wrs) + basic_machine=sparclite-wrs + os=-vxworks + ;; + sps7) + basic_machine=m68k-bull + os=-sysv2 + ;; + spur) + basic_machine=spur-unknown + ;; + st2000) + basic_machine=m68k-tandem + ;; + stratus) + basic_machine=i860-stratus + os=-sysv4 + ;; + sun2) + basic_machine=m68000-sun + ;; + sun2os3) + basic_machine=m68000-sun + os=-sunos3 + ;; + sun2os4) + basic_machine=m68000-sun + os=-sunos4 + ;; + sun3os3) + basic_machine=m68k-sun + os=-sunos3 + ;; + sun3os4) + basic_machine=m68k-sun + os=-sunos4 + ;; + sun4os3) + basic_machine=sparc-sun + os=-sunos3 + ;; + sun4os4) + basic_machine=sparc-sun + os=-sunos4 + ;; + sun4sol2) + basic_machine=sparc-sun + os=-solaris2 + ;; + sun3 | sun3-*) + basic_machine=m68k-sun + ;; + sun4) + basic_machine=sparc-sun + ;; + sun386 | sun386i | roadrunner) + basic_machine=i386-sun + ;; + sv1) + basic_machine=sv1-cray + os=-unicos + ;; + symmetry) + basic_machine=i386-sequent + os=-dynix + ;; + t3e) + basic_machine=alphaev5-cray + os=-unicos + ;; + t90) + basic_machine=t90-cray + os=-unicos + ;; + tic54x | c54x*) + basic_machine=tic54x-unknown + os=-coff + ;; + tic55x | c55x*) + basic_machine=tic55x-unknown + os=-coff + ;; + tic6x | c6x*) + basic_machine=tic6x-unknown + os=-coff + ;; + tile*) + basic_machine=tile-unknown + os=-linux-gnu + ;; + tx39) + basic_machine=mipstx39-unknown + ;; + tx39el) + basic_machine=mipstx39el-unknown + ;; + toad1) + basic_machine=pdp10-xkl + os=-tops20 + ;; + tower | tower-32) + basic_machine=m68k-ncr + ;; + tpf) + basic_machine=s390x-ibm + os=-tpf + ;; + udi29k) + basic_machine=a29k-amd + os=-udi + ;; + ultra3) + basic_machine=a29k-nyu + os=-sym1 + ;; + v810 | necv810) + basic_machine=v810-nec + os=-none + ;; + vaxv) + basic_machine=vax-dec + os=-sysv + ;; + vms) + basic_machine=vax-dec + os=-vms + ;; + vpp*|vx|vx-*) + basic_machine=f301-fujitsu + ;; + vxworks960) + basic_machine=i960-wrs + os=-vxworks + ;; + vxworks68) + basic_machine=m68k-wrs + os=-vxworks + ;; + vxworks29k) + basic_machine=a29k-wrs + os=-vxworks + ;; + w65*) + basic_machine=w65-wdc + os=-none + ;; + w89k-*) + basic_machine=hppa1.1-winbond + os=-proelf + ;; + xbox) + basic_machine=i686-pc + os=-mingw32 + ;; + xps | xps100) + basic_machine=xps100-honeywell + ;; + ymp) + basic_machine=ymp-cray + os=-unicos + ;; + z8k-*-coff) + basic_machine=z8k-unknown + os=-sim + ;; + none) + basic_machine=none-none + os=-none + ;; + +# Here we handle the default manufacturer of certain CPU types. It is in +# some cases the only manufacturer, in others, it is the most popular. + w89k) + basic_machine=hppa1.1-winbond + ;; + op50n) + basic_machine=hppa1.1-oki + ;; + op60c) + basic_machine=hppa1.1-oki + ;; + romp) + basic_machine=romp-ibm + ;; + mmix) + basic_machine=mmix-knuth + ;; + rs6000) + basic_machine=rs6000-ibm + ;; + vax) + basic_machine=vax-dec + ;; + pdp10) + # there are many clones, so DEC is not a safe bet + basic_machine=pdp10-unknown + ;; + pdp11) + basic_machine=pdp11-dec + ;; + we32k) + basic_machine=we32k-att + ;; + sh[1234] | sh[24]a | sh[34]eb | sh[1234]le | sh[23]ele) + basic_machine=sh-unknown + ;; + sparc | sparcv8 | sparcv9 | sparcv9b | sparcv9v) + basic_machine=sparc-sun + ;; + cydra) + basic_machine=cydra-cydrome + ;; + orion) + basic_machine=orion-highlevel + ;; + orion105) + basic_machine=clipper-highlevel + ;; + mac | mpw | mac-mpw) + basic_machine=m68k-apple + ;; + pmac | pmac-mpw) + basic_machine=powerpc-apple + ;; + *-unknown) + # Make sure to match an already-canonicalized machine name. + ;; + *) + echo Invalid configuration \`$1\': machine \`$basic_machine\' not recognized 1>&2 + exit 1 + ;; +esac + +# Here we canonicalize certain aliases for manufacturers. +case $basic_machine in + *-digital*) + basic_machine=`echo $basic_machine | sed 's/digital.*/dec/'` + ;; + *-commodore*) + basic_machine=`echo $basic_machine | sed 's/commodore.*/cbm/'` + ;; + *) + ;; +esac + +# Decode manufacturer-specific aliases for certain operating systems. + +if [ x"$os" != x"" ] +then +case $os in + # First match some system type aliases + # that might get confused with valid system types. + # -solaris* is a basic system type, with this one exception. + -solaris1 | -solaris1.*) + os=`echo $os | sed -e 's|solaris1|sunos4|'` + ;; + -solaris) + os=-solaris2 + ;; + -svr4*) + os=-sysv4 + ;; + -unixware*) + os=-sysv4.2uw + ;; + -gnu/linux*) + os=`echo $os | sed -e 's|gnu/linux|linux-gnu|'` + ;; + # First accept the basic system types. + # The portable systems comes first. + # Each alternative MUST END IN A *, to match a version number. + # -sysv* is not here because it comes later, after sysvr4. + -gnu* | -bsd* | -mach* | -minix* | -genix* | -ultrix* | -irix* \ + | -*vms* | -sco* | -esix* | -isc* | -aix* | -sunos | -sunos[34]*\ + | -hpux* | -unos* | -osf* | -luna* | -dgux* | -solaris* | -sym* \ + | -amigaos* | -amigados* | -msdos* | -newsos* | -unicos* | -aof* \ + | -aos* \ + | -nindy* | -vxsim* | -vxworks* | -ebmon* | -hms* | -mvs* \ + | -clix* | -riscos* | -uniplus* | -iris* | -rtu* | -xenix* \ + | -hiux* | -386bsd* | -knetbsd* | -mirbsd* | -netbsd* \ + | -openbsd* | -solidbsd* \ + | -ekkobsd* | -kfreebsd* | -freebsd* | -riscix* | -lynxos* \ + | -bosx* | -nextstep* | -cxux* | -aout* | -elf* | -oabi* \ + | -ptx* | -coff* | -ecoff* | -winnt* | -domain* | -vsta* \ + | -udi* | -eabi* | -lites* | -ieee* | -go32* | -aux* \ + | -chorusos* | -chorusrdb* \ + | -cygwin* | -pe* | -psos* | -moss* | -proelf* | -rtems* \ + | -mingw32* | -linux-gnu* | -linux-newlib* | -linux-uclibc* \ + | -uxpv* | -beos* | -mpeix* | -udk* \ + | -interix* | -uwin* | -mks* | -rhapsody* | -darwin* | -opened* \ + | -openstep* | -oskit* | -conix* | -pw32* | -nonstopux* \ + | -storm-chaos* | -tops10* | -tenex* | -tops20* | -its* \ + | -os2* | -vos* | -palmos* | -uclinux* | -nucleus* \ + | -morphos* | -superux* | -rtmk* | -rtmk-nova* | -windiss* \ + | -powermax* | -dnix* | -nx6 | -nx7 | -sei* | -dragonfly* \ + | -skyos* | -haiku* | -rdos* | -toppers* | -drops*) + # Remember, each alternative MUST END IN *, to match a version number. + ;; + -qnx*) + case $basic_machine in + x86-* | i*86-*) + ;; + *) + os=-nto$os + ;; + esac + ;; + -nto-qnx*) + ;; + -nto*) + os=`echo $os | sed -e 's|nto|nto-qnx|'` + ;; + -sim | -es1800* | -hms* | -xray | -os68k* | -none* | -v88r* \ + | -windows* | -osx | -abug | -netware* | -os9* | -beos* | -haiku* \ + | -macos* | -mpw* | -magic* | -mmixware* | -mon960* | -lnews*) + ;; + -mac*) + os=`echo $os | sed -e 's|mac|macos|'` + ;; + -linux-dietlibc) + os=-linux-dietlibc + ;; + -linux*) + os=`echo $os | sed -e 's|linux|linux-gnu|'` + ;; + -sunos5*) + os=`echo $os | sed -e 's|sunos5|solaris2|'` + ;; + -sunos6*) + os=`echo $os | sed -e 's|sunos6|solaris3|'` + ;; + -opened*) + os=-openedition + ;; + -os400*) + os=-os400 + ;; + -wince*) + os=-wince + ;; + -osfrose*) + os=-osfrose + ;; + -osf*) + os=-osf + ;; + -utek*) + os=-bsd + ;; + -dynix*) + os=-bsd + ;; + -acis*) + os=-aos + ;; + -atheos*) + os=-atheos + ;; + -syllable*) + os=-syllable + ;; + -386bsd) + os=-bsd + ;; + -ctix* | -uts*) + os=-sysv + ;; + -nova*) + os=-rtmk-nova + ;; + -ns2 ) + os=-nextstep2 + ;; + -nsk*) + os=-nsk + ;; + # Preserve the version number of sinix5. + -sinix5.*) + os=`echo $os | sed -e 's|sinix|sysv|'` + ;; + -sinix*) + os=-sysv4 + ;; + -tpf*) + os=-tpf + ;; + -triton*) + os=-sysv3 + ;; + -oss*) + os=-sysv3 + ;; + -svr4) + os=-sysv4 + ;; + -svr3) + os=-sysv3 + ;; + -sysvr4) + os=-sysv4 + ;; + # This must come after -sysvr4. + -sysv*) + ;; + -ose*) + os=-ose + ;; + -es1800*) + os=-ose + ;; + -xenix) + os=-xenix + ;; + -*mint | -mint[0-9]* | -*MiNT | -MiNT[0-9]*) + os=-mint + ;; + -aros*) + os=-aros + ;; + -kaos*) + os=-kaos + ;; + -zvmoe) + os=-zvmoe + ;; + -none) + ;; + *) + # Get rid of the `-' at the beginning of $os. + os=`echo $os | sed 's/[^-]*-//'` + echo Invalid configuration \`$1\': system \`$os\' not recognized 1>&2 + exit 1 + ;; +esac +else + +# Here we handle the default operating systems that come with various machines. +# The value should be what the vendor currently ships out the door with their +# machine or put another way, the most popular os provided with the machine. + +# Note that if you're going to try to match "-MANUFACTURER" here (say, +# "-sun"), then you have to tell the case statement up towards the top +# that MANUFACTURER isn't an operating system. Otherwise, code above +# will signal an error saying that MANUFACTURER isn't an operating +# system, and we'll never get to this point. + +case $basic_machine in + score-*) + os=-elf + ;; + spu-*) + os=-elf + ;; + *-acorn) + os=-riscix1.2 + ;; + arm*-rebel) + os=-linux + ;; + arm*-semi) + os=-aout + ;; + c4x-* | tic4x-*) + os=-coff + ;; + # This must come before the *-dec entry. + pdp10-*) + os=-tops20 + ;; + pdp11-*) + os=-none + ;; + *-dec | vax-*) + os=-ultrix4.2 + ;; + m68*-apollo) + os=-domain + ;; + i386-sun) + os=-sunos4.0.2 + ;; + m68000-sun) + os=-sunos3 + # This also exists in the configure program, but was not the + # default. + # os=-sunos4 + ;; + m68*-cisco) + os=-aout + ;; + mep-*) + os=-elf + ;; + mips*-cisco) + os=-elf + ;; + mips*-*) + os=-elf + ;; + or32-*) + os=-coff + ;; + *-tti) # must be before sparc entry or we get the wrong os. + os=-sysv3 + ;; + sparc-* | *-sun) + os=-sunos4.1.1 + ;; + *-be) + os=-beos + ;; + *-haiku) + os=-haiku + ;; + *-ibm) + os=-aix + ;; + *-knuth) + os=-mmixware + ;; + *-wec) + os=-proelf + ;; + *-winbond) + os=-proelf + ;; + *-oki) + os=-proelf + ;; + *-hp) + os=-hpux + ;; + *-hitachi) + os=-hiux + ;; + i860-* | *-att | *-ncr | *-altos | *-motorola | *-convergent) + os=-sysv + ;; + *-cbm) + os=-amigaos + ;; + *-dg) + os=-dgux + ;; + *-dolphin) + os=-sysv3 + ;; + m68k-ccur) + os=-rtu + ;; + m88k-omron*) + os=-luna + ;; + *-next ) + os=-nextstep + ;; + *-sequent) + os=-ptx + ;; + *-crds) + os=-unos + ;; + *-ns) + os=-genix + ;; + i370-*) + os=-mvs + ;; + *-next) + os=-nextstep3 + ;; + *-gould) + os=-sysv + ;; + *-highlevel) + os=-bsd + ;; + *-encore) + os=-bsd + ;; + *-sgi) + os=-irix + ;; + *-siemens) + os=-sysv4 + ;; + *-masscomp) + os=-rtu + ;; + f30[01]-fujitsu | f700-fujitsu) + os=-uxpv + ;; + *-rom68k) + os=-coff + ;; + *-*bug) + os=-coff + ;; + *-apple) + os=-macos + ;; + *-atari*) + os=-mint + ;; + *) + os=-none + ;; +esac +fi + +# Here we handle the case where we know the os, and the CPU type, but not the +# manufacturer. We pick the logical manufacturer. +vendor=unknown +case $basic_machine in + *-unknown) + case $os in + -riscix*) + vendor=acorn + ;; + -sunos*) + vendor=sun + ;; + -aix*) + vendor=ibm + ;; + -beos*) + vendor=be + ;; + -hpux*) + vendor=hp + ;; + -mpeix*) + vendor=hp + ;; + -hiux*) + vendor=hitachi + ;; + -unos*) + vendor=crds + ;; + -dgux*) + vendor=dg + ;; + -luna*) + vendor=omron + ;; + -genix*) + vendor=ns + ;; + -mvs* | -opened*) + vendor=ibm + ;; + -os400*) + vendor=ibm + ;; + -ptx*) + vendor=sequent + ;; + -tpf*) + vendor=ibm + ;; + -vxsim* | -vxworks* | -windiss*) + vendor=wrs + ;; + -aux*) + vendor=apple + ;; + -hms*) + vendor=hitachi + ;; + -mpw* | -macos*) + vendor=apple + ;; + -*mint | -mint[0-9]* | -*MiNT | -MiNT[0-9]*) + vendor=atari + ;; + -vos*) + vendor=stratus + ;; + esac + basic_machine=`echo $basic_machine | sed "s/unknown/$vendor/"` + ;; +esac + +echo $basic_machine$os +exit + +# Local variables: +# eval: (add-hook 'write-file-hooks 'time-stamp) +# time-stamp-start: "timestamp='" +# time-stamp-format: "%:y-%02m-%02d" +# time-stamp-end: "'" +# End: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/config/depcomp --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/config/depcomp Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,589 @@ +#! /bin/sh +# depcomp - compile a program generating dependencies as side-effects + +scriptversion=2007-03-29.01 + +# Copyright (C) 1999, 2000, 2003, 2004, 2005, 2006, 2007 Free Software +# Foundation, Inc. + +# This program is free software; you can redistribute it and/or modify +# it under the terms of the GNU General Public License as published by +# the Free Software Foundation; either version 2, or (at your option) +# any later version. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY; without even the implied warranty of +# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the +# GNU General Public License for more details. + +# You should have received a copy of the GNU General Public License +# along with this program; if not, write to the Free Software +# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA +# 02110-1301, USA. + +# As a special exception to the GNU General Public License, if you +# distribute this file as part of a program that contains a +# configuration script generated by Autoconf, you may include it under +# the same distribution terms that you use for the rest of that program. + +# Originally written by Alexandre Oliva . + +case $1 in + '') + echo "$0: No command. Try \`$0 --help' for more information." 1>&2 + exit 1; + ;; + -h | --h*) + cat <<\EOF +Usage: depcomp [--help] [--version] PROGRAM [ARGS] + +Run PROGRAMS ARGS to compile a file, generating dependencies +as side-effects. + +Environment variables: + depmode Dependency tracking mode. + source Source file read by `PROGRAMS ARGS'. + object Object file output by `PROGRAMS ARGS'. + DEPDIR directory where to store dependencies. + depfile Dependency file to output. + tmpdepfile Temporary file to use when outputing dependencies. + libtool Whether libtool is used (yes/no). + +Report bugs to . +EOF + exit $? + ;; + -v | --v*) + echo "depcomp $scriptversion" + exit $? + ;; +esac + +if test -z "$depmode" || test -z "$source" || test -z "$object"; then + echo "depcomp: Variables source, object and depmode must be set" 1>&2 + exit 1 +fi + +# Dependencies for sub/bar.o or sub/bar.obj go into sub/.deps/bar.Po. +depfile=${depfile-`echo "$object" | + sed 's|[^\\/]*$|'${DEPDIR-.deps}'/&|;s|\.\([^.]*\)$|.P\1|;s|Pobj$|Po|'`} +tmpdepfile=${tmpdepfile-`echo "$depfile" | sed 's/\.\([^.]*\)$/.T\1/'`} + +rm -f "$tmpdepfile" + +# Some modes work just like other modes, but use different flags. We +# parameterize here, but still list the modes in the big case below, +# to make depend.m4 easier to write. Note that we *cannot* use a case +# here, because this file can only contain one case statement. +if test "$depmode" = hp; then + # HP compiler uses -M and no extra arg. + gccflag=-M + depmode=gcc +fi + +if test "$depmode" = dashXmstdout; then + # This is just like dashmstdout with a different argument. + dashmflag=-xM + depmode=dashmstdout +fi + +case "$depmode" in +gcc3) +## gcc 3 implements dependency tracking that does exactly what +## we want. Yay! Note: for some reason libtool 1.4 doesn't like +## it if -MD -MP comes after the -MF stuff. Hmm. +## Unfortunately, FreeBSD c89 acceptance of flags depends upon +## the command line argument order; so add the flags where they +## appear in depend2.am. Note that the slowdown incurred here +## affects only configure: in makefiles, %FASTDEP% shortcuts this. + for arg + do + case $arg in + -c) set fnord "$@" -MT "$object" -MD -MP -MF "$tmpdepfile" "$arg" ;; + *) set fnord "$@" "$arg" ;; + esac + shift # fnord + shift # $arg + done + "$@" + stat=$? + if test $stat -eq 0; then : + else + rm -f "$tmpdepfile" + exit $stat + fi + mv "$tmpdepfile" "$depfile" + ;; + +gcc) +## There are various ways to get dependency output from gcc. Here's +## why we pick this rather obscure method: +## - Don't want to use -MD because we'd like the dependencies to end +## up in a subdir. Having to rename by hand is ugly. +## (We might end up doing this anyway to support other compilers.) +## - The DEPENDENCIES_OUTPUT environment variable makes gcc act like +## -MM, not -M (despite what the docs say). +## - Using -M directly means running the compiler twice (even worse +## than renaming). + if test -z "$gccflag"; then + gccflag=-MD, + fi + "$@" -Wp,"$gccflag$tmpdepfile" + stat=$? + if test $stat -eq 0; then : + else + rm -f "$tmpdepfile" + exit $stat + fi + rm -f "$depfile" + echo "$object : \\" > "$depfile" + alpha=ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz +## The second -e expression handles DOS-style file names with drive letters. + sed -e 's/^[^:]*: / /' \ + -e 's/^['$alpha']:\/[^:]*: / /' < "$tmpdepfile" >> "$depfile" +## This next piece of magic avoids the `deleted header file' problem. +## The problem is that when a header file which appears in a .P file +## is deleted, the dependency causes make to die (because there is +## typically no way to rebuild the header). We avoid this by adding +## dummy dependencies for each header file. Too bad gcc doesn't do +## this for us directly. + tr ' ' ' +' < "$tmpdepfile" | +## Some versions of gcc put a space before the `:'. On the theory +## that the space means something, we add a space to the output as +## well. +## Some versions of the HPUX 10.20 sed can't process this invocation +## correctly. Breaking it into two sed invocations is a workaround. + sed -e 's/^\\$//' -e '/^$/d' -e '/:$/d' | sed -e 's/$/ :/' >> "$depfile" + rm -f "$tmpdepfile" + ;; + +hp) + # This case exists only to let depend.m4 do its work. It works by + # looking at the text of this script. This case will never be run, + # since it is checked for above. + exit 1 + ;; + +sgi) + if test "$libtool" = yes; then + "$@" "-Wp,-MDupdate,$tmpdepfile" + else + "$@" -MDupdate "$tmpdepfile" + fi + stat=$? + if test $stat -eq 0; then : + else + rm -f "$tmpdepfile" + exit $stat + fi + rm -f "$depfile" + + if test -f "$tmpdepfile"; then # yes, the sourcefile depend on other files + echo "$object : \\" > "$depfile" + + # Clip off the initial element (the dependent). Don't try to be + # clever and replace this with sed code, as IRIX sed won't handle + # lines with more than a fixed number of characters (4096 in + # IRIX 6.2 sed, 8192 in IRIX 6.5). We also remove comment lines; + # the IRIX cc adds comments like `#:fec' to the end of the + # dependency line. + tr ' ' ' +' < "$tmpdepfile" \ + | sed -e 's/^.*\.o://' -e 's/#.*$//' -e '/^$/ d' | \ + tr ' +' ' ' >> $depfile + echo >> $depfile + + # The second pass generates a dummy entry for each header file. + tr ' ' ' +' < "$tmpdepfile" \ + | sed -e 's/^.*\.o://' -e 's/#.*$//' -e '/^$/ d' -e 's/$/:/' \ + >> $depfile + else + # The sourcefile does not contain any dependencies, so just + # store a dummy comment line, to avoid errors with the Makefile + # "include basename.Plo" scheme. + echo "#dummy" > "$depfile" + fi + rm -f "$tmpdepfile" + ;; + +aix) + # The C for AIX Compiler uses -M and outputs the dependencies + # in a .u file. In older versions, this file always lives in the + # current directory. Also, the AIX compiler puts `$object:' at the + # start of each line; $object doesn't have directory information. + # Version 6 uses the directory in both cases. + dir=`echo "$object" | sed -e 's|/[^/]*$|/|'` + test "x$dir" = "x$object" && dir= + base=`echo "$object" | sed -e 's|^.*/||' -e 's/\.o$//' -e 's/\.lo$//'` + if test "$libtool" = yes; then + tmpdepfile1=$dir$base.u + tmpdepfile2=$base.u + tmpdepfile3=$dir.libs/$base.u + "$@" -Wc,-M + else + tmpdepfile1=$dir$base.u + tmpdepfile2=$dir$base.u + tmpdepfile3=$dir$base.u + "$@" -M + fi + stat=$? + + if test $stat -eq 0; then : + else + rm -f "$tmpdepfile1" "$tmpdepfile2" "$tmpdepfile3" + exit $stat + fi + + for tmpdepfile in "$tmpdepfile1" "$tmpdepfile2" "$tmpdepfile3" + do + test -f "$tmpdepfile" && break + done + if test -f "$tmpdepfile"; then + # Each line is of the form `foo.o: dependent.h'. + # Do two passes, one to just change these to + # `$object: dependent.h' and one to simply `dependent.h:'. + sed -e "s,^.*\.[a-z]*:,$object:," < "$tmpdepfile" > "$depfile" + # That's a tab and a space in the []. + sed -e 's,^.*\.[a-z]*:[ ]*,,' -e 's,$,:,' < "$tmpdepfile" >> "$depfile" + else + # The sourcefile does not contain any dependencies, so just + # store a dummy comment line, to avoid errors with the Makefile + # "include basename.Plo" scheme. + echo "#dummy" > "$depfile" + fi + rm -f "$tmpdepfile" + ;; + +icc) + # Intel's C compiler understands `-MD -MF file'. However on + # icc -MD -MF foo.d -c -o sub/foo.o sub/foo.c + # ICC 7.0 will fill foo.d with something like + # foo.o: sub/foo.c + # foo.o: sub/foo.h + # which is wrong. We want: + # sub/foo.o: sub/foo.c + # sub/foo.o: sub/foo.h + # sub/foo.c: + # sub/foo.h: + # ICC 7.1 will output + # foo.o: sub/foo.c sub/foo.h + # and will wrap long lines using \ : + # foo.o: sub/foo.c ... \ + # sub/foo.h ... \ + # ... + + "$@" -MD -MF "$tmpdepfile" + stat=$? + if test $stat -eq 0; then : + else + rm -f "$tmpdepfile" + exit $stat + fi + rm -f "$depfile" + # Each line is of the form `foo.o: dependent.h', + # or `foo.o: dep1.h dep2.h \', or ` dep3.h dep4.h \'. + # Do two passes, one to just change these to + # `$object: dependent.h' and one to simply `dependent.h:'. + sed "s,^[^:]*:,$object :," < "$tmpdepfile" > "$depfile" + # Some versions of the HPUX 10.20 sed can't process this invocation + # correctly. Breaking it into two sed invocations is a workaround. + sed 's,^[^:]*: \(.*\)$,\1,;s/^\\$//;/^$/d;/:$/d' < "$tmpdepfile" | + sed -e 's/$/ :/' >> "$depfile" + rm -f "$tmpdepfile" + ;; + +hp2) + # The "hp" stanza above does not work with aCC (C++) and HP's ia64 + # compilers, which have integrated preprocessors. The correct option + # to use with these is +Maked; it writes dependencies to a file named + # 'foo.d', which lands next to the object file, wherever that + # happens to be. + # Much of this is similar to the tru64 case; see comments there. + dir=`echo "$object" | sed -e 's|/[^/]*$|/|'` + test "x$dir" = "x$object" && dir= + base=`echo "$object" | sed -e 's|^.*/||' -e 's/\.o$//' -e 's/\.lo$//'` + if test "$libtool" = yes; then + tmpdepfile1=$dir$base.d + tmpdepfile2=$dir.libs/$base.d + "$@" -Wc,+Maked + else + tmpdepfile1=$dir$base.d + tmpdepfile2=$dir$base.d + "$@" +Maked + fi + stat=$? + if test $stat -eq 0; then : + else + rm -f "$tmpdepfile1" "$tmpdepfile2" + exit $stat + fi + + for tmpdepfile in "$tmpdepfile1" "$tmpdepfile2" + do + test -f "$tmpdepfile" && break + done + if test -f "$tmpdepfile"; then + sed -e "s,^.*\.[a-z]*:,$object:," "$tmpdepfile" > "$depfile" + # Add `dependent.h:' lines. + sed -ne '2,${; s/^ *//; s/ \\*$//; s/$/:/; p;}' "$tmpdepfile" >> "$depfile" + else + echo "#dummy" > "$depfile" + fi + rm -f "$tmpdepfile" "$tmpdepfile2" + ;; + +tru64) + # The Tru64 compiler uses -MD to generate dependencies as a side + # effect. `cc -MD -o foo.o ...' puts the dependencies into `foo.o.d'. + # At least on Alpha/Redhat 6.1, Compaq CCC V6.2-504 seems to put + # dependencies in `foo.d' instead, so we check for that too. + # Subdirectories are respected. + dir=`echo "$object" | sed -e 's|/[^/]*$|/|'` + test "x$dir" = "x$object" && dir= + base=`echo "$object" | sed -e 's|^.*/||' -e 's/\.o$//' -e 's/\.lo$//'` + + if test "$libtool" = yes; then + # With Tru64 cc, shared objects can also be used to make a + # static library. This mechanism is used in libtool 1.4 series to + # handle both shared and static libraries in a single compilation. + # With libtool 1.4, dependencies were output in $dir.libs/$base.lo.d. + # + # With libtool 1.5 this exception was removed, and libtool now + # generates 2 separate objects for the 2 libraries. These two + # compilations output dependencies in $dir.libs/$base.o.d and + # in $dir$base.o.d. We have to check for both files, because + # one of the two compilations can be disabled. We should prefer + # $dir$base.o.d over $dir.libs/$base.o.d because the latter is + # automatically cleaned when .libs/ is deleted, while ignoring + # the former would cause a distcleancheck panic. + tmpdepfile1=$dir.libs/$base.lo.d # libtool 1.4 + tmpdepfile2=$dir$base.o.d # libtool 1.5 + tmpdepfile3=$dir.libs/$base.o.d # libtool 1.5 + tmpdepfile4=$dir.libs/$base.d # Compaq CCC V6.2-504 + "$@" -Wc,-MD + else + tmpdepfile1=$dir$base.o.d + tmpdepfile2=$dir$base.d + tmpdepfile3=$dir$base.d + tmpdepfile4=$dir$base.d + "$@" -MD + fi + + stat=$? + if test $stat -eq 0; then : + else + rm -f "$tmpdepfile1" "$tmpdepfile2" "$tmpdepfile3" "$tmpdepfile4" + exit $stat + fi + + for tmpdepfile in "$tmpdepfile1" "$tmpdepfile2" "$tmpdepfile3" "$tmpdepfile4" + do + test -f "$tmpdepfile" && break + done + if test -f "$tmpdepfile"; then + sed -e "s,^.*\.[a-z]*:,$object:," < "$tmpdepfile" > "$depfile" + # That's a tab and a space in the []. + sed -e 's,^.*\.[a-z]*:[ ]*,,' -e 's,$,:,' < "$tmpdepfile" >> "$depfile" + else + echo "#dummy" > "$depfile" + fi + rm -f "$tmpdepfile" + ;; + +#nosideeffect) + # This comment above is used by automake to tell side-effect + # dependency tracking mechanisms from slower ones. + +dashmstdout) + # Important note: in order to support this mode, a compiler *must* + # always write the preprocessed file to stdout, regardless of -o. + "$@" || exit $? + + # Remove the call to Libtool. + if test "$libtool" = yes; then + while test $1 != '--mode=compile'; do + shift + done + shift + fi + + # Remove `-o $object'. + IFS=" " + for arg + do + case $arg in + -o) + shift + ;; + $object) + shift + ;; + *) + set fnord "$@" "$arg" + shift # fnord + shift # $arg + ;; + esac + done + + test -z "$dashmflag" && dashmflag=-M + # Require at least two characters before searching for `:' + # in the target name. This is to cope with DOS-style filenames: + # a dependency such as `c:/foo/bar' could be seen as target `c' otherwise. + "$@" $dashmflag | + sed 's:^[ ]*[^: ][^:][^:]*\:[ ]*:'"$object"'\: :' > "$tmpdepfile" + rm -f "$depfile" + cat < "$tmpdepfile" > "$depfile" + tr ' ' ' +' < "$tmpdepfile" | \ +## Some versions of the HPUX 10.20 sed can't process this invocation +## correctly. Breaking it into two sed invocations is a workaround. + sed -e 's/^\\$//' -e '/^$/d' -e '/:$/d' | sed -e 's/$/ :/' >> "$depfile" + rm -f "$tmpdepfile" + ;; + +dashXmstdout) + # This case only exists to satisfy depend.m4. It is never actually + # run, as this mode is specially recognized in the preamble. + exit 1 + ;; + +makedepend) + "$@" || exit $? + # Remove any Libtool call + if test "$libtool" = yes; then + while test $1 != '--mode=compile'; do + shift + done + shift + fi + # X makedepend + shift + cleared=no + for arg in "$@"; do + case $cleared in + no) + set ""; shift + cleared=yes ;; + esac + case "$arg" in + -D*|-I*) + set fnord "$@" "$arg"; shift ;; + # Strip any option that makedepend may not understand. Remove + # the object too, otherwise makedepend will parse it as a source file. + -*|$object) + ;; + *) + set fnord "$@" "$arg"; shift ;; + esac + done + obj_suffix="`echo $object | sed 's/^.*\././'`" + touch "$tmpdepfile" + ${MAKEDEPEND-makedepend} -o"$obj_suffix" -f"$tmpdepfile" "$@" + rm -f "$depfile" + cat < "$tmpdepfile" > "$depfile" + sed '1,2d' "$tmpdepfile" | tr ' ' ' +' | \ +## Some versions of the HPUX 10.20 sed can't process this invocation +## correctly. Breaking it into two sed invocations is a workaround. + sed -e 's/^\\$//' -e '/^$/d' -e '/:$/d' | sed -e 's/$/ :/' >> "$depfile" + rm -f "$tmpdepfile" "$tmpdepfile".bak + ;; + +cpp) + # Important note: in order to support this mode, a compiler *must* + # always write the preprocessed file to stdout. + "$@" || exit $? + + # Remove the call to Libtool. + if test "$libtool" = yes; then + while test $1 != '--mode=compile'; do + shift + done + shift + fi + + # Remove `-o $object'. + IFS=" " + for arg + do + case $arg in + -o) + shift + ;; + $object) + shift + ;; + *) + set fnord "$@" "$arg" + shift # fnord + shift # $arg + ;; + esac + done + + "$@" -E | + sed -n -e '/^# [0-9][0-9]* "\([^"]*\)".*/ s:: \1 \\:p' \ + -e '/^#line [0-9][0-9]* "\([^"]*\)".*/ s:: \1 \\:p' | + sed '$ s: \\$::' > "$tmpdepfile" + rm -f "$depfile" + echo "$object : \\" > "$depfile" + cat < "$tmpdepfile" >> "$depfile" + sed < "$tmpdepfile" '/^$/d;s/^ //;s/ \\$//;s/$/ :/' >> "$depfile" + rm -f "$tmpdepfile" + ;; + +msvisualcpp) + # Important note: in order to support this mode, a compiler *must* + # always write the preprocessed file to stdout, regardless of -o, + # because we must use -o when running libtool. + "$@" || exit $? + IFS=" " + for arg + do + case "$arg" in + "-Gm"|"/Gm"|"-Gi"|"/Gi"|"-ZI"|"/ZI") + set fnord "$@" + shift + shift + ;; + *) + set fnord "$@" "$arg" + shift + shift + ;; + esac + done + "$@" -E | + sed -n '/^#line [0-9][0-9]* "\([^"]*\)"/ s::echo "`cygpath -u \\"\1\\"`":p' | sort | uniq > "$tmpdepfile" + rm -f "$depfile" + echo "$object : \\" > "$depfile" + . "$tmpdepfile" | sed 's% %\\ %g' | sed -n '/^\(.*\)$/ s:: \1 \\:p' >> "$depfile" + echo " " >> "$depfile" + . "$tmpdepfile" | sed 's% %\\ %g' | sed -n '/^\(.*\)$/ s::\1\::p' >> "$depfile" + rm -f "$tmpdepfile" + ;; + +none) + exec "$@" + ;; + +*) + echo "Unknown depmode $depmode" 1>&2 + exit 1 + ;; +esac + +exit 0 + +# Local Variables: +# mode: shell-script +# sh-indentation: 2 +# eval: (add-hook 'write-file-hooks 'time-stamp) +# time-stamp-start: "scriptversion=" +# time-stamp-format: "%:y-%02m-%02d.%02H" +# time-stamp-end: "$" +# End: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/config/install-sh --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/config/install-sh Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,519 @@ +#!/bin/sh +# install - install a program, script, or datafile + +scriptversion=2006-12-25.00 + +# This originates from X11R5 (mit/util/scripts/install.sh), which was +# later released in X11R6 (xc/config/util/install.sh) with the +# following copyright and license. +# +# Copyright (C) 1994 X Consortium +# +# Permission is hereby granted, free of charge, to any person obtaining a copy +# of this software and associated documentation files (the "Software"), to +# deal in the Software without restriction, including without limitation the +# rights to use, copy, modify, merge, publish, distribute, sublicense, and/or +# sell copies of the Software, and to permit persons to whom the Software is +# furnished to do so, subject to the following conditions: +# +# The above copyright notice and this permission notice shall be included in +# all copies or substantial portions of the Software. +# +# THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +# IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +# FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +# X CONSORTIUM BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN +# AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNEC- +# TION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. +# +# Except as contained in this notice, the name of the X Consortium shall not +# be used in advertising or otherwise to promote the sale, use or other deal- +# ings in this Software without prior written authorization from the X Consor- +# tium. +# +# +# FSF changes to this file are in the public domain. +# +# Calling this script install-sh is preferred over install.sh, to prevent +# `make' implicit rules from creating a file called install from it +# when there is no Makefile. +# +# This script is compatible with the BSD install script, but was written +# from scratch. + +nl=' +' +IFS=" "" $nl" + +# set DOITPROG to echo to test this script + +# Don't use :- since 4.3BSD and earlier shells don't like it. +doit=${DOITPROG-} +if test -z "$doit"; then + doit_exec=exec +else + doit_exec=$doit +fi + +# Put in absolute file names if you don't have them in your path; +# or use environment vars. + +chgrpprog=${CHGRPPROG-chgrp} +chmodprog=${CHMODPROG-chmod} +chownprog=${CHOWNPROG-chown} +cmpprog=${CMPPROG-cmp} +cpprog=${CPPROG-cp} +mkdirprog=${MKDIRPROG-mkdir} +mvprog=${MVPROG-mv} +rmprog=${RMPROG-rm} +stripprog=${STRIPPROG-strip} + +posix_glob='?' +initialize_posix_glob=' + test "$posix_glob" != "?" || { + if (set -f) 2>/dev/null; then + posix_glob= + else + posix_glob=: + fi + } +' + +posix_mkdir= + +# Desired mode of installed file. +mode=0755 + +chgrpcmd= +chmodcmd=$chmodprog +chowncmd= +mvcmd=$mvprog +rmcmd="$rmprog -f" +stripcmd= + +src= +dst= +dir_arg= +dst_arg= + +copy_on_change=false +no_target_directory= + +usage="\ +Usage: $0 [OPTION]... [-T] SRCFILE DSTFILE + or: $0 [OPTION]... SRCFILES... DIRECTORY + or: $0 [OPTION]... -t DIRECTORY SRCFILES... + or: $0 [OPTION]... -d DIRECTORIES... + +In the 1st form, copy SRCFILE to DSTFILE. +In the 2nd and 3rd, copy all SRCFILES to DIRECTORY. +In the 4th, create DIRECTORIES. + +Options: + --help display this help and exit. + --version display version info and exit. + + -c (ignored) + -C install only if different (preserve the last data modification time) + -d create directories instead of installing files. + -g GROUP $chgrpprog installed files to GROUP. + -m MODE $chmodprog installed files to MODE. + -o USER $chownprog installed files to USER. + -s $stripprog installed files. + -t DIRECTORY install into DIRECTORY. + -T report an error if DSTFILE is a directory. + +Environment variables override the default commands: + CHGRPPROG CHMODPROG CHOWNPROG CMPPROG CPPROG MKDIRPROG MVPROG + RMPROG STRIPPROG +" + +while test $# -ne 0; do + case $1 in + -c) ;; + + -C) copy_on_change=true;; + + -d) dir_arg=true;; + + -g) chgrpcmd="$chgrpprog $2" + shift;; + + --help) echo "$usage"; exit $?;; + + -m) mode=$2 + case $mode in + *' '* | *' '* | *' +'* | *'*'* | *'?'* | *'['*) + echo "$0: invalid mode: $mode" >&2 + exit 1;; + esac + shift;; + + -o) chowncmd="$chownprog $2" + shift;; + + -s) stripcmd=$stripprog;; + + -t) dst_arg=$2 + shift;; + + -T) no_target_directory=true;; + + --version) echo "$0 $scriptversion"; exit $?;; + + --) shift + break;; + + -*) echo "$0: invalid option: $1" >&2 + exit 1;; + + *) break;; + esac + shift +done + +if test $# -ne 0 && test -z "$dir_arg$dst_arg"; then + # When -d is used, all remaining arguments are directories to create. + # When -t is used, the destination is already specified. + # Otherwise, the last argument is the destination. Remove it from $@. + for arg + do + if test -n "$dst_arg"; then + # $@ is not empty: it contains at least $arg. + set fnord "$@" "$dst_arg" + shift # fnord + fi + shift # arg + dst_arg=$arg + done +fi + +if test $# -eq 0; then + if test -z "$dir_arg"; then + echo "$0: no input file specified." >&2 + exit 1 + fi + # It's OK to call `install-sh -d' without argument. + # This can happen when creating conditional directories. + exit 0 +fi + +if test -z "$dir_arg"; then + trap '(exit $?); exit' 1 2 13 15 + + # Set umask so as not to create temps with too-generous modes. + # However, 'strip' requires both read and write access to temps. + case $mode in + # Optimize common cases. + *644) cp_umask=133;; + *755) cp_umask=22;; + + *[0-7]) + if test -z "$stripcmd"; then + u_plus_rw= + else + u_plus_rw='% 200' + fi + cp_umask=`expr '(' 777 - $mode % 1000 ')' $u_plus_rw`;; + *) + if test -z "$stripcmd"; then + u_plus_rw= + else + u_plus_rw=,u+rw + fi + cp_umask=$mode$u_plus_rw;; + esac +fi + +for src +do + # Protect names starting with `-'. + case $src in + -*) src=./$src;; + esac + + if test -n "$dir_arg"; then + dst=$src + dstdir=$dst + test -d "$dstdir" + dstdir_status=$? + else + + # Waiting for this to be detected by the "$cpprog $src $dsttmp" command + # might cause directories to be created, which would be especially bad + # if $src (and thus $dsttmp) contains '*'. + if test ! -f "$src" && test ! -d "$src"; then + echo "$0: $src does not exist." >&2 + exit 1 + fi + + if test -z "$dst_arg"; then + echo "$0: no destination specified." >&2 + exit 1 + fi + + dst=$dst_arg + # Protect names starting with `-'. + case $dst in + -*) dst=./$dst;; + esac + + # If destination is a directory, append the input filename; won't work + # if double slashes aren't ignored. + if test -d "$dst"; then + if test -n "$no_target_directory"; then + echo "$0: $dst_arg: Is a directory" >&2 + exit 1 + fi + dstdir=$dst + dst=$dstdir/`basename "$src"` + dstdir_status=0 + else + # Prefer dirname, but fall back on a substitute if dirname fails. + dstdir=` + (dirname "$dst") 2>/dev/null || + expr X"$dst" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \ + X"$dst" : 'X\(//\)[^/]' \| \ + X"$dst" : 'X\(//\)$' \| \ + X"$dst" : 'X\(/\)' \| . 2>/dev/null || + echo X"$dst" | + sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{ + s//\1/ + q + } + /^X\(\/\/\)[^/].*/{ + s//\1/ + q + } + /^X\(\/\/\)$/{ + s//\1/ + q + } + /^X\(\/\).*/{ + s//\1/ + q + } + s/.*/./; q' + ` + + test -d "$dstdir" + dstdir_status=$? + fi + fi + + obsolete_mkdir_used=false + + if test $dstdir_status != 0; then + case $posix_mkdir in + '') + # Create intermediate dirs using mode 755 as modified by the umask. + # This is like FreeBSD 'install' as of 1997-10-28. + umask=`umask` + case $stripcmd.$umask in + # Optimize common cases. + *[2367][2367]) mkdir_umask=$umask;; + .*0[02][02] | .[02][02] | .[02]) mkdir_umask=22;; + + *[0-7]) + mkdir_umask=`expr $umask + 22 \ + - $umask % 100 % 40 + $umask % 20 \ + - $umask % 10 % 4 + $umask % 2 + `;; + *) mkdir_umask=$umask,go-w;; + esac + + # With -d, create the new directory with the user-specified mode. + # Otherwise, rely on $mkdir_umask. + if test -n "$dir_arg"; then + mkdir_mode=-m$mode + else + mkdir_mode= + fi + + posix_mkdir=false + case $umask in + *[123567][0-7][0-7]) + # POSIX mkdir -p sets u+wx bits regardless of umask, which + # is incompatible with FreeBSD 'install' when (umask & 300) != 0. + ;; + *) + tmpdir=${TMPDIR-/tmp}/ins$RANDOM-$$ + trap 'ret=$?; rmdir "$tmpdir/d" "$tmpdir" 2>/dev/null; exit $ret' 0 + + if (umask $mkdir_umask && + exec $mkdirprog $mkdir_mode -p -- "$tmpdir/d") >/dev/null 2>&1 + then + if test -z "$dir_arg" || { + # Check for POSIX incompatibilities with -m. + # HP-UX 11.23 and IRIX 6.5 mkdir -m -p sets group- or + # other-writeable bit of parent directory when it shouldn't. + # FreeBSD 6.1 mkdir -m -p sets mode of existing directory. + ls_ld_tmpdir=`ls -ld "$tmpdir"` + case $ls_ld_tmpdir in + d????-?r-*) different_mode=700;; + d????-?--*) different_mode=755;; + *) false;; + esac && + $mkdirprog -m$different_mode -p -- "$tmpdir" && { + ls_ld_tmpdir_1=`ls -ld "$tmpdir"` + test "$ls_ld_tmpdir" = "$ls_ld_tmpdir_1" + } + } + then posix_mkdir=: + fi + rmdir "$tmpdir/d" "$tmpdir" + else + # Remove any dirs left behind by ancient mkdir implementations. + rmdir ./$mkdir_mode ./-p ./-- 2>/dev/null + fi + trap '' 0;; + esac;; + esac + + if + $posix_mkdir && ( + umask $mkdir_umask && + $doit_exec $mkdirprog $mkdir_mode -p -- "$dstdir" + ) + then : + else + + # The umask is ridiculous, or mkdir does not conform to POSIX, + # or it failed possibly due to a race condition. Create the + # directory the slow way, step by step, checking for races as we go. + + case $dstdir in + /*) prefix='/';; + -*) prefix='./';; + *) prefix='';; + esac + + eval "$initialize_posix_glob" + + oIFS=$IFS + IFS=/ + $posix_glob set -f + set fnord $dstdir + shift + $posix_glob set +f + IFS=$oIFS + + prefixes= + + for d + do + test -z "$d" && continue + + prefix=$prefix$d + if test -d "$prefix"; then + prefixes= + else + if $posix_mkdir; then + (umask=$mkdir_umask && + $doit_exec $mkdirprog $mkdir_mode -p -- "$dstdir") && break + # Don't fail if two instances are running concurrently. + test -d "$prefix" || exit 1 + else + case $prefix in + *\'*) qprefix=`echo "$prefix" | sed "s/'/'\\\\\\\\''/g"`;; + *) qprefix=$prefix;; + esac + prefixes="$prefixes '$qprefix'" + fi + fi + prefix=$prefix/ + done + + if test -n "$prefixes"; then + # Don't fail if two instances are running concurrently. + (umask $mkdir_umask && + eval "\$doit_exec \$mkdirprog $prefixes") || + test -d "$dstdir" || exit 1 + obsolete_mkdir_used=true + fi + fi + fi + + if test -n "$dir_arg"; then + { test -z "$chowncmd" || $doit $chowncmd "$dst"; } && + { test -z "$chgrpcmd" || $doit $chgrpcmd "$dst"; } && + { test "$obsolete_mkdir_used$chowncmd$chgrpcmd" = false || + test -z "$chmodcmd" || $doit $chmodcmd $mode "$dst"; } || exit 1 + else + + # Make a couple of temp file names in the proper directory. + dsttmp=$dstdir/_inst.$$_ + rmtmp=$dstdir/_rm.$$_ + + # Trap to clean up those temp files at exit. + trap 'ret=$?; rm -f "$dsttmp" "$rmtmp" && exit $ret' 0 + + # Copy the file name to the temp name. + (umask $cp_umask && $doit_exec $cpprog "$src" "$dsttmp") && + + # and set any options; do chmod last to preserve setuid bits. + # + # If any of these fail, we abort the whole thing. If we want to + # ignore errors from any of these, just make sure not to ignore + # errors from the above "$doit $cpprog $src $dsttmp" command. + # + { test -z "$chowncmd" || $doit $chowncmd "$dsttmp"; } && + { test -z "$chgrpcmd" || $doit $chgrpcmd "$dsttmp"; } && + { test -z "$stripcmd" || $doit $stripcmd "$dsttmp"; } && + { test -z "$chmodcmd" || $doit $chmodcmd $mode "$dsttmp"; } && + + # If -C, don't bother to copy if it wouldn't change the file. + if $copy_on_change && + old=`LC_ALL=C ls -dlL "$dst" 2>/dev/null` && + new=`LC_ALL=C ls -dlL "$dsttmp" 2>/dev/null` && + + eval "$initialize_posix_glob" && + $posix_glob set -f && + set X $old && old=:$2:$4:$5:$6 && + set X $new && new=:$2:$4:$5:$6 && + $posix_glob set +f && + + test "$old" = "$new" && + $cmpprog "$dst" "$dsttmp" >/dev/null 2>&1 + then + rm -f "$dsttmp" + else + # Rename the file to the real destination. + $doit $mvcmd -f "$dsttmp" "$dst" 2>/dev/null || + + # The rename failed, perhaps because mv can't rename something else + # to itself, or perhaps because mv is so ancient that it does not + # support -f. + { + # Now remove or move aside any old file at destination location. + # We try this two ways since rm can't unlink itself on some + # systems and the destination file might be busy for other + # reasons. In this case, the final cleanup might fail but the new + # file should still install successfully. + { + test ! -f "$dst" || + $doit $rmcmd -f "$dst" 2>/dev/null || + { $doit $mvcmd -f "$dst" "$rmtmp" 2>/dev/null && + { $doit $rmcmd -f "$rmtmp" 2>/dev/null; :; } + } || + { echo "$0: cannot unlink or rename $dst" >&2 + (exit 1); exit 1 + } + } && + + # Now rename the file to the real destination. + $doit $mvcmd "$dsttmp" "$dst" + } + fi || exit 1 + + trap '' 0 + fi +done + +# Local variables: +# eval: (add-hook 'write-file-hooks 'time-stamp) +# time-stamp-start: "scriptversion=" +# time-stamp-format: "%:y-%02m-%02d.%02H" +# time-stamp-end: "$" +# End: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/config/missing --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/config/missing Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,367 @@ +#! /bin/sh +# Common stub for a few missing GNU programs while installing. + +scriptversion=2006-05-10.23 + +# Copyright (C) 1996, 1997, 1999, 2000, 2002, 2003, 2004, 2005, 2006 +# Free Software Foundation, Inc. +# Originally by Fran,cois Pinard , 1996. + +# This program is free software; you can redistribute it and/or modify +# it under the terms of the GNU General Public License as published by +# the Free Software Foundation; either version 2, or (at your option) +# any later version. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY; without even the implied warranty of +# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the +# GNU General Public License for more details. + +# You should have received a copy of the GNU General Public License +# along with this program; if not, write to the Free Software +# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA +# 02110-1301, USA. + +# As a special exception to the GNU General Public License, if you +# distribute this file as part of a program that contains a +# configuration script generated by Autoconf, you may include it under +# the same distribution terms that you use for the rest of that program. + +if test $# -eq 0; then + echo 1>&2 "Try \`$0 --help' for more information" + exit 1 +fi + +run=: +sed_output='s/.* --output[ =]\([^ ]*\).*/\1/p' +sed_minuso='s/.* -o \([^ ]*\).*/\1/p' + +# In the cases where this matters, `missing' is being run in the +# srcdir already. +if test -f configure.ac; then + configure_ac=configure.ac +else + configure_ac=configure.in +fi + +msg="missing on your system" + +case $1 in +--run) + # Try to run requested program, and just exit if it succeeds. + run= + shift + "$@" && exit 0 + # Exit code 63 means version mismatch. This often happens + # when the user try to use an ancient version of a tool on + # a file that requires a minimum version. In this case we + # we should proceed has if the program had been absent, or + # if --run hadn't been passed. + if test $? = 63; then + run=: + msg="probably too old" + fi + ;; + + -h|--h|--he|--hel|--help) + echo "\ +$0 [OPTION]... PROGRAM [ARGUMENT]... + +Handle \`PROGRAM [ARGUMENT]...' for when PROGRAM is missing, or return an +error status if there is no known handling for PROGRAM. + +Options: + -h, --help display this help and exit + -v, --version output version information and exit + --run try to run the given command, and emulate it if it fails + +Supported PROGRAM values: + aclocal touch file \`aclocal.m4' + autoconf touch file \`configure' + autoheader touch file \`config.h.in' + autom4te touch the output file, or create a stub one + automake touch all \`Makefile.in' files + bison create \`y.tab.[ch]', if possible, from existing .[ch] + flex create \`lex.yy.c', if possible, from existing .c + help2man touch the output file + lex create \`lex.yy.c', if possible, from existing .c + makeinfo touch the output file + tar try tar, gnutar, gtar, then tar without non-portable flags + yacc create \`y.tab.[ch]', if possible, from existing .[ch] + +Send bug reports to ." + exit $? + ;; + + -v|--v|--ve|--ver|--vers|--versi|--versio|--version) + echo "missing $scriptversion (GNU Automake)" + exit $? + ;; + + -*) + echo 1>&2 "$0: Unknown \`$1' option" + echo 1>&2 "Try \`$0 --help' for more information" + exit 1 + ;; + +esac + +# Now exit if we have it, but it failed. Also exit now if we +# don't have it and --version was passed (most likely to detect +# the program). +case $1 in + lex|yacc) + # Not GNU programs, they don't have --version. + ;; + + tar) + if test -n "$run"; then + echo 1>&2 "ERROR: \`tar' requires --run" + exit 1 + elif test "x$2" = "x--version" || test "x$2" = "x--help"; then + exit 1 + fi + ;; + + *) + if test -z "$run" && ($1 --version) > /dev/null 2>&1; then + # We have it, but it failed. + exit 1 + elif test "x$2" = "x--version" || test "x$2" = "x--help"; then + # Could not run --version or --help. This is probably someone + # running `$TOOL --version' or `$TOOL --help' to check whether + # $TOOL exists and not knowing $TOOL uses missing. + exit 1 + fi + ;; +esac + +# If it does not exist, or fails to run (possibly an outdated version), +# try to emulate it. +case $1 in + aclocal*) + echo 1>&2 "\ +WARNING: \`$1' is $msg. You should only need it if + you modified \`acinclude.m4' or \`${configure_ac}'. You might want + to install the \`Automake' and \`Perl' packages. Grab them from + any GNU archive site." + touch aclocal.m4 + ;; + + autoconf) + echo 1>&2 "\ +WARNING: \`$1' is $msg. You should only need it if + you modified \`${configure_ac}'. You might want to install the + \`Autoconf' and \`GNU m4' packages. Grab them from any GNU + archive site." + touch configure + ;; + + autoheader) + echo 1>&2 "\ +WARNING: \`$1' is $msg. You should only need it if + you modified \`acconfig.h' or \`${configure_ac}'. You might want + to install the \`Autoconf' and \`GNU m4' packages. Grab them + from any GNU archive site." + files=`sed -n 's/^[ ]*A[CM]_CONFIG_HEADER(\([^)]*\)).*/\1/p' ${configure_ac}` + test -z "$files" && files="config.h" + touch_files= + for f in $files; do + case $f in + *:*) touch_files="$touch_files "`echo "$f" | + sed -e 's/^[^:]*://' -e 's/:.*//'`;; + *) touch_files="$touch_files $f.in";; + esac + done + touch $touch_files + ;; + + automake*) + echo 1>&2 "\ +WARNING: \`$1' is $msg. You should only need it if + you modified \`Makefile.am', \`acinclude.m4' or \`${configure_ac}'. + You might want to install the \`Automake' and \`Perl' packages. + Grab them from any GNU archive site." + find . -type f -name Makefile.am -print | + sed 's/\.am$/.in/' | + while read f; do touch "$f"; done + ;; + + autom4te) + echo 1>&2 "\ +WARNING: \`$1' is needed, but is $msg. + You might have modified some files without having the + proper tools for further handling them. + You can get \`$1' as part of \`Autoconf' from any GNU + archive site." + + file=`echo "$*" | sed -n "$sed_output"` + test -z "$file" && file=`echo "$*" | sed -n "$sed_minuso"` + if test -f "$file"; then + touch $file + else + test -z "$file" || exec >$file + echo "#! /bin/sh" + echo "# Created by GNU Automake missing as a replacement of" + echo "# $ $@" + echo "exit 0" + chmod +x $file + exit 1 + fi + ;; + + bison|yacc) + echo 1>&2 "\ +WARNING: \`$1' $msg. You should only need it if + you modified a \`.y' file. You may need the \`Bison' package + in order for those modifications to take effect. You can get + \`Bison' from any GNU archive site." + rm -f y.tab.c y.tab.h + if test $# -ne 1; then + eval LASTARG="\${$#}" + case $LASTARG in + *.y) + SRCFILE=`echo "$LASTARG" | sed 's/y$/c/'` + if test -f "$SRCFILE"; then + cp "$SRCFILE" y.tab.c + fi + SRCFILE=`echo "$LASTARG" | sed 's/y$/h/'` + if test -f "$SRCFILE"; then + cp "$SRCFILE" y.tab.h + fi + ;; + esac + fi + if test ! -f y.tab.h; then + echo >y.tab.h + fi + if test ! -f y.tab.c; then + echo 'main() { return 0; }' >y.tab.c + fi + ;; + + lex|flex) + echo 1>&2 "\ +WARNING: \`$1' is $msg. You should only need it if + you modified a \`.l' file. You may need the \`Flex' package + in order for those modifications to take effect. You can get + \`Flex' from any GNU archive site." + rm -f lex.yy.c + if test $# -ne 1; then + eval LASTARG="\${$#}" + case $LASTARG in + *.l) + SRCFILE=`echo "$LASTARG" | sed 's/l$/c/'` + if test -f "$SRCFILE"; then + cp "$SRCFILE" lex.yy.c + fi + ;; + esac + fi + if test ! -f lex.yy.c; then + echo 'main() { return 0; }' >lex.yy.c + fi + ;; + + help2man) + echo 1>&2 "\ +WARNING: \`$1' is $msg. You should only need it if + you modified a dependency of a manual page. You may need the + \`Help2man' package in order for those modifications to take + effect. You can get \`Help2man' from any GNU archive site." + + file=`echo "$*" | sed -n "$sed_output"` + test -z "$file" && file=`echo "$*" | sed -n "$sed_minuso"` + if test -f "$file"; then + touch $file + else + test -z "$file" || exec >$file + echo ".ab help2man is required to generate this page" + exit 1 + fi + ;; + + makeinfo) + echo 1>&2 "\ +WARNING: \`$1' is $msg. You should only need it if + you modified a \`.texi' or \`.texinfo' file, or any other file + indirectly affecting the aspect of the manual. The spurious + call might also be the consequence of using a buggy \`make' (AIX, + DU, IRIX). You might want to install the \`Texinfo' package or + the \`GNU make' package. Grab either from any GNU archive site." + # The file to touch is that specified with -o ... + file=`echo "$*" | sed -n "$sed_output"` + test -z "$file" && file=`echo "$*" | sed -n "$sed_minuso"` + if test -z "$file"; then + # ... or it is the one specified with @setfilename ... + infile=`echo "$*" | sed 's/.* \([^ ]*\) *$/\1/'` + file=`sed -n ' + /^@setfilename/{ + s/.* \([^ ]*\) *$/\1/ + p + q + }' $infile` + # ... or it is derived from the source name (dir/f.texi becomes f.info) + test -z "$file" && file=`echo "$infile" | sed 's,.*/,,;s,.[^.]*$,,'`.info + fi + # If the file does not exist, the user really needs makeinfo; + # let's fail without touching anything. + test -f $file || exit 1 + touch $file + ;; + + tar) + shift + + # We have already tried tar in the generic part. + # Look for gnutar/gtar before invocation to avoid ugly error + # messages. + if (gnutar --version > /dev/null 2>&1); then + gnutar "$@" && exit 0 + fi + if (gtar --version > /dev/null 2>&1); then + gtar "$@" && exit 0 + fi + firstarg="$1" + if shift; then + case $firstarg in + *o*) + firstarg=`echo "$firstarg" | sed s/o//` + tar "$firstarg" "$@" && exit 0 + ;; + esac + case $firstarg in + *h*) + firstarg=`echo "$firstarg" | sed s/h//` + tar "$firstarg" "$@" && exit 0 + ;; + esac + fi + + echo 1>&2 "\ +WARNING: I can't seem to be able to run \`tar' with the given arguments. + You may want to install GNU tar or Free paxutils, or check the + command line arguments." + exit 1 + ;; + + *) + echo 1>&2 "\ +WARNING: \`$1' is needed, and is $msg. + You might have modified some files without having the + proper tools for further handling them. Check the \`README' file, + it often tells you about the needed prerequisites for installing + this package. You may also peek at any GNU archive site, in case + some other package would contain this missing \`$1' program." + exit 1 + ;; +esac + +exit 0 + +# Local variables: +# eval: (add-hook 'write-file-hooks 'time-stamp) +# time-stamp-start: "scriptversion=" +# time-stamp-format: "%:y-%02m-%02d.%02H" +# time-stamp-end: "$" +# End: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/configure --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/configure Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,6955 @@ +#! /bin/sh +# Guess values for system-dependent variables and create Makefiles. +# Generated by GNU Autoconf 2.61 for FASTX Toolkit 0.0.6. +# +# Report bugs to . +# +# Copyright (C) 1992, 1993, 1994, 1995, 1996, 1998, 1999, 2000, 2001, +# 2002, 2003, 2004, 2005, 2006 Free Software Foundation, Inc. +# This configure script is free software; the Free Software Foundation +# gives unlimited permission to copy, distribute and modify it. +## --------------------- ## +## M4sh Initialization. ## +## --------------------- ## + +# Be more Bourne compatible +DUALCASE=1; export DUALCASE # for MKS sh +if test -n "${ZSH_VERSION+set}" && (emulate sh) >/dev/null 2>&1; then + emulate sh + NULLCMD=: + # Zsh 3.x and 4.x performs word splitting on ${1+"$@"}, which + # is contrary to our usage. Disable this feature. + alias -g '${1+"$@"}'='"$@"' + setopt NO_GLOB_SUBST +else + case `(set -o) 2>/dev/null` in + *posix*) set -o posix ;; +esac + +fi + + + + +# PATH needs CR +# Avoid depending upon Character Ranges. +as_cr_letters='abcdefghijklmnopqrstuvwxyz' +as_cr_LETTERS='ABCDEFGHIJKLMNOPQRSTUVWXYZ' +as_cr_Letters=$as_cr_letters$as_cr_LETTERS +as_cr_digits='0123456789' +as_cr_alnum=$as_cr_Letters$as_cr_digits + +# The user is always right. +if test "${PATH_SEPARATOR+set}" != set; then + echo "#! /bin/sh" >conf$$.sh + echo "exit 0" >>conf$$.sh + chmod +x conf$$.sh + if (PATH="/nonexistent;."; conf$$.sh) >/dev/null 2>&1; then + PATH_SEPARATOR=';' + else + PATH_SEPARATOR=: + fi + rm -f conf$$.sh +fi + +# Support unset when possible. +if ( (MAIL=60; unset MAIL) || exit) >/dev/null 2>&1; then + as_unset=unset +else + as_unset=false +fi + + +# IFS +# We need space, tab and new line, in precisely that order. Quoting is +# there to prevent editors from complaining about space-tab. +# (If _AS_PATH_WALK were called with IFS unset, it would disable word +# splitting by setting IFS to empty value.) +as_nl=' +' +IFS=" "" $as_nl" + +# Find who we are. Look in the path if we contain no directory separator. +case $0 in + *[\\/]* ) as_myself=$0 ;; + *) as_save_IFS=$IFS; IFS=$PATH_SEPARATOR +for as_dir in $PATH +do + IFS=$as_save_IFS + test -z "$as_dir" && as_dir=. + test -r "$as_dir/$0" && as_myself=$as_dir/$0 && break +done +IFS=$as_save_IFS + + ;; +esac +# We did not find ourselves, most probably we were run as `sh COMMAND' +# in which case we are not to be found in the path. +if test "x$as_myself" = x; then + as_myself=$0 +fi +if test ! -f "$as_myself"; then + echo "$as_myself: error: cannot find myself; rerun with an absolute file name" >&2 + { (exit 1); exit 1; } +fi + +# Work around bugs in pre-3.0 UWIN ksh. +for as_var in ENV MAIL MAILPATH +do ($as_unset $as_var) >/dev/null 2>&1 && $as_unset $as_var +done +PS1='$ ' +PS2='> ' +PS4='+ ' + +# NLS nuisances. +for as_var in \ + LANG LANGUAGE LC_ADDRESS LC_ALL LC_COLLATE LC_CTYPE LC_IDENTIFICATION \ + LC_MEASUREMENT LC_MESSAGES LC_MONETARY LC_NAME LC_NUMERIC LC_PAPER \ + LC_TELEPHONE LC_TIME +do + if (set +x; test -z "`(eval $as_var=C; export $as_var) 2>&1`"); then + eval $as_var=C; export $as_var + else + ($as_unset $as_var) >/dev/null 2>&1 && $as_unset $as_var + fi +done + +# Required to use basename. +if expr a : '\(a\)' >/dev/null 2>&1 && + test "X`expr 00001 : '.*\(...\)'`" = X001; then + as_expr=expr +else + as_expr=false +fi + +if (basename -- /) >/dev/null 2>&1 && test "X`basename -- / 2>&1`" = "X/"; then + as_basename=basename +else + as_basename=false +fi + + +# Name of the executable. +as_me=`$as_basename -- "$0" || +$as_expr X/"$0" : '.*/\([^/][^/]*\)/*$' \| \ + X"$0" : 'X\(//\)$' \| \ + X"$0" : 'X\(/\)' \| . 2>/dev/null || +echo X/"$0" | + sed '/^.*\/\([^/][^/]*\)\/*$/{ + s//\1/ + q + } + /^X\/\(\/\/\)$/{ + s//\1/ + q + } + /^X\/\(\/\).*/{ + s//\1/ + q + } + s/.*/./; q'` + +# CDPATH. +$as_unset CDPATH + + +if test "x$CONFIG_SHELL" = x; then + if (eval ":") 2>/dev/null; then + as_have_required=yes +else + as_have_required=no +fi + + if test $as_have_required = yes && (eval ": +(as_func_return () { + (exit \$1) +} +as_func_success () { + as_func_return 0 +} +as_func_failure () { + as_func_return 1 +} +as_func_ret_success () { + return 0 +} +as_func_ret_failure () { + return 1 +} + +exitcode=0 +if as_func_success; then + : +else + exitcode=1 + echo as_func_success failed. +fi + +if as_func_failure; then + exitcode=1 + echo as_func_failure succeeded. +fi + +if as_func_ret_success; then + : +else + exitcode=1 + echo as_func_ret_success failed. +fi + +if as_func_ret_failure; then + exitcode=1 + echo as_func_ret_failure succeeded. +fi + +if ( set x; as_func_ret_success y && test x = \"\$1\" ); then + : +else + exitcode=1 + echo positional parameters were not saved. +fi + +test \$exitcode = 0) || { (exit 1); exit 1; } + +( + as_lineno_1=\$LINENO + as_lineno_2=\$LINENO + test \"x\$as_lineno_1\" != \"x\$as_lineno_2\" && + test \"x\`expr \$as_lineno_1 + 1\`\" = \"x\$as_lineno_2\") || { (exit 1); exit 1; } +") 2> /dev/null; then + : +else + as_candidate_shells= + as_save_IFS=$IFS; IFS=$PATH_SEPARATOR +for as_dir in /bin$PATH_SEPARATOR/usr/bin$PATH_SEPARATOR$PATH +do + IFS=$as_save_IFS + test -z "$as_dir" && as_dir=. + case $as_dir in + /*) + for as_base in sh bash ksh sh5; do + as_candidate_shells="$as_candidate_shells $as_dir/$as_base" + done;; + esac +done +IFS=$as_save_IFS + + + for as_shell in $as_candidate_shells $SHELL; do + # Try only shells that exist, to save several forks. + if { test -f "$as_shell" || test -f "$as_shell.exe"; } && + { ("$as_shell") 2> /dev/null <<\_ASEOF +if test -n "${ZSH_VERSION+set}" && (emulate sh) >/dev/null 2>&1; then + emulate sh + NULLCMD=: + # Zsh 3.x and 4.x performs word splitting on ${1+"$@"}, which + # is contrary to our usage. Disable this feature. + alias -g '${1+"$@"}'='"$@"' + setopt NO_GLOB_SUBST +else + case `(set -o) 2>/dev/null` in + *posix*) set -o posix ;; +esac + +fi + + +: +_ASEOF +}; then + CONFIG_SHELL=$as_shell + as_have_required=yes + if { "$as_shell" 2> /dev/null <<\_ASEOF +if test -n "${ZSH_VERSION+set}" && (emulate sh) >/dev/null 2>&1; then + emulate sh + NULLCMD=: + # Zsh 3.x and 4.x performs word splitting on ${1+"$@"}, which + # is contrary to our usage. Disable this feature. + alias -g '${1+"$@"}'='"$@"' + setopt NO_GLOB_SUBST +else + case `(set -o) 2>/dev/null` in + *posix*) set -o posix ;; +esac + +fi + + +: +(as_func_return () { + (exit $1) +} +as_func_success () { + as_func_return 0 +} +as_func_failure () { + as_func_return 1 +} +as_func_ret_success () { + return 0 +} +as_func_ret_failure () { + return 1 +} + +exitcode=0 +if as_func_success; then + : +else + exitcode=1 + echo as_func_success failed. +fi + +if as_func_failure; then + exitcode=1 + echo as_func_failure succeeded. +fi + +if as_func_ret_success; then + : +else + exitcode=1 + echo as_func_ret_success failed. +fi + +if as_func_ret_failure; then + exitcode=1 + echo as_func_ret_failure succeeded. +fi + +if ( set x; as_func_ret_success y && test x = "$1" ); then + : +else + exitcode=1 + echo positional parameters were not saved. +fi + +test $exitcode = 0) || { (exit 1); exit 1; } + +( + as_lineno_1=$LINENO + as_lineno_2=$LINENO + test "x$as_lineno_1" != "x$as_lineno_2" && + test "x`expr $as_lineno_1 + 1`" = "x$as_lineno_2") || { (exit 1); exit 1; } + +_ASEOF +}; then + break +fi + +fi + + done + + if test "x$CONFIG_SHELL" != x; then + for as_var in BASH_ENV ENV + do ($as_unset $as_var) >/dev/null 2>&1 && $as_unset $as_var + done + export CONFIG_SHELL + exec "$CONFIG_SHELL" "$as_myself" ${1+"$@"} +fi + + + if test $as_have_required = no; then + echo This script requires a shell more modern than all the + echo shells that I found on your system. Please install a + echo modern shell, or manually run the script under such a + echo shell if you do have one. + { (exit 1); exit 1; } +fi + + +fi + +fi + + + +(eval "as_func_return () { + (exit \$1) +} +as_func_success () { + as_func_return 0 +} +as_func_failure () { + as_func_return 1 +} +as_func_ret_success () { + return 0 +} +as_func_ret_failure () { + return 1 +} + +exitcode=0 +if as_func_success; then + : +else + exitcode=1 + echo as_func_success failed. +fi + +if as_func_failure; then + exitcode=1 + echo as_func_failure succeeded. +fi + +if as_func_ret_success; then + : +else + exitcode=1 + echo as_func_ret_success failed. +fi + +if as_func_ret_failure; then + exitcode=1 + echo as_func_ret_failure succeeded. +fi + +if ( set x; as_func_ret_success y && test x = \"\$1\" ); then + : +else + exitcode=1 + echo positional parameters were not saved. +fi + +test \$exitcode = 0") || { + echo No shell found that supports shell functions. + echo Please tell autoconf@gnu.org about your system, + echo including any error possibly output before this + echo message +} + + + + as_lineno_1=$LINENO + as_lineno_2=$LINENO + test "x$as_lineno_1" != "x$as_lineno_2" && + test "x`expr $as_lineno_1 + 1`" = "x$as_lineno_2" || { + + # Create $as_me.lineno as a copy of $as_myself, but with $LINENO + # uniformly replaced by the line number. The first 'sed' inserts a + # line-number line after each line using $LINENO; the second 'sed' + # does the real work. The second script uses 'N' to pair each + # line-number line with the line containing $LINENO, and appends + # trailing '-' during substitution so that $LINENO is not a special + # case at line end. + # (Raja R Harinath suggested sed '=', and Paul Eggert wrote the + # scripts with optimization help from Paolo Bonzini. Blame Lee + # E. McMahon (1931-1989) for sed's syntax. :-) + sed -n ' + p + /[$]LINENO/= + ' <$as_myself | + sed ' + s/[$]LINENO.*/&-/ + t lineno + b + :lineno + N + :loop + s/[$]LINENO\([^'$as_cr_alnum'_].*\n\)\(.*\)/\2\1\2/ + t loop + s/-\n.*// + ' >$as_me.lineno && + chmod +x "$as_me.lineno" || + { echo "$as_me: error: cannot create $as_me.lineno; rerun with a POSIX shell" >&2 + { (exit 1); exit 1; }; } + + # Don't try to exec as it changes $[0], causing all sort of problems + # (the dirname of $[0] is not the place where we might find the + # original and so on. Autoconf is especially sensitive to this). + . "./$as_me.lineno" + # Exit status is that of the last command. + exit +} + + +if (as_dir=`dirname -- /` && test "X$as_dir" = X/) >/dev/null 2>&1; then + as_dirname=dirname +else + as_dirname=false +fi + +ECHO_C= ECHO_N= ECHO_T= +case `echo -n x` in +-n*) + case `echo 'x\c'` in + *c*) ECHO_T=' ';; # ECHO_T is single tab character. + *) ECHO_C='\c';; + esac;; +*) + ECHO_N='-n';; +esac + +if expr a : '\(a\)' >/dev/null 2>&1 && + test "X`expr 00001 : '.*\(...\)'`" = X001; then + as_expr=expr +else + as_expr=false +fi + +rm -f conf$$ conf$$.exe conf$$.file +if test -d conf$$.dir; then + rm -f conf$$.dir/conf$$.file +else + rm -f conf$$.dir + mkdir conf$$.dir +fi +echo >conf$$.file +if ln -s conf$$.file conf$$ 2>/dev/null; then + as_ln_s='ln -s' + # ... but there are two gotchas: + # 1) On MSYS, both `ln -s file dir' and `ln file dir' fail. + # 2) DJGPP < 2.04 has no symlinks; `ln -s' creates a wrapper executable. + # In both cases, we have to default to `cp -p'. + ln -s conf$$.file conf$$.dir 2>/dev/null && test ! -f conf$$.exe || + as_ln_s='cp -p' +elif ln conf$$.file conf$$ 2>/dev/null; then + as_ln_s=ln +else + as_ln_s='cp -p' +fi +rm -f conf$$ conf$$.exe conf$$.dir/conf$$.file conf$$.file +rmdir conf$$.dir 2>/dev/null + +if mkdir -p . 2>/dev/null; then + as_mkdir_p=: +else + test -d ./-p && rmdir ./-p + as_mkdir_p=false +fi + +if test -x / >/dev/null 2>&1; then + as_test_x='test -x' +else + if ls -dL / >/dev/null 2>&1; then + as_ls_L_option=L + else + as_ls_L_option= + fi + as_test_x=' + eval sh -c '\'' + if test -d "$1"; then + test -d "$1/."; + else + case $1 in + -*)set "./$1";; + esac; + case `ls -ld'$as_ls_L_option' "$1" 2>/dev/null` in + ???[sx]*):;;*)false;;esac;fi + '\'' sh + ' +fi +as_executable_p=$as_test_x + +# Sed expression to map a string onto a valid CPP name. +as_tr_cpp="eval sed 'y%*$as_cr_letters%P$as_cr_LETTERS%;s%[^_$as_cr_alnum]%_%g'" + +# Sed expression to map a string onto a valid variable name. +as_tr_sh="eval sed 'y%*+%pp%;s%[^_$as_cr_alnum]%_%g'" + + + +exec 7<&0 &1 + +# Name of the host. +# hostname on some systems (SVR3.2, Linux) returns a bogus exit status, +# so uname gets run too. +ac_hostname=`(hostname || uname -n) 2>/dev/null | sed 1q` + +# +# Initializations. +# +ac_default_prefix=/usr/local +ac_clean_files= +ac_config_libobj_dir=. +LIBOBJS= +cross_compiling=no +subdirs= +MFLAGS= +MAKEFLAGS= +SHELL=${CONFIG_SHELL-/bin/sh} + +# Identity of this package. +PACKAGE_NAME='FASTX Toolkit' +PACKAGE_TARNAME='fastx_toolkit' +PACKAGE_VERSION='0.0.6' +PACKAGE_STRING='FASTX Toolkit 0.0.6' +PACKAGE_BUGREPORT='Assaf Gordon gordon@cshl.edu' + +# Factoring default headers for most tests. +ac_includes_default="\ +#include +#ifdef HAVE_SYS_TYPES_H +# include +#endif +#ifdef HAVE_SYS_STAT_H +# include +#endif +#ifdef STDC_HEADERS +# include +# include +#else +# ifdef HAVE_STDLIB_H +# include +# endif +#endif +#ifdef HAVE_STRING_H +# if !defined STDC_HEADERS && defined HAVE_MEMORY_H +# include +# endif +# include +#endif +#ifdef HAVE_STRINGS_H +# include +#endif +#ifdef HAVE_INTTYPES_H +# include +#endif +#ifdef HAVE_STDINT_H +# include +#endif +#ifdef HAVE_UNISTD_H +# include +#endif" + +ac_subst_vars='SHELL +PATH_SEPARATOR +PACKAGE_NAME +PACKAGE_TARNAME +PACKAGE_VERSION +PACKAGE_STRING +PACKAGE_BUGREPORT +exec_prefix +prefix +program_transform_name +bindir +sbindir +libexecdir +datarootdir +datadir +sysconfdir +sharedstatedir +localstatedir +includedir +oldincludedir +docdir +infodir +htmldir +dvidir +pdfdir +psdir +libdir +localedir +mandir +DEFS +ECHO_C +ECHO_N +ECHO_T +LIBS +build_alias +host_alias +target_alias +INSTALL_PROGRAM +INSTALL_SCRIPT +INSTALL_DATA +am__isrc +CYGPATH_W +PACKAGE +VERSION +ACLOCAL +AUTOCONF +AUTOMAKE +AUTOHEADER +MAKEINFO +install_sh +STRIP +INSTALL_STRIP_PROGRAM +mkdir_p +AWK +SET_MAKE +am__leading_dot +AMTAR +am__tar +am__untar +CC +CFLAGS +LDFLAGS +CPPFLAGS +ac_ct_CC +EXEEXT +OBJEXT +DEPDIR +am__include +am__quote +AMDEP_TRUE +AMDEP_FALSE +AMDEPBACKSLASH +CCDEPMODE +am__fastdepCC_TRUE +am__fastdepCC_FALSE +CPP +GREP +EGREP +CXX +CXXFLAGS +ac_ct_CXX +CXXDEPMODE +am__fastdepCXX_TRUE +am__fastdepCXX_FALSE +CXXCPP +build +build_cpu +build_vendor +build_os +host +host_cpu +host_vendor +host_os +canonical_host_type +RANLIB +LIBOBJS +LTLIBOBJS' +ac_subst_files='' + ac_precious_vars='build_alias +host_alias +target_alias +CC +CFLAGS +LDFLAGS +LIBS +CPPFLAGS +CPP +CXX +CXXFLAGS +CCC +CXXCPP' + + +# Initialize some variables set by options. +ac_init_help= +ac_init_version=false +# The variables have the same names as the options, with +# dashes changed to underlines. +cache_file=/dev/null +exec_prefix=NONE +no_create= +no_recursion= +prefix=NONE +program_prefix=NONE +program_suffix=NONE +program_transform_name=s,x,x, +silent= +site= +srcdir= +verbose= +x_includes=NONE +x_libraries=NONE + +# Installation directory options. +# These are left unexpanded so users can "make install exec_prefix=/foo" +# and all the variables that are supposed to be based on exec_prefix +# by default will actually change. +# Use braces instead of parens because sh, perl, etc. also accept them. +# (The list follows the same order as the GNU Coding Standards.) +bindir='${exec_prefix}/bin' +sbindir='${exec_prefix}/sbin' +libexecdir='${exec_prefix}/libexec' +datarootdir='${prefix}/share' +datadir='${datarootdir}' +sysconfdir='${prefix}/etc' +sharedstatedir='${prefix}/com' +localstatedir='${prefix}/var' +includedir='${prefix}/include' +oldincludedir='/usr/include' +docdir='${datarootdir}/doc/${PACKAGE_TARNAME}' +infodir='${datarootdir}/info' +htmldir='${docdir}' +dvidir='${docdir}' +pdfdir='${docdir}' +psdir='${docdir}' +libdir='${exec_prefix}/lib' +localedir='${datarootdir}/locale' +mandir='${datarootdir}/man' + +ac_prev= +ac_dashdash= +for ac_option +do + # If the previous option needs an argument, assign it. + if test -n "$ac_prev"; then + eval $ac_prev=\$ac_option + ac_prev= + continue + fi + + case $ac_option in + *=*) ac_optarg=`expr "X$ac_option" : '[^=]*=\(.*\)'` ;; + *) ac_optarg=yes ;; + esac + + # Accept the important Cygnus configure options, so we can diagnose typos. + + case $ac_dashdash$ac_option in + --) + ac_dashdash=yes ;; + + -bindir | --bindir | --bindi | --bind | --bin | --bi) + ac_prev=bindir ;; + -bindir=* | --bindir=* | --bindi=* | --bind=* | --bin=* | --bi=*) + bindir=$ac_optarg ;; + + -build | --build | --buil | --bui | --bu) + ac_prev=build_alias ;; + -build=* | --build=* | --buil=* | --bui=* | --bu=*) + build_alias=$ac_optarg ;; + + -cache-file | --cache-file | --cache-fil | --cache-fi \ + | --cache-f | --cache- | --cache | --cach | --cac | --ca | --c) + ac_prev=cache_file ;; + -cache-file=* | --cache-file=* | --cache-fil=* | --cache-fi=* \ + | --cache-f=* | --cache-=* | --cache=* | --cach=* | --cac=* | --ca=* | --c=*) + cache_file=$ac_optarg ;; + + --config-cache | -C) + cache_file=config.cache ;; + + -datadir | --datadir | --datadi | --datad) + ac_prev=datadir ;; + -datadir=* | --datadir=* | --datadi=* | --datad=*) + datadir=$ac_optarg ;; + + -datarootdir | --datarootdir | --datarootdi | --datarootd | --dataroot \ + | --dataroo | --dataro | --datar) + ac_prev=datarootdir ;; + -datarootdir=* | --datarootdir=* | --datarootdi=* | --datarootd=* \ + | --dataroot=* | --dataroo=* | --dataro=* | --datar=*) + datarootdir=$ac_optarg ;; + + -disable-* | --disable-*) + ac_feature=`expr "x$ac_option" : 'x-*disable-\(.*\)'` + # Reject names that are not valid shell variable names. + expr "x$ac_feature" : ".*[^-._$as_cr_alnum]" >/dev/null && + { echo "$as_me: error: invalid feature name: $ac_feature" >&2 + { (exit 1); exit 1; }; } + ac_feature=`echo $ac_feature | sed 's/[-.]/_/g'` + eval enable_$ac_feature=no ;; + + -docdir | --docdir | --docdi | --doc | --do) + ac_prev=docdir ;; + -docdir=* | --docdir=* | --docdi=* | --doc=* | --do=*) + docdir=$ac_optarg ;; + + -dvidir | --dvidir | --dvidi | --dvid | --dvi | --dv) + ac_prev=dvidir ;; + -dvidir=* | --dvidir=* | --dvidi=* | --dvid=* | --dvi=* | --dv=*) + dvidir=$ac_optarg ;; + + -enable-* | --enable-*) + ac_feature=`expr "x$ac_option" : 'x-*enable-\([^=]*\)'` + # Reject names that are not valid shell variable names. + expr "x$ac_feature" : ".*[^-._$as_cr_alnum]" >/dev/null && + { echo "$as_me: error: invalid feature name: $ac_feature" >&2 + { (exit 1); exit 1; }; } + ac_feature=`echo $ac_feature | sed 's/[-.]/_/g'` + eval enable_$ac_feature=\$ac_optarg ;; + + -exec-prefix | --exec_prefix | --exec-prefix | --exec-prefi \ + | --exec-pref | --exec-pre | --exec-pr | --exec-p | --exec- \ + | --exec | --exe | --ex) + ac_prev=exec_prefix ;; + -exec-prefix=* | --exec_prefix=* | --exec-prefix=* | --exec-prefi=* \ + | --exec-pref=* | --exec-pre=* | --exec-pr=* | --exec-p=* | --exec-=* \ + | --exec=* | --exe=* | --ex=*) + exec_prefix=$ac_optarg ;; + + -gas | --gas | --ga | --g) + # Obsolete; use --with-gas. + with_gas=yes ;; + + -help | --help | --hel | --he | -h) + ac_init_help=long ;; + -help=r* | --help=r* | --hel=r* | --he=r* | -hr*) + ac_init_help=recursive ;; + -help=s* | --help=s* | --hel=s* | --he=s* | -hs*) + ac_init_help=short ;; + + -host | --host | --hos | --ho) + ac_prev=host_alias ;; + -host=* | --host=* | --hos=* | --ho=*) + host_alias=$ac_optarg ;; + + -htmldir | --htmldir | --htmldi | --htmld | --html | --htm | --ht) + ac_prev=htmldir ;; + -htmldir=* | --htmldir=* | --htmldi=* | --htmld=* | --html=* | --htm=* \ + | --ht=*) + htmldir=$ac_optarg ;; + + -includedir | --includedir | --includedi | --included | --include \ + | --includ | --inclu | --incl | --inc) + ac_prev=includedir ;; + -includedir=* | --includedir=* | --includedi=* | --included=* | --include=* \ + | --includ=* | --inclu=* | --incl=* | --inc=*) + includedir=$ac_optarg ;; + + -infodir | --infodir | --infodi | --infod | --info | --inf) + ac_prev=infodir ;; + -infodir=* | --infodir=* | --infodi=* | --infod=* | --info=* | --inf=*) + infodir=$ac_optarg ;; + + -libdir | --libdir | --libdi | --libd) + ac_prev=libdir ;; + -libdir=* | --libdir=* | --libdi=* | --libd=*) + libdir=$ac_optarg ;; + + -libexecdir | --libexecdir | --libexecdi | --libexecd | --libexec \ + | --libexe | --libex | --libe) + ac_prev=libexecdir ;; + -libexecdir=* | --libexecdir=* | --libexecdi=* | --libexecd=* | --libexec=* \ + | --libexe=* | --libex=* | --libe=*) + libexecdir=$ac_optarg ;; + + -localedir | --localedir | --localedi | --localed | --locale) + ac_prev=localedir ;; + -localedir=* | --localedir=* | --localedi=* | --localed=* | --locale=*) + localedir=$ac_optarg ;; + + -localstatedir | --localstatedir | --localstatedi | --localstated \ + | --localstate | --localstat | --localsta | --localst | --locals) + ac_prev=localstatedir ;; + -localstatedir=* | --localstatedir=* | --localstatedi=* | --localstated=* \ + | --localstate=* | --localstat=* | --localsta=* | --localst=* | --locals=*) + localstatedir=$ac_optarg ;; + + -mandir | --mandir | --mandi | --mand | --man | --ma | --m) + ac_prev=mandir ;; + -mandir=* | --mandir=* | --mandi=* | --mand=* | --man=* | --ma=* | --m=*) + mandir=$ac_optarg ;; + + -nfp | --nfp | --nf) + # Obsolete; use --without-fp. + with_fp=no ;; + + -no-create | --no-create | --no-creat | --no-crea | --no-cre \ + | --no-cr | --no-c | -n) + no_create=yes ;; + + -no-recursion | --no-recursion | --no-recursio | --no-recursi \ + | --no-recurs | --no-recur | --no-recu | --no-rec | --no-re | --no-r) + no_recursion=yes ;; + + -oldincludedir | --oldincludedir | --oldincludedi | --oldincluded \ + | --oldinclude | --oldinclud | --oldinclu | --oldincl | --oldinc \ + | --oldin | --oldi | --old | --ol | --o) + ac_prev=oldincludedir ;; + -oldincludedir=* | --oldincludedir=* | --oldincludedi=* | --oldincluded=* \ + | --oldinclude=* | --oldinclud=* | --oldinclu=* | --oldincl=* | --oldinc=* \ + | --oldin=* | --oldi=* | --old=* | --ol=* | --o=*) + oldincludedir=$ac_optarg ;; + + -prefix | --prefix | --prefi | --pref | --pre | --pr | --p) + ac_prev=prefix ;; + -prefix=* | --prefix=* | --prefi=* | --pref=* | --pre=* | --pr=* | --p=*) + prefix=$ac_optarg ;; + + -program-prefix | --program-prefix | --program-prefi | --program-pref \ + | --program-pre | --program-pr | --program-p) + ac_prev=program_prefix ;; + -program-prefix=* | --program-prefix=* | --program-prefi=* \ + | --program-pref=* | --program-pre=* | --program-pr=* | --program-p=*) + program_prefix=$ac_optarg ;; + + -program-suffix | --program-suffix | --program-suffi | --program-suff \ + | --program-suf | --program-su | --program-s) + ac_prev=program_suffix ;; + -program-suffix=* | --program-suffix=* | --program-suffi=* \ + | --program-suff=* | --program-suf=* | --program-su=* | --program-s=*) + program_suffix=$ac_optarg ;; + + -program-transform-name | --program-transform-name \ + | --program-transform-nam | --program-transform-na \ + | --program-transform-n | --program-transform- \ + | --program-transform | --program-transfor \ + | --program-transfo | --program-transf \ + | --program-trans | --program-tran \ + | --progr-tra | --program-tr | --program-t) + ac_prev=program_transform_name ;; + -program-transform-name=* | --program-transform-name=* \ + | --program-transform-nam=* | --program-transform-na=* \ + | --program-transform-n=* | --program-transform-=* \ + | --program-transform=* | --program-transfor=* \ + | --program-transfo=* | --program-transf=* \ + | --program-trans=* | --program-tran=* \ + | --progr-tra=* | --program-tr=* | --program-t=*) + program_transform_name=$ac_optarg ;; + + -pdfdir | --pdfdir | --pdfdi | --pdfd | --pdf | --pd) + ac_prev=pdfdir ;; + -pdfdir=* | --pdfdir=* | --pdfdi=* | --pdfd=* | --pdf=* | --pd=*) + pdfdir=$ac_optarg ;; + + -psdir | --psdir | --psdi | --psd | --ps) + ac_prev=psdir ;; + -psdir=* | --psdir=* | --psdi=* | --psd=* | --ps=*) + psdir=$ac_optarg ;; + + -q | -quiet | --quiet | --quie | --qui | --qu | --q \ + | -silent | --silent | --silen | --sile | --sil) + silent=yes ;; + + -sbindir | --sbindir | --sbindi | --sbind | --sbin | --sbi | --sb) + ac_prev=sbindir ;; + -sbindir=* | --sbindir=* | --sbindi=* | --sbind=* | --sbin=* \ + | --sbi=* | --sb=*) + sbindir=$ac_optarg ;; + + -sharedstatedir | --sharedstatedir | --sharedstatedi \ + | --sharedstated | --sharedstate | --sharedstat | --sharedsta \ + | --sharedst | --shareds | --shared | --share | --shar \ + | --sha | --sh) + ac_prev=sharedstatedir ;; + -sharedstatedir=* | --sharedstatedir=* | --sharedstatedi=* \ + | --sharedstated=* | --sharedstate=* | --sharedstat=* | --sharedsta=* \ + | --sharedst=* | --shareds=* | --shared=* | --share=* | --shar=* \ + | --sha=* | --sh=*) + sharedstatedir=$ac_optarg ;; + + -site | --site | --sit) + ac_prev=site ;; + -site=* | --site=* | --sit=*) + site=$ac_optarg ;; + + -srcdir | --srcdir | --srcdi | --srcd | --src | --sr) + ac_prev=srcdir ;; + -srcdir=* | --srcdir=* | --srcdi=* | --srcd=* | --src=* | --sr=*) + srcdir=$ac_optarg ;; + + -sysconfdir | --sysconfdir | --sysconfdi | --sysconfd | --sysconf \ + | --syscon | --sysco | --sysc | --sys | --sy) + ac_prev=sysconfdir ;; + -sysconfdir=* | --sysconfdir=* | --sysconfdi=* | --sysconfd=* | --sysconf=* \ + | --syscon=* | --sysco=* | --sysc=* | --sys=* | --sy=*) + sysconfdir=$ac_optarg ;; + + -target | --target | --targe | --targ | --tar | --ta | --t) + ac_prev=target_alias ;; + -target=* | --target=* | --targe=* | --targ=* | --tar=* | --ta=* | --t=*) + target_alias=$ac_optarg ;; + + -v | -verbose | --verbose | --verbos | --verbo | --verb) + verbose=yes ;; + + -version | --version | --versio | --versi | --vers | -V) + ac_init_version=: ;; + + -with-* | --with-*) + ac_package=`expr "x$ac_option" : 'x-*with-\([^=]*\)'` + # Reject names that are not valid shell variable names. + expr "x$ac_package" : ".*[^-._$as_cr_alnum]" >/dev/null && + { echo "$as_me: error: invalid package name: $ac_package" >&2 + { (exit 1); exit 1; }; } + ac_package=`echo $ac_package | sed 's/[-.]/_/g'` + eval with_$ac_package=\$ac_optarg ;; + + -without-* | --without-*) + ac_package=`expr "x$ac_option" : 'x-*without-\(.*\)'` + # Reject names that are not valid shell variable names. + expr "x$ac_package" : ".*[^-._$as_cr_alnum]" >/dev/null && + { echo "$as_me: error: invalid package name: $ac_package" >&2 + { (exit 1); exit 1; }; } + ac_package=`echo $ac_package | sed 's/[-.]/_/g'` + eval with_$ac_package=no ;; + + --x) + # Obsolete; use --with-x. + with_x=yes ;; + + -x-includes | --x-includes | --x-include | --x-includ | --x-inclu \ + | --x-incl | --x-inc | --x-in | --x-i) + ac_prev=x_includes ;; + -x-includes=* | --x-includes=* | --x-include=* | --x-includ=* | --x-inclu=* \ + | --x-incl=* | --x-inc=* | --x-in=* | --x-i=*) + x_includes=$ac_optarg ;; + + -x-libraries | --x-libraries | --x-librarie | --x-librari \ + | --x-librar | --x-libra | --x-libr | --x-lib | --x-li | --x-l) + ac_prev=x_libraries ;; + -x-libraries=* | --x-libraries=* | --x-librarie=* | --x-librari=* \ + | --x-librar=* | --x-libra=* | --x-libr=* | --x-lib=* | --x-li=* | --x-l=*) + x_libraries=$ac_optarg ;; + + -*) { echo "$as_me: error: unrecognized option: $ac_option +Try \`$0 --help' for more information." >&2 + { (exit 1); exit 1; }; } + ;; + + *=*) + ac_envvar=`expr "x$ac_option" : 'x\([^=]*\)='` + # Reject names that are not valid shell variable names. + expr "x$ac_envvar" : ".*[^_$as_cr_alnum]" >/dev/null && + { echo "$as_me: error: invalid variable name: $ac_envvar" >&2 + { (exit 1); exit 1; }; } + eval $ac_envvar=\$ac_optarg + export $ac_envvar ;; + + *) + # FIXME: should be removed in autoconf 3.0. + echo "$as_me: WARNING: you should use --build, --host, --target" >&2 + expr "x$ac_option" : ".*[^-._$as_cr_alnum]" >/dev/null && + echo "$as_me: WARNING: invalid host type: $ac_option" >&2 + : ${build_alias=$ac_option} ${host_alias=$ac_option} ${target_alias=$ac_option} + ;; + + esac +done + +if test -n "$ac_prev"; then + ac_option=--`echo $ac_prev | sed 's/_/-/g'` + { echo "$as_me: error: missing argument to $ac_option" >&2 + { (exit 1); exit 1; }; } +fi + +# Be sure to have absolute directory names. +for ac_var in exec_prefix prefix bindir sbindir libexecdir datarootdir \ + datadir sysconfdir sharedstatedir localstatedir includedir \ + oldincludedir docdir infodir htmldir dvidir pdfdir psdir \ + libdir localedir mandir +do + eval ac_val=\$$ac_var + case $ac_val in + [\\/$]* | ?:[\\/]* ) continue;; + NONE | '' ) case $ac_var in *prefix ) continue;; esac;; + esac + { echo "$as_me: error: expected an absolute directory name for --$ac_var: $ac_val" >&2 + { (exit 1); exit 1; }; } +done + +# There might be people who depend on the old broken behavior: `$host' +# used to hold the argument of --host etc. +# FIXME: To remove some day. +build=$build_alias +host=$host_alias +target=$target_alias + +# FIXME: To remove some day. +if test "x$host_alias" != x; then + if test "x$build_alias" = x; then + cross_compiling=maybe + echo "$as_me: WARNING: If you wanted to set the --build type, don't use --host. + If a cross compiler is detected then cross compile mode will be used." >&2 + elif test "x$build_alias" != "x$host_alias"; then + cross_compiling=yes + fi +fi + +ac_tool_prefix= +test -n "$host_alias" && ac_tool_prefix=$host_alias- + +test "$silent" = yes && exec 6>/dev/null + + +ac_pwd=`pwd` && test -n "$ac_pwd" && +ac_ls_di=`ls -di .` && +ac_pwd_ls_di=`cd "$ac_pwd" && ls -di .` || + { echo "$as_me: error: Working directory cannot be determined" >&2 + { (exit 1); exit 1; }; } +test "X$ac_ls_di" = "X$ac_pwd_ls_di" || + { echo "$as_me: error: pwd does not report name of working directory" >&2 + { (exit 1); exit 1; }; } + + +# Find the source files, if location was not specified. +if test -z "$srcdir"; then + ac_srcdir_defaulted=yes + # Try the directory containing this script, then the parent directory. + ac_confdir=`$as_dirname -- "$0" || +$as_expr X"$0" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \ + X"$0" : 'X\(//\)[^/]' \| \ + X"$0" : 'X\(//\)$' \| \ + X"$0" : 'X\(/\)' \| . 2>/dev/null || +echo X"$0" | + sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{ + s//\1/ + q + } + /^X\(\/\/\)[^/].*/{ + s//\1/ + q + } + /^X\(\/\/\)$/{ + s//\1/ + q + } + /^X\(\/\).*/{ + s//\1/ + q + } + s/.*/./; q'` + srcdir=$ac_confdir + if test ! -r "$srcdir/$ac_unique_file"; then + srcdir=.. + fi +else + ac_srcdir_defaulted=no +fi +if test ! -r "$srcdir/$ac_unique_file"; then + test "$ac_srcdir_defaulted" = yes && srcdir="$ac_confdir or .." + { echo "$as_me: error: cannot find sources ($ac_unique_file) in $srcdir" >&2 + { (exit 1); exit 1; }; } +fi +ac_msg="sources are in $srcdir, but \`cd $srcdir' does not work" +ac_abs_confdir=`( + cd "$srcdir" && test -r "./$ac_unique_file" || { echo "$as_me: error: $ac_msg" >&2 + { (exit 1); exit 1; }; } + pwd)` +# When building in place, set srcdir=. +if test "$ac_abs_confdir" = "$ac_pwd"; then + srcdir=. +fi +# Remove unnecessary trailing slashes from srcdir. +# Double slashes in file names in object file debugging info +# mess up M-x gdb in Emacs. +case $srcdir in +*/) srcdir=`expr "X$srcdir" : 'X\(.*[^/]\)' \| "X$srcdir" : 'X\(.*\)'`;; +esac +for ac_var in $ac_precious_vars; do + eval ac_env_${ac_var}_set=\${${ac_var}+set} + eval ac_env_${ac_var}_value=\$${ac_var} + eval ac_cv_env_${ac_var}_set=\${${ac_var}+set} + eval ac_cv_env_${ac_var}_value=\$${ac_var} +done + +# +# Report the --help message. +# +if test "$ac_init_help" = "long"; then + # Omit some internal or obsolete options to make the list less imposing. + # This message is too long to be a string in the A/UX 3.1 sh. + cat <<_ACEOF +\`configure' configures FASTX Toolkit 0.0.6 to adapt to many kinds of systems. + +Usage: $0 [OPTION]... [VAR=VALUE]... + +To assign environment variables (e.g., CC, CFLAGS...), specify them as +VAR=VALUE. See below for descriptions of some of the useful variables. + +Defaults for the options are specified in brackets. + +Configuration: + -h, --help display this help and exit + --help=short display options specific to this package + --help=recursive display the short help of all the included packages + -V, --version display version information and exit + -q, --quiet, --silent do not print \`checking...' messages + --cache-file=FILE cache test results in FILE [disabled] + -C, --config-cache alias for \`--cache-file=config.cache' + -n, --no-create do not create output files + --srcdir=DIR find the sources in DIR [configure dir or \`..'] + +Installation directories: + --prefix=PREFIX install architecture-independent files in PREFIX + [$ac_default_prefix] + --exec-prefix=EPREFIX install architecture-dependent files in EPREFIX + [PREFIX] + +By default, \`make install' will install all the files in +\`$ac_default_prefix/bin', \`$ac_default_prefix/lib' etc. You can specify +an installation prefix other than \`$ac_default_prefix' using \`--prefix', +for instance \`--prefix=\$HOME'. + +For better control, use the options below. + +Fine tuning of the installation directories: + --bindir=DIR user executables [EPREFIX/bin] + --sbindir=DIR system admin executables [EPREFIX/sbin] + --libexecdir=DIR program executables [EPREFIX/libexec] + --sysconfdir=DIR read-only single-machine data [PREFIX/etc] + --sharedstatedir=DIR modifiable architecture-independent data [PREFIX/com] + --localstatedir=DIR modifiable single-machine data [PREFIX/var] + --libdir=DIR object code libraries [EPREFIX/lib] + --includedir=DIR C header files [PREFIX/include] + --oldincludedir=DIR C header files for non-gcc [/usr/include] + --datarootdir=DIR read-only arch.-independent data root [PREFIX/share] + --datadir=DIR read-only architecture-independent data [DATAROOTDIR] + --infodir=DIR info documentation [DATAROOTDIR/info] + --localedir=DIR locale-dependent data [DATAROOTDIR/locale] + --mandir=DIR man documentation [DATAROOTDIR/man] + --docdir=DIR documentation root [DATAROOTDIR/doc/fastx_toolkit] + --htmldir=DIR html documentation [DOCDIR] + --dvidir=DIR dvi documentation [DOCDIR] + --pdfdir=DIR pdf documentation [DOCDIR] + --psdir=DIR ps documentation [DOCDIR] +_ACEOF + + cat <<\_ACEOF + +Program names: + --program-prefix=PREFIX prepend PREFIX to installed program names + --program-suffix=SUFFIX append SUFFIX to installed program names + --program-transform-name=PROGRAM run sed PROGRAM on installed program names + +System types: + --build=BUILD configure for building on BUILD [guessed] + --host=HOST cross-compile to build programs to run on HOST [BUILD] +_ACEOF +fi + +if test -n "$ac_init_help"; then + case $ac_init_help in + short | recursive ) echo "Configuration of FASTX Toolkit 0.0.6:";; + esac + cat <<\_ACEOF + +Optional Features: + --disable-FEATURE do not include FEATURE (same as --enable-FEATURE=no) + --enable-FEATURE[=ARG] include FEATURE [ARG=yes] + --enable-wall Enable many common GCC warnings (-Wall,-Wextra, -Werror etc., default enabled) + --enable-debug Enable debug mode (default enabled) + --disable-dependency-tracking speeds up one-time build + --enable-dependency-tracking do not reject slow dependency extractors + --disable-assert don't use cpp.h assert + +Optional Packages: + --with-PACKAGE[=ARG] use PACKAGE [ARG=yes] + --without-PACKAGE do not use PACKAGE (same as --with-PACKAGE=no) + --with-warnings Turn on warnings + +Some influential environment variables: + CC C compiler command + CFLAGS C compiler flags + LDFLAGS linker flags, e.g. -L if you have libraries in a + nonstandard directory + LIBS libraries to pass to the linker, e.g. -l + CPPFLAGS C/C++/Objective C preprocessor flags, e.g. -I if + you have headers in a nonstandard directory + CPP C preprocessor + CXX C++ compiler command + CXXFLAGS C++ compiler flags + CXXCPP C++ preprocessor + +Use these variables to override the choices made by `configure' or to help +it to find libraries and programs with nonstandard names/locations. + +Report bugs to . +_ACEOF +ac_status=$? +fi + +if test "$ac_init_help" = "recursive"; then + # If there are subdirs, report their specific --help. + for ac_dir in : $ac_subdirs_all; do test "x$ac_dir" = x: && continue + test -d "$ac_dir" || continue + ac_builddir=. + +case "$ac_dir" in +.) ac_dir_suffix= ac_top_builddir_sub=. ac_top_build_prefix= ;; +*) + ac_dir_suffix=/`echo "$ac_dir" | sed 's,^\.[\\/],,'` + # A ".." for each directory in $ac_dir_suffix. + ac_top_builddir_sub=`echo "$ac_dir_suffix" | sed 's,/[^\\/]*,/..,g;s,/,,'` + case $ac_top_builddir_sub in + "") ac_top_builddir_sub=. ac_top_build_prefix= ;; + *) ac_top_build_prefix=$ac_top_builddir_sub/ ;; + esac ;; +esac +ac_abs_top_builddir=$ac_pwd +ac_abs_builddir=$ac_pwd$ac_dir_suffix +# for backward compatibility: +ac_top_builddir=$ac_top_build_prefix + +case $srcdir in + .) # We are building in place. + ac_srcdir=. + ac_top_srcdir=$ac_top_builddir_sub + ac_abs_top_srcdir=$ac_pwd ;; + [\\/]* | ?:[\\/]* ) # Absolute name. + ac_srcdir=$srcdir$ac_dir_suffix; + ac_top_srcdir=$srcdir + ac_abs_top_srcdir=$srcdir ;; + *) # Relative name. + ac_srcdir=$ac_top_build_prefix$srcdir$ac_dir_suffix + ac_top_srcdir=$ac_top_build_prefix$srcdir + ac_abs_top_srcdir=$ac_pwd/$srcdir ;; +esac +ac_abs_srcdir=$ac_abs_top_srcdir$ac_dir_suffix + + cd "$ac_dir" || { ac_status=$?; continue; } + # Check for guested configure. + if test -f "$ac_srcdir/configure.gnu"; then + echo && + $SHELL "$ac_srcdir/configure.gnu" --help=recursive + elif test -f "$ac_srcdir/configure"; then + echo && + $SHELL "$ac_srcdir/configure" --help=recursive + else + echo "$as_me: WARNING: no configuration information is in $ac_dir" >&2 + fi || ac_status=$? + cd "$ac_pwd" || { ac_status=$?; break; } + done +fi + +test -n "$ac_init_help" && exit $ac_status +if $ac_init_version; then + cat <<\_ACEOF +FASTX Toolkit configure 0.0.6 +generated by GNU Autoconf 2.61 + +Copyright (C) 1992, 1993, 1994, 1995, 1996, 1998, 1999, 2000, 2001, +2002, 2003, 2004, 2005, 2006 Free Software Foundation, Inc. +This configure script is free software; the Free Software Foundation +gives unlimited permission to copy, distribute and modify it. +_ACEOF + exit +fi +cat >config.log <<_ACEOF +This file contains any messages produced by compilers while +running configure, to aid debugging if configure makes a mistake. + +It was created by FASTX Toolkit $as_me 0.0.6, which was +generated by GNU Autoconf 2.61. Invocation command line was + + $ $0 $@ + +_ACEOF +exec 5>>config.log +{ +cat <<_ASUNAME +## --------- ## +## Platform. ## +## --------- ## + +hostname = `(hostname || uname -n) 2>/dev/null | sed 1q` +uname -m = `(uname -m) 2>/dev/null || echo unknown` +uname -r = `(uname -r) 2>/dev/null || echo unknown` +uname -s = `(uname -s) 2>/dev/null || echo unknown` +uname -v = `(uname -v) 2>/dev/null || echo unknown` + +/usr/bin/uname -p = `(/usr/bin/uname -p) 2>/dev/null || echo unknown` +/bin/uname -X = `(/bin/uname -X) 2>/dev/null || echo unknown` + +/bin/arch = `(/bin/arch) 2>/dev/null || echo unknown` +/usr/bin/arch -k = `(/usr/bin/arch -k) 2>/dev/null || echo unknown` +/usr/convex/getsysinfo = `(/usr/convex/getsysinfo) 2>/dev/null || echo unknown` +/usr/bin/hostinfo = `(/usr/bin/hostinfo) 2>/dev/null || echo unknown` +/bin/machine = `(/bin/machine) 2>/dev/null || echo unknown` +/usr/bin/oslevel = `(/usr/bin/oslevel) 2>/dev/null || echo unknown` +/bin/universe = `(/bin/universe) 2>/dev/null || echo unknown` + +_ASUNAME + +as_save_IFS=$IFS; IFS=$PATH_SEPARATOR +for as_dir in $PATH +do + IFS=$as_save_IFS + test -z "$as_dir" && as_dir=. + echo "PATH: $as_dir" +done +IFS=$as_save_IFS + +} >&5 + +cat >&5 <<_ACEOF + + +## ----------- ## +## Core tests. ## +## ----------- ## + +_ACEOF + + +# Keep a trace of the command line. +# Strip out --no-create and --no-recursion so they do not pile up. +# Strip out --silent because we don't want to record it for future runs. +# Also quote any args containing shell meta-characters. +# Make two passes to allow for proper duplicate-argument suppression. +ac_configure_args= +ac_configure_args0= +ac_configure_args1= +ac_must_keep_next=false +for ac_pass in 1 2 +do + for ac_arg + do + case $ac_arg in + -no-create | --no-c* | -n | -no-recursion | --no-r*) continue ;; + -q | -quiet | --quiet | --quie | --qui | --qu | --q \ + | -silent | --silent | --silen | --sile | --sil) + continue ;; + *\'*) + ac_arg=`echo "$ac_arg" | sed "s/'/'\\\\\\\\''/g"` ;; + esac + case $ac_pass in + 1) ac_configure_args0="$ac_configure_args0 '$ac_arg'" ;; + 2) + ac_configure_args1="$ac_configure_args1 '$ac_arg'" + if test $ac_must_keep_next = true; then + ac_must_keep_next=false # Got value, back to normal. + else + case $ac_arg in + *=* | --config-cache | -C | -disable-* | --disable-* \ + | -enable-* | --enable-* | -gas | --g* | -nfp | --nf* \ + | -q | -quiet | --q* | -silent | --sil* | -v | -verb* \ + | -with-* | --with-* | -without-* | --without-* | --x) + case "$ac_configure_args0 " in + "$ac_configure_args1"*" '$ac_arg' "* ) continue ;; + esac + ;; + -* ) ac_must_keep_next=true ;; + esac + fi + ac_configure_args="$ac_configure_args '$ac_arg'" + ;; + esac + done +done +$as_unset ac_configure_args0 || test "${ac_configure_args0+set}" != set || { ac_configure_args0=; export ac_configure_args0; } +$as_unset ac_configure_args1 || test "${ac_configure_args1+set}" != set || { ac_configure_args1=; export ac_configure_args1; } + +# When interrupted or exit'd, cleanup temporary files, and complete +# config.log. We remove comments because anyway the quotes in there +# would cause problems or look ugly. +# WARNING: Use '\'' to represent an apostrophe within the trap. +# WARNING: Do not start the trap code with a newline, due to a FreeBSD 4.0 bug. +trap 'exit_status=$? + # Save into config.log some information that might help in debugging. + { + echo + + cat <<\_ASBOX +## ---------------- ## +## Cache variables. ## +## ---------------- ## +_ASBOX + echo + # The following way of writing the cache mishandles newlines in values, +( + for ac_var in `(set) 2>&1 | sed -n '\''s/^\([a-zA-Z_][a-zA-Z0-9_]*\)=.*/\1/p'\''`; do + eval ac_val=\$$ac_var + case $ac_val in #( + *${as_nl}*) + case $ac_var in #( + *_cv_*) { echo "$as_me:$LINENO: WARNING: Cache variable $ac_var contains a newline." >&5 +echo "$as_me: WARNING: Cache variable $ac_var contains a newline." >&2;} ;; + esac + case $ac_var in #( + _ | IFS | as_nl) ;; #( + *) $as_unset $ac_var ;; + esac ;; + esac + done + (set) 2>&1 | + case $as_nl`(ac_space='\'' '\''; set) 2>&1` in #( + *${as_nl}ac_space=\ *) + sed -n \ + "s/'\''/'\''\\\\'\'''\''/g; + s/^\\([_$as_cr_alnum]*_cv_[_$as_cr_alnum]*\\)=\\(.*\\)/\\1='\''\\2'\''/p" + ;; #( + *) + sed -n "/^[_$as_cr_alnum]*_cv_[_$as_cr_alnum]*=/p" + ;; + esac | + sort +) + echo + + cat <<\_ASBOX +## ----------------- ## +## Output variables. ## +## ----------------- ## +_ASBOX + echo + for ac_var in $ac_subst_vars + do + eval ac_val=\$$ac_var + case $ac_val in + *\'\''*) ac_val=`echo "$ac_val" | sed "s/'\''/'\''\\\\\\\\'\'''\''/g"`;; + esac + echo "$ac_var='\''$ac_val'\''" + done | sort + echo + + if test -n "$ac_subst_files"; then + cat <<\_ASBOX +## ------------------- ## +## File substitutions. ## +## ------------------- ## +_ASBOX + echo + for ac_var in $ac_subst_files + do + eval ac_val=\$$ac_var + case $ac_val in + *\'\''*) ac_val=`echo "$ac_val" | sed "s/'\''/'\''\\\\\\\\'\'''\''/g"`;; + esac + echo "$ac_var='\''$ac_val'\''" + done | sort + echo + fi + + if test -s confdefs.h; then + cat <<\_ASBOX +## ----------- ## +## confdefs.h. ## +## ----------- ## +_ASBOX + echo + cat confdefs.h + echo + fi + test "$ac_signal" != 0 && + echo "$as_me: caught signal $ac_signal" + echo "$as_me: exit $exit_status" + } >&5 + rm -f core *.core core.conftest.* && + rm -f -r conftest* confdefs* conf$$* $ac_clean_files && + exit $exit_status +' 0 +for ac_signal in 1 2 13 15; do + trap 'ac_signal='$ac_signal'; { (exit 1); exit 1; }' $ac_signal +done +ac_signal=0 + +# confdefs.h avoids OS command line length limits that DEFS can exceed. +rm -f -r conftest* confdefs.h + +# Predefined preprocessor variables. + +cat >>confdefs.h <<_ACEOF +#define PACKAGE_NAME "$PACKAGE_NAME" +_ACEOF + + +cat >>confdefs.h <<_ACEOF +#define PACKAGE_TARNAME "$PACKAGE_TARNAME" +_ACEOF + + +cat >>confdefs.h <<_ACEOF +#define PACKAGE_VERSION "$PACKAGE_VERSION" +_ACEOF + + +cat >>confdefs.h <<_ACEOF +#define PACKAGE_STRING "$PACKAGE_STRING" +_ACEOF + + +cat >>confdefs.h <<_ACEOF +#define PACKAGE_BUGREPORT "$PACKAGE_BUGREPORT" +_ACEOF + + +# Let the site file select an alternate cache file if it wants to. +# Prefer explicitly selected file to automatically selected ones. +if test -n "$CONFIG_SITE"; then + set x "$CONFIG_SITE" +elif test "x$prefix" != xNONE; then + set x "$prefix/share/config.site" "$prefix/etc/config.site" +else + set x "$ac_default_prefix/share/config.site" \ + "$ac_default_prefix/etc/config.site" +fi +shift +for ac_site_file +do + if test -r "$ac_site_file"; then + { echo "$as_me:$LINENO: loading site script $ac_site_file" >&5 +echo "$as_me: loading site script $ac_site_file" >&6;} + sed 's/^/| /' "$ac_site_file" >&5 + . "$ac_site_file" + fi +done + +if test -r "$cache_file"; then + # Some versions of bash will fail to source /dev/null (special + # files actually), so we avoid doing that. + if test -f "$cache_file"; then + { echo "$as_me:$LINENO: loading cache $cache_file" >&5 +echo "$as_me: loading cache $cache_file" >&6;} + case $cache_file in + [\\/]* | ?:[\\/]* ) . "$cache_file";; + *) . "./$cache_file";; + esac + fi +else + { echo "$as_me:$LINENO: creating cache $cache_file" >&5 +echo "$as_me: creating cache $cache_file" >&6;} + >$cache_file +fi + +# Check that the precious variables saved in the cache have kept the same +# value. +ac_cache_corrupted=false +for ac_var in $ac_precious_vars; do + eval ac_old_set=\$ac_cv_env_${ac_var}_set + eval ac_new_set=\$ac_env_${ac_var}_set + eval ac_old_val=\$ac_cv_env_${ac_var}_value + eval ac_new_val=\$ac_env_${ac_var}_value + case $ac_old_set,$ac_new_set in + set,) + { echo "$as_me:$LINENO: error: \`$ac_var' was set to \`$ac_old_val' in the previous run" >&5 +echo "$as_me: error: \`$ac_var' was set to \`$ac_old_val' in the previous run" >&2;} + ac_cache_corrupted=: ;; + ,set) + { echo "$as_me:$LINENO: error: \`$ac_var' was not set in the previous run" >&5 +echo "$as_me: error: \`$ac_var' was not set in the previous run" >&2;} + ac_cache_corrupted=: ;; + ,);; + *) + if test "x$ac_old_val" != "x$ac_new_val"; then + { echo "$as_me:$LINENO: error: \`$ac_var' has changed since the previous run:" >&5 +echo "$as_me: error: \`$ac_var' has changed since the previous run:" >&2;} + { echo "$as_me:$LINENO: former value: $ac_old_val" >&5 +echo "$as_me: former value: $ac_old_val" >&2;} + { echo "$as_me:$LINENO: current value: $ac_new_val" >&5 +echo "$as_me: current value: $ac_new_val" >&2;} + ac_cache_corrupted=: + fi;; + esac + # Pass precious variables to config.status. + if test "$ac_new_set" = set; then + case $ac_new_val in + *\'*) ac_arg=$ac_var=`echo "$ac_new_val" | sed "s/'/'\\\\\\\\''/g"` ;; + *) ac_arg=$ac_var=$ac_new_val ;; + esac + case " $ac_configure_args " in + *" '$ac_arg' "*) ;; # Avoid dups. Use of quotes ensures accuracy. + *) ac_configure_args="$ac_configure_args '$ac_arg'" ;; + esac + fi +done +if $ac_cache_corrupted; then + { echo "$as_me:$LINENO: error: changes in the environment can compromise the build" >&5 +echo "$as_me: error: changes in the environment can compromise the build" >&2;} + { { echo "$as_me:$LINENO: error: run \`make distclean' and/or \`rm $cache_file' and start over" >&5 +echo "$as_me: error: run \`make distclean' and/or \`rm $cache_file' and start over" >&2;} + { (exit 1); exit 1; }; } +fi + + + + + + + + + + + + + + + + + + + + + + + + + +ac_ext=c +ac_cpp='$CPP $CPPFLAGS' +ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5' +ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5' +ac_compiler_gnu=$ac_cv_c_compiler_gnu + + +ac_aux_dir= +for ac_dir in config "$srcdir"/config; do + if test -f "$ac_dir/install-sh"; then + ac_aux_dir=$ac_dir + ac_install_sh="$ac_aux_dir/install-sh -c" + break + elif test -f "$ac_dir/install.sh"; then + ac_aux_dir=$ac_dir + ac_install_sh="$ac_aux_dir/install.sh -c" + break + elif test -f "$ac_dir/shtool"; then + ac_aux_dir=$ac_dir + ac_install_sh="$ac_aux_dir/shtool install -c" + break + fi +done +if test -z "$ac_aux_dir"; then + { { echo "$as_me:$LINENO: error: cannot find install-sh or install.sh in config \"$srcdir\"/config" >&5 +echo "$as_me: error: cannot find install-sh or install.sh in config \"$srcdir\"/config" >&2;} + { (exit 1); exit 1; }; } +fi + +# These three variables are undocumented and unsupported, +# and are intended to be withdrawn in a future Autoconf release. +# They can cause serious problems if a builder's source tree is in a directory +# whose full name contains unusual characters. +ac_config_guess="$SHELL $ac_aux_dir/config.guess" # Please don't use this var. +ac_config_sub="$SHELL $ac_aux_dir/config.sub" # Please don't use this var. +ac_configure="$SHELL $ac_aux_dir/configure" # Please don't use this var. + + +ac_config_headers="$ac_config_headers config.h" + +am__api_version='1.10' + +# Find a good install program. We prefer a C program (faster), +# so one script is as good as another. But avoid the broken or +# incompatible versions: +# SysV /etc/install, /usr/sbin/install +# SunOS /usr/etc/install +# IRIX /sbin/install +# AIX /bin/install +# AmigaOS /C/install, which installs bootblocks on floppy discs +# AIX 4 /usr/bin/installbsd, which doesn't work without a -g flag +# AFS /usr/afsws/bin/install, which mishandles nonexistent args +# SVR4 /usr/ucb/install, which tries to use the nonexistent group "staff" +# OS/2's system install, which has a completely different semantic +# ./install, which can be erroneously created by make from ./install.sh. +{ echo "$as_me:$LINENO: checking for a BSD-compatible install" >&5 +echo $ECHO_N "checking for a BSD-compatible install... $ECHO_C" >&6; } +if test -z "$INSTALL"; then +if test "${ac_cv_path_install+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + as_save_IFS=$IFS; IFS=$PATH_SEPARATOR +for as_dir in $PATH +do + IFS=$as_save_IFS + test -z "$as_dir" && as_dir=. + # Account for people who put trailing slashes in PATH elements. +case $as_dir/ in + ./ | .// | /cC/* | \ + /etc/* | /usr/sbin/* | /usr/etc/* | /sbin/* | /usr/afsws/bin/* | \ + ?:\\/os2\\/install\\/* | ?:\\/OS2\\/INSTALL\\/* | \ + /usr/ucb/* ) ;; + *) + # OSF1 and SCO ODT 3.0 have their own names for install. + # Don't use installbsd from OSF since it installs stuff as root + # by default. + for ac_prog in ginstall scoinst install; do + for ac_exec_ext in '' $ac_executable_extensions; do + if { test -f "$as_dir/$ac_prog$ac_exec_ext" && $as_test_x "$as_dir/$ac_prog$ac_exec_ext"; }; then + if test $ac_prog = install && + grep dspmsg "$as_dir/$ac_prog$ac_exec_ext" >/dev/null 2>&1; then + # AIX install. It has an incompatible calling convention. + : + elif test $ac_prog = install && + grep pwplus "$as_dir/$ac_prog$ac_exec_ext" >/dev/null 2>&1; then + # program-specific install script used by HP pwplus--don't use. + : + else + ac_cv_path_install="$as_dir/$ac_prog$ac_exec_ext -c" + break 3 + fi + fi + done + done + ;; +esac +done +IFS=$as_save_IFS + + +fi + if test "${ac_cv_path_install+set}" = set; then + INSTALL=$ac_cv_path_install + else + # As a last resort, use the slow shell script. Don't cache a + # value for INSTALL within a source directory, because that will + # break other packages using the cache if that directory is + # removed, or if the value is a relative name. + INSTALL=$ac_install_sh + fi +fi +{ echo "$as_me:$LINENO: result: $INSTALL" >&5 +echo "${ECHO_T}$INSTALL" >&6; } + +# Use test -z because SunOS4 sh mishandles braces in ${var-val}. +# It thinks the first close brace ends the variable substitution. +test -z "$INSTALL_PROGRAM" && INSTALL_PROGRAM='${INSTALL}' + +test -z "$INSTALL_SCRIPT" && INSTALL_SCRIPT='${INSTALL}' + +test -z "$INSTALL_DATA" && INSTALL_DATA='${INSTALL} -m 644' + +{ echo "$as_me:$LINENO: checking whether build environment is sane" >&5 +echo $ECHO_N "checking whether build environment is sane... $ECHO_C" >&6; } +# Just in case +sleep 1 +echo timestamp > conftest.file +# Do `set' in a subshell so we don't clobber the current shell's +# arguments. Must try -L first in case configure is actually a +# symlink; some systems play weird games with the mod time of symlinks +# (eg FreeBSD returns the mod time of the symlink's containing +# directory). +if ( + set X `ls -Lt $srcdir/configure conftest.file 2> /dev/null` + if test "$*" = "X"; then + # -L didn't work. + set X `ls -t $srcdir/configure conftest.file` + fi + rm -f conftest.file + if test "$*" != "X $srcdir/configure conftest.file" \ + && test "$*" != "X conftest.file $srcdir/configure"; then + + # If neither matched, then we have a broken ls. This can happen + # if, for instance, CONFIG_SHELL is bash and it inherits a + # broken ls alias from the environment. This has actually + # happened. Such a system could not be considered "sane". + { { echo "$as_me:$LINENO: error: ls -t appears to fail. Make sure there is not a broken +alias in your environment" >&5 +echo "$as_me: error: ls -t appears to fail. Make sure there is not a broken +alias in your environment" >&2;} + { (exit 1); exit 1; }; } + fi + + test "$2" = conftest.file + ) +then + # Ok. + : +else + { { echo "$as_me:$LINENO: error: newly created file is older than distributed files! +Check your system clock" >&5 +echo "$as_me: error: newly created file is older than distributed files! +Check your system clock" >&2;} + { (exit 1); exit 1; }; } +fi +{ echo "$as_me:$LINENO: result: yes" >&5 +echo "${ECHO_T}yes" >&6; } +test "$program_prefix" != NONE && + program_transform_name="s&^&$program_prefix&;$program_transform_name" +# Use a double $ so make ignores it. +test "$program_suffix" != NONE && + program_transform_name="s&\$&$program_suffix&;$program_transform_name" +# Double any \ or $. echo might interpret backslashes. +# By default was `s,x,x', remove it if useless. +cat <<\_ACEOF >conftest.sed +s/[\\$]/&&/g;s/;s,x,x,$// +_ACEOF +program_transform_name=`echo $program_transform_name | sed -f conftest.sed` +rm -f conftest.sed + +# expand $ac_aux_dir to an absolute path +am_aux_dir=`cd $ac_aux_dir && pwd` + +test x"${MISSING+set}" = xset || MISSING="\${SHELL} $am_aux_dir/missing" +# Use eval to expand $SHELL +if eval "$MISSING --run true"; then + am_missing_run="$MISSING --run " +else + am_missing_run= + { echo "$as_me:$LINENO: WARNING: \`missing' script is too old or missing" >&5 +echo "$as_me: WARNING: \`missing' script is too old or missing" >&2;} +fi + +{ echo "$as_me:$LINENO: checking for a thread-safe mkdir -p" >&5 +echo $ECHO_N "checking for a thread-safe mkdir -p... $ECHO_C" >&6; } +if test -z "$MKDIR_P"; then + if test "${ac_cv_path_mkdir+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + as_save_IFS=$IFS; IFS=$PATH_SEPARATOR +for as_dir in $PATH$PATH_SEPARATOR/opt/sfw/bin +do + IFS=$as_save_IFS + test -z "$as_dir" && as_dir=. + for ac_prog in mkdir gmkdir; do + for ac_exec_ext in '' $ac_executable_extensions; do + { test -f "$as_dir/$ac_prog$ac_exec_ext" && $as_test_x "$as_dir/$ac_prog$ac_exec_ext"; } || continue + case `"$as_dir/$ac_prog$ac_exec_ext" --version 2>&1` in #( + 'mkdir (GNU coreutils) '* | \ + 'mkdir (coreutils) '* | \ + 'mkdir (fileutils) '4.1*) + ac_cv_path_mkdir=$as_dir/$ac_prog$ac_exec_ext + break 3;; + esac + done + done +done +IFS=$as_save_IFS + +fi + + if test "${ac_cv_path_mkdir+set}" = set; then + MKDIR_P="$ac_cv_path_mkdir -p" + else + # As a last resort, use the slow shell script. Don't cache a + # value for MKDIR_P within a source directory, because that will + # break other packages using the cache if that directory is + # removed, or if the value is a relative name. + test -d ./--version && rmdir ./--version + MKDIR_P="$ac_install_sh -d" + fi +fi +{ echo "$as_me:$LINENO: result: $MKDIR_P" >&5 +echo "${ECHO_T}$MKDIR_P" >&6; } + +mkdir_p="$MKDIR_P" +case $mkdir_p in + [\\/$]* | ?:[\\/]*) ;; + */*) mkdir_p="\$(top_builddir)/$mkdir_p" ;; +esac + +for ac_prog in gawk mawk nawk awk +do + # Extract the first word of "$ac_prog", so it can be a program name with args. +set dummy $ac_prog; ac_word=$2 +{ echo "$as_me:$LINENO: checking for $ac_word" >&5 +echo $ECHO_N "checking for $ac_word... $ECHO_C" >&6; } +if test "${ac_cv_prog_AWK+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + if test -n "$AWK"; then + ac_cv_prog_AWK="$AWK" # Let the user override the test. +else +as_save_IFS=$IFS; IFS=$PATH_SEPARATOR +for as_dir in $PATH +do + IFS=$as_save_IFS + test -z "$as_dir" && as_dir=. + for ac_exec_ext in '' $ac_executable_extensions; do + if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then + ac_cv_prog_AWK="$ac_prog" + echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5 + break 2 + fi +done +done +IFS=$as_save_IFS + +fi +fi +AWK=$ac_cv_prog_AWK +if test -n "$AWK"; then + { echo "$as_me:$LINENO: result: $AWK" >&5 +echo "${ECHO_T}$AWK" >&6; } +else + { echo "$as_me:$LINENO: result: no" >&5 +echo "${ECHO_T}no" >&6; } +fi + + + test -n "$AWK" && break +done + +{ echo "$as_me:$LINENO: checking whether ${MAKE-make} sets \$(MAKE)" >&5 +echo $ECHO_N "checking whether ${MAKE-make} sets \$(MAKE)... $ECHO_C" >&6; } +set x ${MAKE-make}; ac_make=`echo "$2" | sed 's/+/p/g; s/[^a-zA-Z0-9_]/_/g'` +if { as_var=ac_cv_prog_make_${ac_make}_set; eval "test \"\${$as_var+set}\" = set"; }; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + cat >conftest.make <<\_ACEOF +SHELL = /bin/sh +all: + @echo '@@@%%%=$(MAKE)=@@@%%%' +_ACEOF +# GNU make sometimes prints "make[1]: Entering...", which would confuse us. +case `${MAKE-make} -f conftest.make 2>/dev/null` in + *@@@%%%=?*=@@@%%%*) + eval ac_cv_prog_make_${ac_make}_set=yes;; + *) + eval ac_cv_prog_make_${ac_make}_set=no;; +esac +rm -f conftest.make +fi +if eval test \$ac_cv_prog_make_${ac_make}_set = yes; then + { echo "$as_me:$LINENO: result: yes" >&5 +echo "${ECHO_T}yes" >&6; } + SET_MAKE= +else + { echo "$as_me:$LINENO: result: no" >&5 +echo "${ECHO_T}no" >&6; } + SET_MAKE="MAKE=${MAKE-make}" +fi + +rm -rf .tst 2>/dev/null +mkdir .tst 2>/dev/null +if test -d .tst; then + am__leading_dot=. +else + am__leading_dot=_ +fi +rmdir .tst 2>/dev/null + +if test "`cd $srcdir && pwd`" != "`pwd`"; then + # Use -I$(srcdir) only when $(srcdir) != ., so that make's output + # is not polluted with repeated "-I." + am__isrc=' -I$(srcdir)' + # test to see if srcdir already configured + if test -f $srcdir/config.status; then + { { echo "$as_me:$LINENO: error: source directory already configured; run \"make distclean\" there first" >&5 +echo "$as_me: error: source directory already configured; run \"make distclean\" there first" >&2;} + { (exit 1); exit 1; }; } + fi +fi + +# test whether we have cygpath +if test -z "$CYGPATH_W"; then + if (cygpath --version) >/dev/null 2>/dev/null; then + CYGPATH_W='cygpath -w' + else + CYGPATH_W=echo + fi +fi + + +# Define the identity of the package. + PACKAGE='fastx_toolkit' + VERSION='0.0.6' + + +cat >>confdefs.h <<_ACEOF +#define PACKAGE "$PACKAGE" +_ACEOF + + +cat >>confdefs.h <<_ACEOF +#define VERSION "$VERSION" +_ACEOF + +# Some tools Automake needs. + +ACLOCAL=${ACLOCAL-"${am_missing_run}aclocal-${am__api_version}"} + + +AUTOCONF=${AUTOCONF-"${am_missing_run}autoconf"} + + +AUTOMAKE=${AUTOMAKE-"${am_missing_run}automake-${am__api_version}"} + + +AUTOHEADER=${AUTOHEADER-"${am_missing_run}autoheader"} + + +MAKEINFO=${MAKEINFO-"${am_missing_run}makeinfo"} + +install_sh=${install_sh-"\$(SHELL) $am_aux_dir/install-sh"} + +# Installed binaries are usually stripped using `strip' when the user +# run `make install-strip'. However `strip' might not be the right +# tool to use in cross-compilation environments, therefore Automake +# will honor the `STRIP' environment variable to overrule this program. +if test "$cross_compiling" != no; then + if test -n "$ac_tool_prefix"; then + # Extract the first word of "${ac_tool_prefix}strip", so it can be a program name with args. +set dummy ${ac_tool_prefix}strip; ac_word=$2 +{ echo "$as_me:$LINENO: checking for $ac_word" >&5 +echo $ECHO_N "checking for $ac_word... $ECHO_C" >&6; } +if test "${ac_cv_prog_STRIP+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + if test -n "$STRIP"; then + ac_cv_prog_STRIP="$STRIP" # Let the user override the test. +else +as_save_IFS=$IFS; IFS=$PATH_SEPARATOR +for as_dir in $PATH +do + IFS=$as_save_IFS + test -z "$as_dir" && as_dir=. + for ac_exec_ext in '' $ac_executable_extensions; do + if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then + ac_cv_prog_STRIP="${ac_tool_prefix}strip" + echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5 + break 2 + fi +done +done +IFS=$as_save_IFS + +fi +fi +STRIP=$ac_cv_prog_STRIP +if test -n "$STRIP"; then + { echo "$as_me:$LINENO: result: $STRIP" >&5 +echo "${ECHO_T}$STRIP" >&6; } +else + { echo "$as_me:$LINENO: result: no" >&5 +echo "${ECHO_T}no" >&6; } +fi + + +fi +if test -z "$ac_cv_prog_STRIP"; then + ac_ct_STRIP=$STRIP + # Extract the first word of "strip", so it can be a program name with args. +set dummy strip; ac_word=$2 +{ echo "$as_me:$LINENO: checking for $ac_word" >&5 +echo $ECHO_N "checking for $ac_word... $ECHO_C" >&6; } +if test "${ac_cv_prog_ac_ct_STRIP+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + if test -n "$ac_ct_STRIP"; then + ac_cv_prog_ac_ct_STRIP="$ac_ct_STRIP" # Let the user override the test. +else +as_save_IFS=$IFS; IFS=$PATH_SEPARATOR +for as_dir in $PATH +do + IFS=$as_save_IFS + test -z "$as_dir" && as_dir=. + for ac_exec_ext in '' $ac_executable_extensions; do + if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then + ac_cv_prog_ac_ct_STRIP="strip" + echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5 + break 2 + fi +done +done +IFS=$as_save_IFS + +fi +fi +ac_ct_STRIP=$ac_cv_prog_ac_ct_STRIP +if test -n "$ac_ct_STRIP"; then + { echo "$as_me:$LINENO: result: $ac_ct_STRIP" >&5 +echo "${ECHO_T}$ac_ct_STRIP" >&6; } +else + { echo "$as_me:$LINENO: result: no" >&5 +echo "${ECHO_T}no" >&6; } +fi + + if test "x$ac_ct_STRIP" = x; then + STRIP=":" + else + case $cross_compiling:$ac_tool_warned in +yes:) +{ echo "$as_me:$LINENO: WARNING: In the future, Autoconf will not detect cross-tools +whose name does not start with the host triplet. If you think this +configuration is useful to you, please write to autoconf@gnu.org." >&5 +echo "$as_me: WARNING: In the future, Autoconf will not detect cross-tools +whose name does not start with the host triplet. If you think this +configuration is useful to you, please write to autoconf@gnu.org." >&2;} +ac_tool_warned=yes ;; +esac + STRIP=$ac_ct_STRIP + fi +else + STRIP="$ac_cv_prog_STRIP" +fi + +fi +INSTALL_STRIP_PROGRAM="\$(install_sh) -c -s" + +# We need awk for the "check" target. The system "awk" is bad on +# some platforms. +# Always define AMTAR for backward compatibility. + +AMTAR=${AMTAR-"${am_missing_run}tar"} + +am__tar='${AMTAR} chof - "$$tardir"'; am__untar='${AMTAR} xf -' + + + + + + +# 23dec08, Gordon +# Only added those things because 'autoheader' was complaining... + +cat >>confdefs.h <<\_ACEOF +#define CXX_HAS_BUGGY_FOR_LOOPS +_ACEOF + + +cat >>confdefs.h <<\_ACEOF +#define CXX_HAS_NO_BOOL +_ACEOF + + +cat >>confdefs.h <<\_ACEOF +#define NDEBUG +_ACEOF + + +cat >>confdefs.h <<\_ACEOF +#define YOUR_OS +_ACEOF + + +EXTRA_CHECKS="-Wall -Wextra -Wformat-nonliteral -Wformat-security -Wswitch-default -Wswitch-enum -Wunused-parameter -Wfloat-equal -Werror" +# Check whether --enable-wall was given. +if test "${enable_wall+set}" = set; then + enableval=$enable_wall; case "${enableval}" in + yes) wall=true ;; + no) wall=false ;; + *) { { echo "$as_me:$LINENO: error: bad value ${enableval} for --enable-wall" >&5 +echo "$as_me: error: bad value ${enableval} for --enable-wall" >&2;} + { (exit 1); exit 1; }; } ;; +esac +else + wall=true +fi + +if test "$wall" = "true" +then + CFLAGS="${CFLAGS} ${EXTRA_CHECKS}" + CXXFLAGS="${CXXFLAGS} ${EXTRA_CHECKS}" +fi + +# Check whether --enable-debug was given. +if test "${enable_debug+set}" = set; then + enableval=$enable_debug; case "${enableval}" in + yes) debug=true ;; + no) debug=false ;; + *) { { echo "$as_me:$LINENO: error: bad value ${enableval} for --enable-debug" >&5 +echo "$as_me: error: bad value ${enableval} for --enable-debug" >&2;} + { (exit 1); exit 1; }; } ;; +esac +else + debug=true +fi + +if test "$debug" = "true" +then + CFLAGS="${CFLAGS} -DDEBUG -g -O1" + CXXFLAGS="${CFLAGS} -DDEBUG -g -O1" +else + CFLAGS="${CFLAGS} -O3" + CXXFLAGS="${CFLAGS} -O3" +fi + + +DEPDIR="${am__leading_dot}deps" + +ac_config_commands="$ac_config_commands depfiles" + + +am_make=${MAKE-make} +cat > confinc << 'END' +am__doit: + @echo done +.PHONY: am__doit +END +# If we don't find an include directive, just comment out the code. +{ echo "$as_me:$LINENO: checking for style of include used by $am_make" >&5 +echo $ECHO_N "checking for style of include used by $am_make... $ECHO_C" >&6; } +am__include="#" +am__quote= +_am_result=none +# First try GNU make style include. +echo "include confinc" > confmf +# We grep out `Entering directory' and `Leaving directory' +# messages which can occur if `w' ends up in MAKEFLAGS. +# In particular we don't look at `^make:' because GNU make might +# be invoked under some other name (usually "gmake"), in which +# case it prints its new name instead of `make'. +if test "`$am_make -s -f confmf 2> /dev/null | grep -v 'ing directory'`" = "done"; then + am__include=include + am__quote= + _am_result=GNU +fi +# Now try BSD make style include. +if test "$am__include" = "#"; then + echo '.include "confinc"' > confmf + if test "`$am_make -s -f confmf 2> /dev/null`" = "done"; then + am__include=.include + am__quote="\"" + _am_result=BSD + fi +fi + + +{ echo "$as_me:$LINENO: result: $_am_result" >&5 +echo "${ECHO_T}$_am_result" >&6; } +rm -f confinc confmf + +# Check whether --enable-dependency-tracking was given. +if test "${enable_dependency_tracking+set}" = set; then + enableval=$enable_dependency_tracking; +fi + +if test "x$enable_dependency_tracking" != xno; then + am_depcomp="$ac_aux_dir/depcomp" + AMDEPBACKSLASH='\' +fi + if test "x$enable_dependency_tracking" != xno; then + AMDEP_TRUE= + AMDEP_FALSE='#' +else + AMDEP_TRUE='#' + AMDEP_FALSE= +fi + + + + +{ echo "$as_me:$LINENO: checking for grep that handles long lines and -e" >&5 +echo $ECHO_N "checking for grep that handles long lines and -e... $ECHO_C" >&6; } +if test "${ac_cv_path_GREP+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + # Extract the first word of "grep ggrep" to use in msg output +if test -z "$GREP"; then +set dummy grep ggrep; ac_prog_name=$2 +if test "${ac_cv_path_GREP+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + ac_path_GREP_found=false +# Loop through the user's path and test for each of PROGNAME-LIST +as_save_IFS=$IFS; IFS=$PATH_SEPARATOR +for as_dir in $PATH$PATH_SEPARATOR/usr/xpg4/bin +do + IFS=$as_save_IFS + test -z "$as_dir" && as_dir=. + for ac_prog in grep ggrep; do + for ac_exec_ext in '' $ac_executable_extensions; do + ac_path_GREP="$as_dir/$ac_prog$ac_exec_ext" + { test -f "$ac_path_GREP" && $as_test_x "$ac_path_GREP"; } || continue + # Check for GNU ac_path_GREP and select it if it is found. + # Check for GNU $ac_path_GREP +case `"$ac_path_GREP" --version 2>&1` in +*GNU*) + ac_cv_path_GREP="$ac_path_GREP" ac_path_GREP_found=:;; +*) + ac_count=0 + echo $ECHO_N "0123456789$ECHO_C" >"conftest.in" + while : + do + cat "conftest.in" "conftest.in" >"conftest.tmp" + mv "conftest.tmp" "conftest.in" + cp "conftest.in" "conftest.nl" + echo 'GREP' >> "conftest.nl" + "$ac_path_GREP" -e 'GREP$' -e '-(cannot match)-' < "conftest.nl" >"conftest.out" 2>/dev/null || break + diff "conftest.out" "conftest.nl" >/dev/null 2>&1 || break + ac_count=`expr $ac_count + 1` + if test $ac_count -gt ${ac_path_GREP_max-0}; then + # Best one so far, save it but keep looking for a better one + ac_cv_path_GREP="$ac_path_GREP" + ac_path_GREP_max=$ac_count + fi + # 10*(2^10) chars as input seems more than enough + test $ac_count -gt 10 && break + done + rm -f conftest.in conftest.tmp conftest.nl conftest.out;; +esac + + + $ac_path_GREP_found && break 3 + done +done + +done +IFS=$as_save_IFS + + +fi + +GREP="$ac_cv_path_GREP" +if test -z "$GREP"; then + { { echo "$as_me:$LINENO: error: no acceptable $ac_prog_name could be found in $PATH$PATH_SEPARATOR/usr/xpg4/bin" >&5 +echo "$as_me: error: no acceptable $ac_prog_name could be found in $PATH$PATH_SEPARATOR/usr/xpg4/bin" >&2;} + { (exit 1); exit 1; }; } +fi + +else + ac_cv_path_GREP=$GREP +fi + + +fi +{ echo "$as_me:$LINENO: result: $ac_cv_path_GREP" >&5 +echo "${ECHO_T}$ac_cv_path_GREP" >&6; } + GREP="$ac_cv_path_GREP" + + +{ echo "$as_me:$LINENO: checking for egrep" >&5 +echo $ECHO_N "checking for egrep... $ECHO_C" >&6; } +if test "${ac_cv_path_EGREP+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + if echo a | $GREP -E '(a|b)' >/dev/null 2>&1 + then ac_cv_path_EGREP="$GREP -E" + else + # Extract the first word of "egrep" to use in msg output +if test -z "$EGREP"; then +set dummy egrep; ac_prog_name=$2 +if test "${ac_cv_path_EGREP+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + ac_path_EGREP_found=false +# Loop through the user's path and test for each of PROGNAME-LIST +as_save_IFS=$IFS; IFS=$PATH_SEPARATOR +for as_dir in $PATH$PATH_SEPARATOR/usr/xpg4/bin +do + IFS=$as_save_IFS + test -z "$as_dir" && as_dir=. + for ac_prog in egrep; do + for ac_exec_ext in '' $ac_executable_extensions; do + ac_path_EGREP="$as_dir/$ac_prog$ac_exec_ext" + { test -f "$ac_path_EGREP" && $as_test_x "$ac_path_EGREP"; } || continue + # Check for GNU ac_path_EGREP and select it if it is found. + # Check for GNU $ac_path_EGREP +case `"$ac_path_EGREP" --version 2>&1` in +*GNU*) + ac_cv_path_EGREP="$ac_path_EGREP" ac_path_EGREP_found=:;; +*) + ac_count=0 + echo $ECHO_N "0123456789$ECHO_C" >"conftest.in" + while : + do + cat "conftest.in" "conftest.in" >"conftest.tmp" + mv "conftest.tmp" "conftest.in" + cp "conftest.in" "conftest.nl" + echo 'EGREP' >> "conftest.nl" + "$ac_path_EGREP" 'EGREP$' < "conftest.nl" >"conftest.out" 2>/dev/null || break + diff "conftest.out" "conftest.nl" >/dev/null 2>&1 || break + ac_count=`expr $ac_count + 1` + if test $ac_count -gt ${ac_path_EGREP_max-0}; then + # Best one so far, save it but keep looking for a better one + ac_cv_path_EGREP="$ac_path_EGREP" + ac_path_EGREP_max=$ac_count + fi + # 10*(2^10) chars as input seems more than enough + test $ac_count -gt 10 && break + done + rm -f conftest.in conftest.tmp conftest.nl conftest.out;; +esac + + + $ac_path_EGREP_found && break 3 + done +done + +done +IFS=$as_save_IFS + + +fi + +EGREP="$ac_cv_path_EGREP" +if test -z "$EGREP"; then + { { echo "$as_me:$LINENO: error: no acceptable $ac_prog_name could be found in $PATH$PATH_SEPARATOR/usr/xpg4/bin" >&5 +echo "$as_me: error: no acceptable $ac_prog_name could be found in $PATH$PATH_SEPARATOR/usr/xpg4/bin" >&2;} + { (exit 1); exit 1; }; } +fi + +else + ac_cv_path_EGREP=$EGREP +fi + + + fi +fi +{ echo "$as_me:$LINENO: result: $ac_cv_path_EGREP" >&5 +echo "${ECHO_T}$ac_cv_path_EGREP" >&6; } + EGREP="$ac_cv_path_EGREP" + + +{ echo "$as_me:$LINENO: checking for ANSI C header files" >&5 +echo $ECHO_N "checking for ANSI C header files... $ECHO_C" >&6; } +if test "${ac_cv_header_stdc+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ +#include +#include +#include +#include + +int +main () +{ + + ; + return 0; +} +_ACEOF +rm -f conftest.$ac_objext +if { (ac_try="$ac_compile" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_compile") 2>conftest.er1 + ac_status=$? + grep -v '^ *+' conftest.er1 >conftest.err + rm -f conftest.er1 + cat conftest.err >&5 + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } && { + test -z "$ac_c_werror_flag" || + test ! -s conftest.err + } && test -s conftest.$ac_objext; then + ac_cv_header_stdc=yes +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + + ac_cv_header_stdc=no +fi + +rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext + +if test $ac_cv_header_stdc = yes; then + # SunOS 4.x string.h does not declare mem*, contrary to ANSI. + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ +#include + +_ACEOF +if (eval "$ac_cpp conftest.$ac_ext") 2>&5 | + $EGREP "memchr" >/dev/null 2>&1; then + : +else + ac_cv_header_stdc=no +fi +rm -f conftest* + +fi + +if test $ac_cv_header_stdc = yes; then + # ISC 2.0.2 stdlib.h does not declare free, contrary to ANSI. + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ +#include + +_ACEOF +if (eval "$ac_cpp conftest.$ac_ext") 2>&5 | + $EGREP "free" >/dev/null 2>&1; then + : +else + ac_cv_header_stdc=no +fi +rm -f conftest* + +fi + +if test $ac_cv_header_stdc = yes; then + # /bin/cc in Irix-4.0.5 gets non-ANSI ctype macros unless using -ansi. + if test "$cross_compiling" = yes; then + : +else + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ +#include +#include +#if ((' ' & 0x0FF) == 0x020) +# define ISLOWER(c) ('a' <= (c) && (c) <= 'z') +# define TOUPPER(c) (ISLOWER(c) ? 'A' + ((c) - 'a') : (c)) +#else +# define ISLOWER(c) \ + (('a' <= (c) && (c) <= 'i') \ + || ('j' <= (c) && (c) <= 'r') \ + || ('s' <= (c) && (c) <= 'z')) +# define TOUPPER(c) (ISLOWER(c) ? ((c) | 0x40) : (c)) +#endif + +#define XOR(e, f) (((e) && !(f)) || (!(e) && (f))) +int +main () +{ + int i; + for (i = 0; i < 256; i++) + if (XOR (islower (i), ISLOWER (i)) + || toupper (i) != TOUPPER (i)) + return 2; + return 0; +} +_ACEOF +rm -f conftest$ac_exeext +if { (ac_try="$ac_link" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_link") 2>&5 + ac_status=$? + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } && { ac_try='./conftest$ac_exeext' + { (case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_try") 2>&5 + ac_status=$? + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); }; }; then + : +else + echo "$as_me: program exited with status $ac_status" >&5 +echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + +( exit $ac_status ) +ac_cv_header_stdc=no +fi +rm -f core *.core core.conftest.* gmon.out bb.out conftest$ac_exeext conftest.$ac_objext conftest.$ac_ext +fi + + +fi +fi +{ echo "$as_me:$LINENO: result: $ac_cv_header_stdc" >&5 +echo "${ECHO_T}$ac_cv_header_stdc" >&6; } +if test $ac_cv_header_stdc = yes; then + +cat >>confdefs.h <<\_ACEOF +#define STDC_HEADERS 1 +_ACEOF + +fi + +# On IRIX 5.3, sys/types and inttypes.h are conflicting. + + + + + + + + + +for ac_header in sys/types.h sys/stat.h stdlib.h string.h memory.h strings.h \ + inttypes.h stdint.h unistd.h +do +as_ac_Header=`echo "ac_cv_header_$ac_header" | $as_tr_sh` +{ echo "$as_me:$LINENO: checking for $ac_header" >&5 +echo $ECHO_N "checking for $ac_header... $ECHO_C" >&6; } +if { as_var=$as_ac_Header; eval "test \"\${$as_var+set}\" = set"; }; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ +$ac_includes_default + +#include <$ac_header> +_ACEOF +rm -f conftest.$ac_objext +if { (ac_try="$ac_compile" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_compile") 2>conftest.er1 + ac_status=$? + grep -v '^ *+' conftest.er1 >conftest.err + rm -f conftest.er1 + cat conftest.err >&5 + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } && { + test -z "$ac_c_werror_flag" || + test ! -s conftest.err + } && test -s conftest.$ac_objext; then + eval "$as_ac_Header=yes" +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + + eval "$as_ac_Header=no" +fi + +rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext +fi +ac_res=`eval echo '${'$as_ac_Header'}'` + { echo "$as_me:$LINENO: result: $ac_res" >&5 +echo "${ECHO_T}$ac_res" >&6; } +if test `eval echo '${'$as_ac_Header'}'` = yes; then + cat >>confdefs.h <<_ACEOF +#define `echo "HAVE_$ac_header" | $as_tr_cpp` 1 +_ACEOF + +fi + +done + + + + ac_ext=c +ac_cpp='$CPP $CPPFLAGS' +ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5' +ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5' +ac_compiler_gnu=$ac_cv_c_compiler_gnu +if test -n "$ac_tool_prefix"; then + # Extract the first word of "${ac_tool_prefix}gcc", so it can be a program name with args. +set dummy ${ac_tool_prefix}gcc; ac_word=$2 +{ echo "$as_me:$LINENO: checking for $ac_word" >&5 +echo $ECHO_N "checking for $ac_word... $ECHO_C" >&6; } +if test "${ac_cv_prog_CC+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + if test -n "$CC"; then + ac_cv_prog_CC="$CC" # Let the user override the test. +else +as_save_IFS=$IFS; IFS=$PATH_SEPARATOR +for as_dir in $PATH +do + IFS=$as_save_IFS + test -z "$as_dir" && as_dir=. + for ac_exec_ext in '' $ac_executable_extensions; do + if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then + ac_cv_prog_CC="${ac_tool_prefix}gcc" + echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5 + break 2 + fi +done +done +IFS=$as_save_IFS + +fi +fi +CC=$ac_cv_prog_CC +if test -n "$CC"; then + { echo "$as_me:$LINENO: result: $CC" >&5 +echo "${ECHO_T}$CC" >&6; } +else + { echo "$as_me:$LINENO: result: no" >&5 +echo "${ECHO_T}no" >&6; } +fi + + +fi +if test -z "$ac_cv_prog_CC"; then + ac_ct_CC=$CC + # Extract the first word of "gcc", so it can be a program name with args. +set dummy gcc; ac_word=$2 +{ echo "$as_me:$LINENO: checking for $ac_word" >&5 +echo $ECHO_N "checking for $ac_word... $ECHO_C" >&6; } +if test "${ac_cv_prog_ac_ct_CC+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + if test -n "$ac_ct_CC"; then + ac_cv_prog_ac_ct_CC="$ac_ct_CC" # Let the user override the test. +else +as_save_IFS=$IFS; IFS=$PATH_SEPARATOR +for as_dir in $PATH +do + IFS=$as_save_IFS + test -z "$as_dir" && as_dir=. + for ac_exec_ext in '' $ac_executable_extensions; do + if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then + ac_cv_prog_ac_ct_CC="gcc" + echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5 + break 2 + fi +done +done +IFS=$as_save_IFS + +fi +fi +ac_ct_CC=$ac_cv_prog_ac_ct_CC +if test -n "$ac_ct_CC"; then + { echo "$as_me:$LINENO: result: $ac_ct_CC" >&5 +echo "${ECHO_T}$ac_ct_CC" >&6; } +else + { echo "$as_me:$LINENO: result: no" >&5 +echo "${ECHO_T}no" >&6; } +fi + + if test "x$ac_ct_CC" = x; then + CC="" + else + case $cross_compiling:$ac_tool_warned in +yes:) +{ echo "$as_me:$LINENO: WARNING: In the future, Autoconf will not detect cross-tools +whose name does not start with the host triplet. If you think this +configuration is useful to you, please write to autoconf@gnu.org." >&5 +echo "$as_me: WARNING: In the future, Autoconf will not detect cross-tools +whose name does not start with the host triplet. If you think this +configuration is useful to you, please write to autoconf@gnu.org." >&2;} +ac_tool_warned=yes ;; +esac + CC=$ac_ct_CC + fi +else + CC="$ac_cv_prog_CC" +fi + +if test -z "$CC"; then + if test -n "$ac_tool_prefix"; then + # Extract the first word of "${ac_tool_prefix}cc", so it can be a program name with args. +set dummy ${ac_tool_prefix}cc; ac_word=$2 +{ echo "$as_me:$LINENO: checking for $ac_word" >&5 +echo $ECHO_N "checking for $ac_word... $ECHO_C" >&6; } +if test "${ac_cv_prog_CC+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + if test -n "$CC"; then + ac_cv_prog_CC="$CC" # Let the user override the test. +else +as_save_IFS=$IFS; IFS=$PATH_SEPARATOR +for as_dir in $PATH +do + IFS=$as_save_IFS + test -z "$as_dir" && as_dir=. + for ac_exec_ext in '' $ac_executable_extensions; do + if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then + ac_cv_prog_CC="${ac_tool_prefix}cc" + echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5 + break 2 + fi +done +done +IFS=$as_save_IFS + +fi +fi +CC=$ac_cv_prog_CC +if test -n "$CC"; then + { echo "$as_me:$LINENO: result: $CC" >&5 +echo "${ECHO_T}$CC" >&6; } +else + { echo "$as_me:$LINENO: result: no" >&5 +echo "${ECHO_T}no" >&6; } +fi + + + fi +fi +if test -z "$CC"; then + # Extract the first word of "cc", so it can be a program name with args. +set dummy cc; ac_word=$2 +{ echo "$as_me:$LINENO: checking for $ac_word" >&5 +echo $ECHO_N "checking for $ac_word... $ECHO_C" >&6; } +if test "${ac_cv_prog_CC+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + if test -n "$CC"; then + ac_cv_prog_CC="$CC" # Let the user override the test. +else + ac_prog_rejected=no +as_save_IFS=$IFS; IFS=$PATH_SEPARATOR +for as_dir in $PATH +do + IFS=$as_save_IFS + test -z "$as_dir" && as_dir=. + for ac_exec_ext in '' $ac_executable_extensions; do + if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then + if test "$as_dir/$ac_word$ac_exec_ext" = "/usr/ucb/cc"; then + ac_prog_rejected=yes + continue + fi + ac_cv_prog_CC="cc" + echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5 + break 2 + fi +done +done +IFS=$as_save_IFS + +if test $ac_prog_rejected = yes; then + # We found a bogon in the path, so make sure we never use it. + set dummy $ac_cv_prog_CC + shift + if test $# != 0; then + # We chose a different compiler from the bogus one. + # However, it has the same basename, so the bogon will be chosen + # first if we set CC to just the basename; use the full file name. + shift + ac_cv_prog_CC="$as_dir/$ac_word${1+' '}$@" + fi +fi +fi +fi +CC=$ac_cv_prog_CC +if test -n "$CC"; then + { echo "$as_me:$LINENO: result: $CC" >&5 +echo "${ECHO_T}$CC" >&6; } +else + { echo "$as_me:$LINENO: result: no" >&5 +echo "${ECHO_T}no" >&6; } +fi + + +fi +if test -z "$CC"; then + if test -n "$ac_tool_prefix"; then + for ac_prog in cl.exe + do + # Extract the first word of "$ac_tool_prefix$ac_prog", so it can be a program name with args. +set dummy $ac_tool_prefix$ac_prog; ac_word=$2 +{ echo "$as_me:$LINENO: checking for $ac_word" >&5 +echo $ECHO_N "checking for $ac_word... $ECHO_C" >&6; } +if test "${ac_cv_prog_CC+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + if test -n "$CC"; then + ac_cv_prog_CC="$CC" # Let the user override the test. +else +as_save_IFS=$IFS; IFS=$PATH_SEPARATOR +for as_dir in $PATH +do + IFS=$as_save_IFS + test -z "$as_dir" && as_dir=. + for ac_exec_ext in '' $ac_executable_extensions; do + if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then + ac_cv_prog_CC="$ac_tool_prefix$ac_prog" + echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5 + break 2 + fi +done +done +IFS=$as_save_IFS + +fi +fi +CC=$ac_cv_prog_CC +if test -n "$CC"; then + { echo "$as_me:$LINENO: result: $CC" >&5 +echo "${ECHO_T}$CC" >&6; } +else + { echo "$as_me:$LINENO: result: no" >&5 +echo "${ECHO_T}no" >&6; } +fi + + + test -n "$CC" && break + done +fi +if test -z "$CC"; then + ac_ct_CC=$CC + for ac_prog in cl.exe +do + # Extract the first word of "$ac_prog", so it can be a program name with args. +set dummy $ac_prog; ac_word=$2 +{ echo "$as_me:$LINENO: checking for $ac_word" >&5 +echo $ECHO_N "checking for $ac_word... $ECHO_C" >&6; } +if test "${ac_cv_prog_ac_ct_CC+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + if test -n "$ac_ct_CC"; then + ac_cv_prog_ac_ct_CC="$ac_ct_CC" # Let the user override the test. +else +as_save_IFS=$IFS; IFS=$PATH_SEPARATOR +for as_dir in $PATH +do + IFS=$as_save_IFS + test -z "$as_dir" && as_dir=. + for ac_exec_ext in '' $ac_executable_extensions; do + if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then + ac_cv_prog_ac_ct_CC="$ac_prog" + echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5 + break 2 + fi +done +done +IFS=$as_save_IFS + +fi +fi +ac_ct_CC=$ac_cv_prog_ac_ct_CC +if test -n "$ac_ct_CC"; then + { echo "$as_me:$LINENO: result: $ac_ct_CC" >&5 +echo "${ECHO_T}$ac_ct_CC" >&6; } +else + { echo "$as_me:$LINENO: result: no" >&5 +echo "${ECHO_T}no" >&6; } +fi + + + test -n "$ac_ct_CC" && break +done + + if test "x$ac_ct_CC" = x; then + CC="" + else + case $cross_compiling:$ac_tool_warned in +yes:) +{ echo "$as_me:$LINENO: WARNING: In the future, Autoconf will not detect cross-tools +whose name does not start with the host triplet. If you think this +configuration is useful to you, please write to autoconf@gnu.org." >&5 +echo "$as_me: WARNING: In the future, Autoconf will not detect cross-tools +whose name does not start with the host triplet. If you think this +configuration is useful to you, please write to autoconf@gnu.org." >&2;} +ac_tool_warned=yes ;; +esac + CC=$ac_ct_CC + fi +fi + +fi + + +test -z "$CC" && { { echo "$as_me:$LINENO: error: no acceptable C compiler found in \$PATH +See \`config.log' for more details." >&5 +echo "$as_me: error: no acceptable C compiler found in \$PATH +See \`config.log' for more details." >&2;} + { (exit 1); exit 1; }; } + +# Provide some information about the compiler. +echo "$as_me:$LINENO: checking for C compiler version" >&5 +ac_compiler=`set X $ac_compile; echo $2` +{ (ac_try="$ac_compiler --version >&5" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_compiler --version >&5") 2>&5 + ac_status=$? + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } +{ (ac_try="$ac_compiler -v >&5" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_compiler -v >&5") 2>&5 + ac_status=$? + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } +{ (ac_try="$ac_compiler -V >&5" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_compiler -V >&5") 2>&5 + ac_status=$? + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } + +cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ + +int +main () +{ + + ; + return 0; +} +_ACEOF +ac_clean_files_save=$ac_clean_files +ac_clean_files="$ac_clean_files a.out a.exe b.out" +# Try to create an executable without -o first, disregard a.out. +# It will help us diagnose broken compilers, and finding out an intuition +# of exeext. +{ echo "$as_me:$LINENO: checking for C compiler default output file name" >&5 +echo $ECHO_N "checking for C compiler default output file name... $ECHO_C" >&6; } +ac_link_default=`echo "$ac_link" | sed 's/ -o *conftest[^ ]*//'` +# +# List of possible output files, starting from the most likely. +# The algorithm is not robust to junk in `.', hence go to wildcards (a.*) +# only as a last resort. b.out is created by i960 compilers. +ac_files='a_out.exe a.exe conftest.exe a.out conftest a.* conftest.* b.out' +# +# The IRIX 6 linker writes into existing files which may not be +# executable, retaining their permissions. Remove them first so a +# subsequent execution test works. +ac_rmfiles= +for ac_file in $ac_files +do + case $ac_file in + *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.o | *.obj ) ;; + * ) ac_rmfiles="$ac_rmfiles $ac_file";; + esac +done +rm -f $ac_rmfiles + +if { (ac_try="$ac_link_default" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_link_default") 2>&5 + ac_status=$? + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); }; then + # Autoconf-2.13 could set the ac_cv_exeext variable to `no'. +# So ignore a value of `no', otherwise this would lead to `EXEEXT = no' +# in a Makefile. We should not override ac_cv_exeext if it was cached, +# so that the user can short-circuit this test for compilers unknown to +# Autoconf. +for ac_file in $ac_files '' +do + test -f "$ac_file" || continue + case $ac_file in + *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.o | *.obj ) + ;; + [ab].out ) + # We found the default executable, but exeext='' is most + # certainly right. + break;; + *.* ) + if test "${ac_cv_exeext+set}" = set && test "$ac_cv_exeext" != no; + then :; else + ac_cv_exeext=`expr "$ac_file" : '[^.]*\(\..*\)'` + fi + # We set ac_cv_exeext here because the later test for it is not + # safe: cross compilers may not add the suffix if given an `-o' + # argument, so we may need to know it at that point already. + # Even if this section looks crufty: it has the advantage of + # actually working. + break;; + * ) + break;; + esac +done +test "$ac_cv_exeext" = no && ac_cv_exeext= + +else + ac_file='' +fi + +{ echo "$as_me:$LINENO: result: $ac_file" >&5 +echo "${ECHO_T}$ac_file" >&6; } +if test -z "$ac_file"; then + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + +{ { echo "$as_me:$LINENO: error: C compiler cannot create executables +See \`config.log' for more details." >&5 +echo "$as_me: error: C compiler cannot create executables +See \`config.log' for more details." >&2;} + { (exit 77); exit 77; }; } +fi + +ac_exeext=$ac_cv_exeext + +# Check that the compiler produces executables we can run. If not, either +# the compiler is broken, or we cross compile. +{ echo "$as_me:$LINENO: checking whether the C compiler works" >&5 +echo $ECHO_N "checking whether the C compiler works... $ECHO_C" >&6; } +# FIXME: These cross compiler hacks should be removed for Autoconf 3.0 +# If not cross compiling, check that we can run a simple program. +if test "$cross_compiling" != yes; then + if { ac_try='./$ac_file' + { (case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_try") 2>&5 + ac_status=$? + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); }; }; then + cross_compiling=no + else + if test "$cross_compiling" = maybe; then + cross_compiling=yes + else + { { echo "$as_me:$LINENO: error: cannot run C compiled programs. +If you meant to cross compile, use \`--host'. +See \`config.log' for more details." >&5 +echo "$as_me: error: cannot run C compiled programs. +If you meant to cross compile, use \`--host'. +See \`config.log' for more details." >&2;} + { (exit 1); exit 1; }; } + fi + fi +fi +{ echo "$as_me:$LINENO: result: yes" >&5 +echo "${ECHO_T}yes" >&6; } + +rm -f a.out a.exe conftest$ac_cv_exeext b.out +ac_clean_files=$ac_clean_files_save +# Check that the compiler produces executables we can run. If not, either +# the compiler is broken, or we cross compile. +{ echo "$as_me:$LINENO: checking whether we are cross compiling" >&5 +echo $ECHO_N "checking whether we are cross compiling... $ECHO_C" >&6; } +{ echo "$as_me:$LINENO: result: $cross_compiling" >&5 +echo "${ECHO_T}$cross_compiling" >&6; } + +{ echo "$as_me:$LINENO: checking for suffix of executables" >&5 +echo $ECHO_N "checking for suffix of executables... $ECHO_C" >&6; } +if { (ac_try="$ac_link" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_link") 2>&5 + ac_status=$? + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); }; then + # If both `conftest.exe' and `conftest' are `present' (well, observable) +# catch `conftest.exe'. For instance with Cygwin, `ls conftest' will +# work properly (i.e., refer to `conftest.exe'), while it won't with +# `rm'. +for ac_file in conftest.exe conftest conftest.*; do + test -f "$ac_file" || continue + case $ac_file in + *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.o | *.obj ) ;; + *.* ) ac_cv_exeext=`expr "$ac_file" : '[^.]*\(\..*\)'` + break;; + * ) break;; + esac +done +else + { { echo "$as_me:$LINENO: error: cannot compute suffix of executables: cannot compile and link +See \`config.log' for more details." >&5 +echo "$as_me: error: cannot compute suffix of executables: cannot compile and link +See \`config.log' for more details." >&2;} + { (exit 1); exit 1; }; } +fi + +rm -f conftest$ac_cv_exeext +{ echo "$as_me:$LINENO: result: $ac_cv_exeext" >&5 +echo "${ECHO_T}$ac_cv_exeext" >&6; } + +rm -f conftest.$ac_ext +EXEEXT=$ac_cv_exeext +ac_exeext=$EXEEXT +{ echo "$as_me:$LINENO: checking for suffix of object files" >&5 +echo $ECHO_N "checking for suffix of object files... $ECHO_C" >&6; } +if test "${ac_cv_objext+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ + +int +main () +{ + + ; + return 0; +} +_ACEOF +rm -f conftest.o conftest.obj +if { (ac_try="$ac_compile" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_compile") 2>&5 + ac_status=$? + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); }; then + for ac_file in conftest.o conftest.obj conftest.*; do + test -f "$ac_file" || continue; + case $ac_file in + *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf ) ;; + *) ac_cv_objext=`expr "$ac_file" : '.*\.\(.*\)'` + break;; + esac +done +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + +{ { echo "$as_me:$LINENO: error: cannot compute suffix of object files: cannot compile +See \`config.log' for more details." >&5 +echo "$as_me: error: cannot compute suffix of object files: cannot compile +See \`config.log' for more details." >&2;} + { (exit 1); exit 1; }; } +fi + +rm -f conftest.$ac_cv_objext conftest.$ac_ext +fi +{ echo "$as_me:$LINENO: result: $ac_cv_objext" >&5 +echo "${ECHO_T}$ac_cv_objext" >&6; } +OBJEXT=$ac_cv_objext +ac_objext=$OBJEXT +{ echo "$as_me:$LINENO: checking whether we are using the GNU C compiler" >&5 +echo $ECHO_N "checking whether we are using the GNU C compiler... $ECHO_C" >&6; } +if test "${ac_cv_c_compiler_gnu+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ + +int +main () +{ +#ifndef __GNUC__ + choke me +#endif + + ; + return 0; +} +_ACEOF +rm -f conftest.$ac_objext +if { (ac_try="$ac_compile" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_compile") 2>conftest.er1 + ac_status=$? + grep -v '^ *+' conftest.er1 >conftest.err + rm -f conftest.er1 + cat conftest.err >&5 + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } && { + test -z "$ac_c_werror_flag" || + test ! -s conftest.err + } && test -s conftest.$ac_objext; then + ac_compiler_gnu=yes +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + + ac_compiler_gnu=no +fi + +rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext +ac_cv_c_compiler_gnu=$ac_compiler_gnu + +fi +{ echo "$as_me:$LINENO: result: $ac_cv_c_compiler_gnu" >&5 +echo "${ECHO_T}$ac_cv_c_compiler_gnu" >&6; } +GCC=`test $ac_compiler_gnu = yes && echo yes` +ac_test_CFLAGS=${CFLAGS+set} +ac_save_CFLAGS=$CFLAGS +{ echo "$as_me:$LINENO: checking whether $CC accepts -g" >&5 +echo $ECHO_N "checking whether $CC accepts -g... $ECHO_C" >&6; } +if test "${ac_cv_prog_cc_g+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + ac_save_c_werror_flag=$ac_c_werror_flag + ac_c_werror_flag=yes + ac_cv_prog_cc_g=no + CFLAGS="-g" + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ + +int +main () +{ + + ; + return 0; +} +_ACEOF +rm -f conftest.$ac_objext +if { (ac_try="$ac_compile" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_compile") 2>conftest.er1 + ac_status=$? + grep -v '^ *+' conftest.er1 >conftest.err + rm -f conftest.er1 + cat conftest.err >&5 + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } && { + test -z "$ac_c_werror_flag" || + test ! -s conftest.err + } && test -s conftest.$ac_objext; then + ac_cv_prog_cc_g=yes +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + + CFLAGS="" + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ + +int +main () +{ + + ; + return 0; +} +_ACEOF +rm -f conftest.$ac_objext +if { (ac_try="$ac_compile" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_compile") 2>conftest.er1 + ac_status=$? + grep -v '^ *+' conftest.er1 >conftest.err + rm -f conftest.er1 + cat conftest.err >&5 + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } && { + test -z "$ac_c_werror_flag" || + test ! -s conftest.err + } && test -s conftest.$ac_objext; then + : +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + + ac_c_werror_flag=$ac_save_c_werror_flag + CFLAGS="-g" + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ + +int +main () +{ + + ; + return 0; +} +_ACEOF +rm -f conftest.$ac_objext +if { (ac_try="$ac_compile" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_compile") 2>conftest.er1 + ac_status=$? + grep -v '^ *+' conftest.er1 >conftest.err + rm -f conftest.er1 + cat conftest.err >&5 + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } && { + test -z "$ac_c_werror_flag" || + test ! -s conftest.err + } && test -s conftest.$ac_objext; then + ac_cv_prog_cc_g=yes +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + + +fi + +rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext +fi + +rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext +fi + +rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext + ac_c_werror_flag=$ac_save_c_werror_flag +fi +{ echo "$as_me:$LINENO: result: $ac_cv_prog_cc_g" >&5 +echo "${ECHO_T}$ac_cv_prog_cc_g" >&6; } +if test "$ac_test_CFLAGS" = set; then + CFLAGS=$ac_save_CFLAGS +elif test $ac_cv_prog_cc_g = yes; then + if test "$GCC" = yes; then + CFLAGS="-g -O2" + else + CFLAGS="-g" + fi +else + if test "$GCC" = yes; then + CFLAGS="-O2" + else + CFLAGS= + fi +fi +{ echo "$as_me:$LINENO: checking for $CC option to accept ISO C89" >&5 +echo $ECHO_N "checking for $CC option to accept ISO C89... $ECHO_C" >&6; } +if test "${ac_cv_prog_cc_c89+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + ac_cv_prog_cc_c89=no +ac_save_CC=$CC +cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ +#include +#include +#include +#include +/* Most of the following tests are stolen from RCS 5.7's src/conf.sh. */ +struct buf { int x; }; +FILE * (*rcsopen) (struct buf *, struct stat *, int); +static char *e (p, i) + char **p; + int i; +{ + return p[i]; +} +static char *f (char * (*g) (char **, int), char **p, ...) +{ + char *s; + va_list v; + va_start (v,p); + s = g (p, va_arg (v,int)); + va_end (v); + return s; +} + +/* OSF 4.0 Compaq cc is some sort of almost-ANSI by default. It has + function prototypes and stuff, but not '\xHH' hex character constants. + These don't provoke an error unfortunately, instead are silently treated + as 'x'. The following induces an error, until -std is added to get + proper ANSI mode. Curiously '\x00'!='x' always comes out true, for an + array size at least. It's necessary to write '\x00'==0 to get something + that's true only with -std. */ +int osf4_cc_array ['\x00' == 0 ? 1 : -1]; + +/* IBM C 6 for AIX is almost-ANSI by default, but it replaces macro parameters + inside strings and character constants. */ +#define FOO(x) 'x' +int xlc6_cc_array[FOO(a) == 'x' ? 1 : -1]; + +int test (int i, double x); +struct s1 {int (*f) (int a);}; +struct s2 {int (*f) (double a);}; +int pairnames (int, char **, FILE *(*)(struct buf *, struct stat *, int), int, int); +int argc; +char **argv; +int +main () +{ +return f (e, argv, 0) != argv[0] || f (e, argv, 1) != argv[1]; + ; + return 0; +} +_ACEOF +for ac_arg in '' -qlanglvl=extc89 -qlanglvl=ansi -std \ + -Ae "-Aa -D_HPUX_SOURCE" "-Xc -D__EXTENSIONS__" +do + CC="$ac_save_CC $ac_arg" + rm -f conftest.$ac_objext +if { (ac_try="$ac_compile" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_compile") 2>conftest.er1 + ac_status=$? + grep -v '^ *+' conftest.er1 >conftest.err + rm -f conftest.er1 + cat conftest.err >&5 + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } && { + test -z "$ac_c_werror_flag" || + test ! -s conftest.err + } && test -s conftest.$ac_objext; then + ac_cv_prog_cc_c89=$ac_arg +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + + +fi + +rm -f core conftest.err conftest.$ac_objext + test "x$ac_cv_prog_cc_c89" != "xno" && break +done +rm -f conftest.$ac_ext +CC=$ac_save_CC + +fi +# AC_CACHE_VAL +case "x$ac_cv_prog_cc_c89" in + x) + { echo "$as_me:$LINENO: result: none needed" >&5 +echo "${ECHO_T}none needed" >&6; } ;; + xno) + { echo "$as_me:$LINENO: result: unsupported" >&5 +echo "${ECHO_T}unsupported" >&6; } ;; + *) + CC="$CC $ac_cv_prog_cc_c89" + { echo "$as_me:$LINENO: result: $ac_cv_prog_cc_c89" >&5 +echo "${ECHO_T}$ac_cv_prog_cc_c89" >&6; } ;; +esac + + +ac_ext=c +ac_cpp='$CPP $CPPFLAGS' +ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5' +ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5' +ac_compiler_gnu=$ac_cv_c_compiler_gnu + +depcc="$CC" am_compiler_list= + +{ echo "$as_me:$LINENO: checking dependency style of $depcc" >&5 +echo $ECHO_N "checking dependency style of $depcc... $ECHO_C" >&6; } +if test "${am_cv_CC_dependencies_compiler_type+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + if test -z "$AMDEP_TRUE" && test -f "$am_depcomp"; then + # We make a subdir and do the tests there. Otherwise we can end up + # making bogus files that we don't know about and never remove. For + # instance it was reported that on HP-UX the gcc test will end up + # making a dummy file named `D' -- because `-MD' means `put the output + # in D'. + mkdir conftest.dir + # Copy depcomp to subdir because otherwise we won't find it if we're + # using a relative directory. + cp "$am_depcomp" conftest.dir + cd conftest.dir + # We will build objects and dependencies in a subdirectory because + # it helps to detect inapplicable dependency modes. For instance + # both Tru64's cc and ICC support -MD to output dependencies as a + # side effect of compilation, but ICC will put the dependencies in + # the current directory while Tru64 will put them in the object + # directory. + mkdir sub + + am_cv_CC_dependencies_compiler_type=none + if test "$am_compiler_list" = ""; then + am_compiler_list=`sed -n 's/^#*\([a-zA-Z0-9]*\))$/\1/p' < ./depcomp` + fi + for depmode in $am_compiler_list; do + # Setup a source with many dependencies, because some compilers + # like to wrap large dependency lists on column 80 (with \), and + # we should not choose a depcomp mode which is confused by this. + # + # We need to recreate these files for each test, as the compiler may + # overwrite some of them when testing with obscure command lines. + # This happens at least with the AIX C compiler. + : > sub/conftest.c + for i in 1 2 3 4 5 6; do + echo '#include "conftst'$i'.h"' >> sub/conftest.c + # Using `: > sub/conftst$i.h' creates only sub/conftst1.h with + # Solaris 8's {/usr,}/bin/sh. + touch sub/conftst$i.h + done + echo "${am__include} ${am__quote}sub/conftest.Po${am__quote}" > confmf + + case $depmode in + nosideeffect) + # after this tag, mechanisms are not by side-effect, so they'll + # only be used when explicitly requested + if test "x$enable_dependency_tracking" = xyes; then + continue + else + break + fi + ;; + none) break ;; + esac + # We check with `-c' and `-o' for the sake of the "dashmstdout" + # mode. It turns out that the SunPro C++ compiler does not properly + # handle `-M -o', and we need to detect this. + if depmode=$depmode \ + source=sub/conftest.c object=sub/conftest.${OBJEXT-o} \ + depfile=sub/conftest.Po tmpdepfile=sub/conftest.TPo \ + $SHELL ./depcomp $depcc -c -o sub/conftest.${OBJEXT-o} sub/conftest.c \ + >/dev/null 2>conftest.err && + grep sub/conftst1.h sub/conftest.Po > /dev/null 2>&1 && + grep sub/conftst6.h sub/conftest.Po > /dev/null 2>&1 && + grep sub/conftest.${OBJEXT-o} sub/conftest.Po > /dev/null 2>&1 && + ${MAKE-make} -s -f confmf > /dev/null 2>&1; then + # icc doesn't choke on unknown options, it will just issue warnings + # or remarks (even with -Werror). So we grep stderr for any message + # that says an option was ignored or not supported. + # When given -MP, icc 7.0 and 7.1 complain thusly: + # icc: Command line warning: ignoring option '-M'; no argument required + # The diagnosis changed in icc 8.0: + # icc: Command line remark: option '-MP' not supported + if (grep 'ignoring option' conftest.err || + grep 'not supported' conftest.err) >/dev/null 2>&1; then :; else + am_cv_CC_dependencies_compiler_type=$depmode + break + fi + fi + done + + cd .. + rm -rf conftest.dir +else + am_cv_CC_dependencies_compiler_type=none +fi + +fi +{ echo "$as_me:$LINENO: result: $am_cv_CC_dependencies_compiler_type" >&5 +echo "${ECHO_T}$am_cv_CC_dependencies_compiler_type" >&6; } +CCDEPMODE=depmode=$am_cv_CC_dependencies_compiler_type + + if + test "x$enable_dependency_tracking" != xno \ + && test "$am_cv_CC_dependencies_compiler_type" = gcc3; then + am__fastdepCC_TRUE= + am__fastdepCC_FALSE='#' +else + am__fastdepCC_TRUE='#' + am__fastdepCC_FALSE= +fi + + + ac_ext=c +ac_cpp='$CPP $CPPFLAGS' +ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5' +ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5' +ac_compiler_gnu=$ac_cv_c_compiler_gnu +{ echo "$as_me:$LINENO: checking how to run the C preprocessor" >&5 +echo $ECHO_N "checking how to run the C preprocessor... $ECHO_C" >&6; } +# On Suns, sometimes $CPP names a directory. +if test -n "$CPP" && test -d "$CPP"; then + CPP= +fi +if test -z "$CPP"; then + if test "${ac_cv_prog_CPP+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + # Double quotes because CPP needs to be expanded + for CPP in "$CC -E" "$CC -E -traditional-cpp" "/lib/cpp" + do + ac_preproc_ok=false +for ac_c_preproc_warn_flag in '' yes +do + # Use a header file that comes with gcc, so configuring glibc + # with a fresh cross-compiler works. + # Prefer to if __STDC__ is defined, since + # exists even on freestanding compilers. + # On the NeXT, cc -E runs the code through the compiler's parser, + # not just through cpp. "Syntax error" is here to catch this case. + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ +#ifdef __STDC__ +# include +#else +# include +#endif + Syntax error +_ACEOF +if { (ac_try="$ac_cpp conftest.$ac_ext" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_cpp conftest.$ac_ext") 2>conftest.er1 + ac_status=$? + grep -v '^ *+' conftest.er1 >conftest.err + rm -f conftest.er1 + cat conftest.err >&5 + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } >/dev/null && { + test -z "$ac_c_preproc_warn_flag$ac_c_werror_flag" || + test ! -s conftest.err + }; then + : +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + + # Broken: fails on valid input. +continue +fi + +rm -f conftest.err conftest.$ac_ext + + # OK, works on sane cases. Now check whether nonexistent headers + # can be detected and how. + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ +#include +_ACEOF +if { (ac_try="$ac_cpp conftest.$ac_ext" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_cpp conftest.$ac_ext") 2>conftest.er1 + ac_status=$? + grep -v '^ *+' conftest.er1 >conftest.err + rm -f conftest.er1 + cat conftest.err >&5 + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } >/dev/null && { + test -z "$ac_c_preproc_warn_flag$ac_c_werror_flag" || + test ! -s conftest.err + }; then + # Broken: success on invalid input. +continue +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + + # Passes both tests. +ac_preproc_ok=: +break +fi + +rm -f conftest.err conftest.$ac_ext + +done +# Because of `break', _AC_PREPROC_IFELSE's cleaning code was skipped. +rm -f conftest.err conftest.$ac_ext +if $ac_preproc_ok; then + break +fi + + done + ac_cv_prog_CPP=$CPP + +fi + CPP=$ac_cv_prog_CPP +else + ac_cv_prog_CPP=$CPP +fi +{ echo "$as_me:$LINENO: result: $CPP" >&5 +echo "${ECHO_T}$CPP" >&6; } +ac_preproc_ok=false +for ac_c_preproc_warn_flag in '' yes +do + # Use a header file that comes with gcc, so configuring glibc + # with a fresh cross-compiler works. + # Prefer to if __STDC__ is defined, since + # exists even on freestanding compilers. + # On the NeXT, cc -E runs the code through the compiler's parser, + # not just through cpp. "Syntax error" is here to catch this case. + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ +#ifdef __STDC__ +# include +#else +# include +#endif + Syntax error +_ACEOF +if { (ac_try="$ac_cpp conftest.$ac_ext" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_cpp conftest.$ac_ext") 2>conftest.er1 + ac_status=$? + grep -v '^ *+' conftest.er1 >conftest.err + rm -f conftest.er1 + cat conftest.err >&5 + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } >/dev/null && { + test -z "$ac_c_preproc_warn_flag$ac_c_werror_flag" || + test ! -s conftest.err + }; then + : +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + + # Broken: fails on valid input. +continue +fi + +rm -f conftest.err conftest.$ac_ext + + # OK, works on sane cases. Now check whether nonexistent headers + # can be detected and how. + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ +#include +_ACEOF +if { (ac_try="$ac_cpp conftest.$ac_ext" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_cpp conftest.$ac_ext") 2>conftest.er1 + ac_status=$? + grep -v '^ *+' conftest.er1 >conftest.err + rm -f conftest.er1 + cat conftest.err >&5 + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } >/dev/null && { + test -z "$ac_c_preproc_warn_flag$ac_c_werror_flag" || + test ! -s conftest.err + }; then + # Broken: success on invalid input. +continue +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + + # Passes both tests. +ac_preproc_ok=: +break +fi + +rm -f conftest.err conftest.$ac_ext + +done +# Because of `break', _AC_PREPROC_IFELSE's cleaning code was skipped. +rm -f conftest.err conftest.$ac_ext +if $ac_preproc_ok; then + : +else + { { echo "$as_me:$LINENO: error: C preprocessor \"$CPP\" fails sanity check +See \`config.log' for more details." >&5 +echo "$as_me: error: C preprocessor \"$CPP\" fails sanity check +See \`config.log' for more details." >&2;} + { (exit 1); exit 1; }; } +fi + +ac_ext=c +ac_cpp='$CPP $CPPFLAGS' +ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5' +ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5' +ac_compiler_gnu=$ac_cv_c_compiler_gnu + + +{ echo "$as_me:$LINENO: checking for AIX" >&5 +echo $ECHO_N "checking for AIX... $ECHO_C" >&6; } +cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ +#ifdef _AIX + yes +#endif + +_ACEOF +if (eval "$ac_cpp conftest.$ac_ext") 2>&5 | + $EGREP "yes" >/dev/null 2>&1; then + { echo "$as_me:$LINENO: result: yes" >&5 +echo "${ECHO_T}yes" >&6; } +cat >>confdefs.h <<\_ACEOF +#define _ALL_SOURCE 1 +_ACEOF + +else + { echo "$as_me:$LINENO: result: no" >&5 +echo "${ECHO_T}no" >&6; } +fi +rm -f conftest* + + + { echo "$as_me:$LINENO: checking for library containing strerror" >&5 +echo $ECHO_N "checking for library containing strerror... $ECHO_C" >&6; } +if test "${ac_cv_search_strerror+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + ac_func_search_save_LIBS=$LIBS +cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ + +/* Override any GCC internal prototype to avoid an error. + Use char because int might match the return type of a GCC + builtin and then its argument prototype would still apply. */ +#ifdef __cplusplus +extern "C" +#endif +char strerror (); +int +main () +{ +return strerror (); + ; + return 0; +} +_ACEOF +for ac_lib in '' cposix; do + if test -z "$ac_lib"; then + ac_res="none required" + else + ac_res=-l$ac_lib + LIBS="-l$ac_lib $ac_func_search_save_LIBS" + fi + rm -f conftest.$ac_objext conftest$ac_exeext +if { (ac_try="$ac_link" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_link") 2>conftest.er1 + ac_status=$? + grep -v '^ *+' conftest.er1 >conftest.err + rm -f conftest.er1 + cat conftest.err >&5 + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } && { + test -z "$ac_c_werror_flag" || + test ! -s conftest.err + } && test -s conftest$ac_exeext && + $as_test_x conftest$ac_exeext; then + ac_cv_search_strerror=$ac_res +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + + +fi + +rm -f core conftest.err conftest.$ac_objext conftest_ipa8_conftest.oo \ + conftest$ac_exeext + if test "${ac_cv_search_strerror+set}" = set; then + break +fi +done +if test "${ac_cv_search_strerror+set}" = set; then + : +else + ac_cv_search_strerror=no +fi +rm conftest.$ac_ext +LIBS=$ac_func_search_save_LIBS +fi +{ echo "$as_me:$LINENO: result: $ac_cv_search_strerror" >&5 +echo "${ECHO_T}$ac_cv_search_strerror" >&6; } +ac_res=$ac_cv_search_strerror +if test "$ac_res" != no; then + test "$ac_res" = "none required" || LIBS="$ac_res $LIBS" + +fi + + if test "${ac_cv_header_minix_config_h+set}" = set; then + { echo "$as_me:$LINENO: checking for minix/config.h" >&5 +echo $ECHO_N "checking for minix/config.h... $ECHO_C" >&6; } +if test "${ac_cv_header_minix_config_h+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +fi +{ echo "$as_me:$LINENO: result: $ac_cv_header_minix_config_h" >&5 +echo "${ECHO_T}$ac_cv_header_minix_config_h" >&6; } +else + # Is the header compilable? +{ echo "$as_me:$LINENO: checking minix/config.h usability" >&5 +echo $ECHO_N "checking minix/config.h usability... $ECHO_C" >&6; } +cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ +$ac_includes_default +#include +_ACEOF +rm -f conftest.$ac_objext +if { (ac_try="$ac_compile" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_compile") 2>conftest.er1 + ac_status=$? + grep -v '^ *+' conftest.er1 >conftest.err + rm -f conftest.er1 + cat conftest.err >&5 + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } && { + test -z "$ac_c_werror_flag" || + test ! -s conftest.err + } && test -s conftest.$ac_objext; then + ac_header_compiler=yes +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + + ac_header_compiler=no +fi + +rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext +{ echo "$as_me:$LINENO: result: $ac_header_compiler" >&5 +echo "${ECHO_T}$ac_header_compiler" >&6; } + +# Is the header present? +{ echo "$as_me:$LINENO: checking minix/config.h presence" >&5 +echo $ECHO_N "checking minix/config.h presence... $ECHO_C" >&6; } +cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ +#include +_ACEOF +if { (ac_try="$ac_cpp conftest.$ac_ext" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_cpp conftest.$ac_ext") 2>conftest.er1 + ac_status=$? + grep -v '^ *+' conftest.er1 >conftest.err + rm -f conftest.er1 + cat conftest.err >&5 + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } >/dev/null && { + test -z "$ac_c_preproc_warn_flag$ac_c_werror_flag" || + test ! -s conftest.err + }; then + ac_header_preproc=yes +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + + ac_header_preproc=no +fi + +rm -f conftest.err conftest.$ac_ext +{ echo "$as_me:$LINENO: result: $ac_header_preproc" >&5 +echo "${ECHO_T}$ac_header_preproc" >&6; } + +# So? What about this header? +case $ac_header_compiler:$ac_header_preproc:$ac_c_preproc_warn_flag in + yes:no: ) + { echo "$as_me:$LINENO: WARNING: minix/config.h: accepted by the compiler, rejected by the preprocessor!" >&5 +echo "$as_me: WARNING: minix/config.h: accepted by the compiler, rejected by the preprocessor!" >&2;} + { echo "$as_me:$LINENO: WARNING: minix/config.h: proceeding with the compiler's result" >&5 +echo "$as_me: WARNING: minix/config.h: proceeding with the compiler's result" >&2;} + ac_header_preproc=yes + ;; + no:yes:* ) + { echo "$as_me:$LINENO: WARNING: minix/config.h: present but cannot be compiled" >&5 +echo "$as_me: WARNING: minix/config.h: present but cannot be compiled" >&2;} + { echo "$as_me:$LINENO: WARNING: minix/config.h: check for missing prerequisite headers?" >&5 +echo "$as_me: WARNING: minix/config.h: check for missing prerequisite headers?" >&2;} + { echo "$as_me:$LINENO: WARNING: minix/config.h: see the Autoconf documentation" >&5 +echo "$as_me: WARNING: minix/config.h: see the Autoconf documentation" >&2;} + { echo "$as_me:$LINENO: WARNING: minix/config.h: section \"Present But Cannot Be Compiled\"" >&5 +echo "$as_me: WARNING: minix/config.h: section \"Present But Cannot Be Compiled\"" >&2;} + { echo "$as_me:$LINENO: WARNING: minix/config.h: proceeding with the preprocessor's result" >&5 +echo "$as_me: WARNING: minix/config.h: proceeding with the preprocessor's result" >&2;} + { echo "$as_me:$LINENO: WARNING: minix/config.h: in the future, the compiler will take precedence" >&5 +echo "$as_me: WARNING: minix/config.h: in the future, the compiler will take precedence" >&2;} + ( cat <<\_ASBOX +## ------------------------------------------- ## +## Report this to Assaf Gordon gordon@cshl.edu ## +## ------------------------------------------- ## +_ASBOX + ) | sed "s/^/$as_me: WARNING: /" >&2 + ;; +esac +{ echo "$as_me:$LINENO: checking for minix/config.h" >&5 +echo $ECHO_N "checking for minix/config.h... $ECHO_C" >&6; } +if test "${ac_cv_header_minix_config_h+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + ac_cv_header_minix_config_h=$ac_header_preproc +fi +{ echo "$as_me:$LINENO: result: $ac_cv_header_minix_config_h" >&5 +echo "${ECHO_T}$ac_cv_header_minix_config_h" >&6; } + +fi +if test $ac_cv_header_minix_config_h = yes; then + MINIX=yes +else + MINIX= +fi + + +if test "$MINIX" = yes; then + +cat >>confdefs.h <<\_ACEOF +#define _POSIX_SOURCE 1 +_ACEOF + + +cat >>confdefs.h <<\_ACEOF +#define _POSIX_1_SOURCE 2 +_ACEOF + + +cat >>confdefs.h <<\_ACEOF +#define _MINIX 1 +_ACEOF + +fi + + { echo "$as_me:$LINENO: checking for ANSI C header files" >&5 +echo $ECHO_N "checking for ANSI C header files... $ECHO_C" >&6; } +if test "${ac_cv_header_stdc+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ +#include +#include +#include +#include + +int +main () +{ + + ; + return 0; +} +_ACEOF +rm -f conftest.$ac_objext +if { (ac_try="$ac_compile" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_compile") 2>conftest.er1 + ac_status=$? + grep -v '^ *+' conftest.er1 >conftest.err + rm -f conftest.er1 + cat conftest.err >&5 + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } && { + test -z "$ac_c_werror_flag" || + test ! -s conftest.err + } && test -s conftest.$ac_objext; then + ac_cv_header_stdc=yes +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + + ac_cv_header_stdc=no +fi + +rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext + +if test $ac_cv_header_stdc = yes; then + # SunOS 4.x string.h does not declare mem*, contrary to ANSI. + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ +#include + +_ACEOF +if (eval "$ac_cpp conftest.$ac_ext") 2>&5 | + $EGREP "memchr" >/dev/null 2>&1; then + : +else + ac_cv_header_stdc=no +fi +rm -f conftest* + +fi + +if test $ac_cv_header_stdc = yes; then + # ISC 2.0.2 stdlib.h does not declare free, contrary to ANSI. + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ +#include + +_ACEOF +if (eval "$ac_cpp conftest.$ac_ext") 2>&5 | + $EGREP "free" >/dev/null 2>&1; then + : +else + ac_cv_header_stdc=no +fi +rm -f conftest* + +fi + +if test $ac_cv_header_stdc = yes; then + # /bin/cc in Irix-4.0.5 gets non-ANSI ctype macros unless using -ansi. + if test "$cross_compiling" = yes; then + : +else + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ +#include +#include +#if ((' ' & 0x0FF) == 0x020) +# define ISLOWER(c) ('a' <= (c) && (c) <= 'z') +# define TOUPPER(c) (ISLOWER(c) ? 'A' + ((c) - 'a') : (c)) +#else +# define ISLOWER(c) \ + (('a' <= (c) && (c) <= 'i') \ + || ('j' <= (c) && (c) <= 'r') \ + || ('s' <= (c) && (c) <= 'z')) +# define TOUPPER(c) (ISLOWER(c) ? ((c) | 0x40) : (c)) +#endif + +#define XOR(e, f) (((e) && !(f)) || (!(e) && (f))) +int +main () +{ + int i; + for (i = 0; i < 256; i++) + if (XOR (islower (i), ISLOWER (i)) + || toupper (i) != TOUPPER (i)) + return 2; + return 0; +} +_ACEOF +rm -f conftest$ac_exeext +if { (ac_try="$ac_link" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_link") 2>&5 + ac_status=$? + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } && { ac_try='./conftest$ac_exeext' + { (case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_try") 2>&5 + ac_status=$? + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); }; }; then + : +else + echo "$as_me: program exited with status $ac_status" >&5 +echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + +( exit $ac_status ) +ac_cv_header_stdc=no +fi +rm -f core *.core core.conftest.* gmon.out bb.out conftest$ac_exeext conftest.$ac_objext conftest.$ac_ext +fi + + +fi +fi +{ echo "$as_me:$LINENO: result: $ac_cv_header_stdc" >&5 +echo "${ECHO_T}$ac_cv_header_stdc" >&6; } +if test $ac_cv_header_stdc = yes; then + +cat >>confdefs.h <<\_ACEOF +#define STDC_HEADERS 1 +_ACEOF + +fi + + + + + ac_ext=cpp +ac_cpp='$CXXCPP $CPPFLAGS' +ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5' +ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5' +ac_compiler_gnu=$ac_cv_cxx_compiler_gnu +if test -z "$CXX"; then + if test -n "$CCC"; then + CXX=$CCC + else + if test -n "$ac_tool_prefix"; then + for ac_prog in g++ c++ gpp aCC CC cxx cc++ cl.exe FCC KCC RCC xlC_r xlC + do + # Extract the first word of "$ac_tool_prefix$ac_prog", so it can be a program name with args. +set dummy $ac_tool_prefix$ac_prog; ac_word=$2 +{ echo "$as_me:$LINENO: checking for $ac_word" >&5 +echo $ECHO_N "checking for $ac_word... $ECHO_C" >&6; } +if test "${ac_cv_prog_CXX+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + if test -n "$CXX"; then + ac_cv_prog_CXX="$CXX" # Let the user override the test. +else +as_save_IFS=$IFS; IFS=$PATH_SEPARATOR +for as_dir in $PATH +do + IFS=$as_save_IFS + test -z "$as_dir" && as_dir=. + for ac_exec_ext in '' $ac_executable_extensions; do + if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then + ac_cv_prog_CXX="$ac_tool_prefix$ac_prog" + echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5 + break 2 + fi +done +done +IFS=$as_save_IFS + +fi +fi +CXX=$ac_cv_prog_CXX +if test -n "$CXX"; then + { echo "$as_me:$LINENO: result: $CXX" >&5 +echo "${ECHO_T}$CXX" >&6; } +else + { echo "$as_me:$LINENO: result: no" >&5 +echo "${ECHO_T}no" >&6; } +fi + + + test -n "$CXX" && break + done +fi +if test -z "$CXX"; then + ac_ct_CXX=$CXX + for ac_prog in g++ c++ gpp aCC CC cxx cc++ cl.exe FCC KCC RCC xlC_r xlC +do + # Extract the first word of "$ac_prog", so it can be a program name with args. +set dummy $ac_prog; ac_word=$2 +{ echo "$as_me:$LINENO: checking for $ac_word" >&5 +echo $ECHO_N "checking for $ac_word... $ECHO_C" >&6; } +if test "${ac_cv_prog_ac_ct_CXX+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + if test -n "$ac_ct_CXX"; then + ac_cv_prog_ac_ct_CXX="$ac_ct_CXX" # Let the user override the test. +else +as_save_IFS=$IFS; IFS=$PATH_SEPARATOR +for as_dir in $PATH +do + IFS=$as_save_IFS + test -z "$as_dir" && as_dir=. + for ac_exec_ext in '' $ac_executable_extensions; do + if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then + ac_cv_prog_ac_ct_CXX="$ac_prog" + echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5 + break 2 + fi +done +done +IFS=$as_save_IFS + +fi +fi +ac_ct_CXX=$ac_cv_prog_ac_ct_CXX +if test -n "$ac_ct_CXX"; then + { echo "$as_me:$LINENO: result: $ac_ct_CXX" >&5 +echo "${ECHO_T}$ac_ct_CXX" >&6; } +else + { echo "$as_me:$LINENO: result: no" >&5 +echo "${ECHO_T}no" >&6; } +fi + + + test -n "$ac_ct_CXX" && break +done + + if test "x$ac_ct_CXX" = x; then + CXX="g++" + else + case $cross_compiling:$ac_tool_warned in +yes:) +{ echo "$as_me:$LINENO: WARNING: In the future, Autoconf will not detect cross-tools +whose name does not start with the host triplet. If you think this +configuration is useful to you, please write to autoconf@gnu.org." >&5 +echo "$as_me: WARNING: In the future, Autoconf will not detect cross-tools +whose name does not start with the host triplet. If you think this +configuration is useful to you, please write to autoconf@gnu.org." >&2;} +ac_tool_warned=yes ;; +esac + CXX=$ac_ct_CXX + fi +fi + + fi +fi +# Provide some information about the compiler. +echo "$as_me:$LINENO: checking for C++ compiler version" >&5 +ac_compiler=`set X $ac_compile; echo $2` +{ (ac_try="$ac_compiler --version >&5" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_compiler --version >&5") 2>&5 + ac_status=$? + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } +{ (ac_try="$ac_compiler -v >&5" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_compiler -v >&5") 2>&5 + ac_status=$? + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } +{ (ac_try="$ac_compiler -V >&5" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_compiler -V >&5") 2>&5 + ac_status=$? + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } + +{ echo "$as_me:$LINENO: checking whether we are using the GNU C++ compiler" >&5 +echo $ECHO_N "checking whether we are using the GNU C++ compiler... $ECHO_C" >&6; } +if test "${ac_cv_cxx_compiler_gnu+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ + +int +main () +{ +#ifndef __GNUC__ + choke me +#endif + + ; + return 0; +} +_ACEOF +rm -f conftest.$ac_objext +if { (ac_try="$ac_compile" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_compile") 2>conftest.er1 + ac_status=$? + grep -v '^ *+' conftest.er1 >conftest.err + rm -f conftest.er1 + cat conftest.err >&5 + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } && { + test -z "$ac_cxx_werror_flag" || + test ! -s conftest.err + } && test -s conftest.$ac_objext; then + ac_compiler_gnu=yes +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + + ac_compiler_gnu=no +fi + +rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext +ac_cv_cxx_compiler_gnu=$ac_compiler_gnu + +fi +{ echo "$as_me:$LINENO: result: $ac_cv_cxx_compiler_gnu" >&5 +echo "${ECHO_T}$ac_cv_cxx_compiler_gnu" >&6; } +GXX=`test $ac_compiler_gnu = yes && echo yes` +ac_test_CXXFLAGS=${CXXFLAGS+set} +ac_save_CXXFLAGS=$CXXFLAGS +{ echo "$as_me:$LINENO: checking whether $CXX accepts -g" >&5 +echo $ECHO_N "checking whether $CXX accepts -g... $ECHO_C" >&6; } +if test "${ac_cv_prog_cxx_g+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + ac_save_cxx_werror_flag=$ac_cxx_werror_flag + ac_cxx_werror_flag=yes + ac_cv_prog_cxx_g=no + CXXFLAGS="-g" + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ + +int +main () +{ + + ; + return 0; +} +_ACEOF +rm -f conftest.$ac_objext +if { (ac_try="$ac_compile" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_compile") 2>conftest.er1 + ac_status=$? + grep -v '^ *+' conftest.er1 >conftest.err + rm -f conftest.er1 + cat conftest.err >&5 + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } && { + test -z "$ac_cxx_werror_flag" || + test ! -s conftest.err + } && test -s conftest.$ac_objext; then + ac_cv_prog_cxx_g=yes +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + + CXXFLAGS="" + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ + +int +main () +{ + + ; + return 0; +} +_ACEOF +rm -f conftest.$ac_objext +if { (ac_try="$ac_compile" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_compile") 2>conftest.er1 + ac_status=$? + grep -v '^ *+' conftest.er1 >conftest.err + rm -f conftest.er1 + cat conftest.err >&5 + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } && { + test -z "$ac_cxx_werror_flag" || + test ! -s conftest.err + } && test -s conftest.$ac_objext; then + : +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + + ac_cxx_werror_flag=$ac_save_cxx_werror_flag + CXXFLAGS="-g" + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ + +int +main () +{ + + ; + return 0; +} +_ACEOF +rm -f conftest.$ac_objext +if { (ac_try="$ac_compile" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_compile") 2>conftest.er1 + ac_status=$? + grep -v '^ *+' conftest.er1 >conftest.err + rm -f conftest.er1 + cat conftest.err >&5 + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } && { + test -z "$ac_cxx_werror_flag" || + test ! -s conftest.err + } && test -s conftest.$ac_objext; then + ac_cv_prog_cxx_g=yes +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + + +fi + +rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext +fi + +rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext +fi + +rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext + ac_cxx_werror_flag=$ac_save_cxx_werror_flag +fi +{ echo "$as_me:$LINENO: result: $ac_cv_prog_cxx_g" >&5 +echo "${ECHO_T}$ac_cv_prog_cxx_g" >&6; } +if test "$ac_test_CXXFLAGS" = set; then + CXXFLAGS=$ac_save_CXXFLAGS +elif test $ac_cv_prog_cxx_g = yes; then + if test "$GXX" = yes; then + CXXFLAGS="-g -O2" + else + CXXFLAGS="-g" + fi +else + if test "$GXX" = yes; then + CXXFLAGS="-O2" + else + CXXFLAGS= + fi +fi +ac_ext=c +ac_cpp='$CPP $CPPFLAGS' +ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5' +ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5' +ac_compiler_gnu=$ac_cv_c_compiler_gnu + +depcc="$CXX" am_compiler_list= + +{ echo "$as_me:$LINENO: checking dependency style of $depcc" >&5 +echo $ECHO_N "checking dependency style of $depcc... $ECHO_C" >&6; } +if test "${am_cv_CXX_dependencies_compiler_type+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + if test -z "$AMDEP_TRUE" && test -f "$am_depcomp"; then + # We make a subdir and do the tests there. Otherwise we can end up + # making bogus files that we don't know about and never remove. For + # instance it was reported that on HP-UX the gcc test will end up + # making a dummy file named `D' -- because `-MD' means `put the output + # in D'. + mkdir conftest.dir + # Copy depcomp to subdir because otherwise we won't find it if we're + # using a relative directory. + cp "$am_depcomp" conftest.dir + cd conftest.dir + # We will build objects and dependencies in a subdirectory because + # it helps to detect inapplicable dependency modes. For instance + # both Tru64's cc and ICC support -MD to output dependencies as a + # side effect of compilation, but ICC will put the dependencies in + # the current directory while Tru64 will put them in the object + # directory. + mkdir sub + + am_cv_CXX_dependencies_compiler_type=none + if test "$am_compiler_list" = ""; then + am_compiler_list=`sed -n 's/^#*\([a-zA-Z0-9]*\))$/\1/p' < ./depcomp` + fi + for depmode in $am_compiler_list; do + # Setup a source with many dependencies, because some compilers + # like to wrap large dependency lists on column 80 (with \), and + # we should not choose a depcomp mode which is confused by this. + # + # We need to recreate these files for each test, as the compiler may + # overwrite some of them when testing with obscure command lines. + # This happens at least with the AIX C compiler. + : > sub/conftest.c + for i in 1 2 3 4 5 6; do + echo '#include "conftst'$i'.h"' >> sub/conftest.c + # Using `: > sub/conftst$i.h' creates only sub/conftst1.h with + # Solaris 8's {/usr,}/bin/sh. + touch sub/conftst$i.h + done + echo "${am__include} ${am__quote}sub/conftest.Po${am__quote}" > confmf + + case $depmode in + nosideeffect) + # after this tag, mechanisms are not by side-effect, so they'll + # only be used when explicitly requested + if test "x$enable_dependency_tracking" = xyes; then + continue + else + break + fi + ;; + none) break ;; + esac + # We check with `-c' and `-o' for the sake of the "dashmstdout" + # mode. It turns out that the SunPro C++ compiler does not properly + # handle `-M -o', and we need to detect this. + if depmode=$depmode \ + source=sub/conftest.c object=sub/conftest.${OBJEXT-o} \ + depfile=sub/conftest.Po tmpdepfile=sub/conftest.TPo \ + $SHELL ./depcomp $depcc -c -o sub/conftest.${OBJEXT-o} sub/conftest.c \ + >/dev/null 2>conftest.err && + grep sub/conftst1.h sub/conftest.Po > /dev/null 2>&1 && + grep sub/conftst6.h sub/conftest.Po > /dev/null 2>&1 && + grep sub/conftest.${OBJEXT-o} sub/conftest.Po > /dev/null 2>&1 && + ${MAKE-make} -s -f confmf > /dev/null 2>&1; then + # icc doesn't choke on unknown options, it will just issue warnings + # or remarks (even with -Werror). So we grep stderr for any message + # that says an option was ignored or not supported. + # When given -MP, icc 7.0 and 7.1 complain thusly: + # icc: Command line warning: ignoring option '-M'; no argument required + # The diagnosis changed in icc 8.0: + # icc: Command line remark: option '-MP' not supported + if (grep 'ignoring option' conftest.err || + grep 'not supported' conftest.err) >/dev/null 2>&1; then :; else + am_cv_CXX_dependencies_compiler_type=$depmode + break + fi + fi + done + + cd .. + rm -rf conftest.dir +else + am_cv_CXX_dependencies_compiler_type=none +fi + +fi +{ echo "$as_me:$LINENO: result: $am_cv_CXX_dependencies_compiler_type" >&5 +echo "${ECHO_T}$am_cv_CXX_dependencies_compiler_type" >&6; } +CXXDEPMODE=depmode=$am_cv_CXX_dependencies_compiler_type + + if + test "x$enable_dependency_tracking" != xno \ + && test "$am_cv_CXX_dependencies_compiler_type" = gcc3; then + am__fastdepCXX_TRUE= + am__fastdepCXX_FALSE='#' +else + am__fastdepCXX_TRUE='#' + am__fastdepCXX_FALSE= +fi + + + ac_ext=cpp +ac_cpp='$CXXCPP $CPPFLAGS' +ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5' +ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5' +ac_compiler_gnu=$ac_cv_cxx_compiler_gnu +{ echo "$as_me:$LINENO: checking how to run the C++ preprocessor" >&5 +echo $ECHO_N "checking how to run the C++ preprocessor... $ECHO_C" >&6; } +if test -z "$CXXCPP"; then + if test "${ac_cv_prog_CXXCPP+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + # Double quotes because CXXCPP needs to be expanded + for CXXCPP in "$CXX -E" "/lib/cpp" + do + ac_preproc_ok=false +for ac_cxx_preproc_warn_flag in '' yes +do + # Use a header file that comes with gcc, so configuring glibc + # with a fresh cross-compiler works. + # Prefer to if __STDC__ is defined, since + # exists even on freestanding compilers. + # On the NeXT, cc -E runs the code through the compiler's parser, + # not just through cpp. "Syntax error" is here to catch this case. + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ +#ifdef __STDC__ +# include +#else +# include +#endif + Syntax error +_ACEOF +if { (ac_try="$ac_cpp conftest.$ac_ext" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_cpp conftest.$ac_ext") 2>conftest.er1 + ac_status=$? + grep -v '^ *+' conftest.er1 >conftest.err + rm -f conftest.er1 + cat conftest.err >&5 + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } >/dev/null && { + test -z "$ac_cxx_preproc_warn_flag$ac_cxx_werror_flag" || + test ! -s conftest.err + }; then + : +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + + # Broken: fails on valid input. +continue +fi + +rm -f conftest.err conftest.$ac_ext + + # OK, works on sane cases. Now check whether nonexistent headers + # can be detected and how. + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ +#include +_ACEOF +if { (ac_try="$ac_cpp conftest.$ac_ext" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_cpp conftest.$ac_ext") 2>conftest.er1 + ac_status=$? + grep -v '^ *+' conftest.er1 >conftest.err + rm -f conftest.er1 + cat conftest.err >&5 + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } >/dev/null && { + test -z "$ac_cxx_preproc_warn_flag$ac_cxx_werror_flag" || + test ! -s conftest.err + }; then + # Broken: success on invalid input. +continue +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + + # Passes both tests. +ac_preproc_ok=: +break +fi + +rm -f conftest.err conftest.$ac_ext + +done +# Because of `break', _AC_PREPROC_IFELSE's cleaning code was skipped. +rm -f conftest.err conftest.$ac_ext +if $ac_preproc_ok; then + break +fi + + done + ac_cv_prog_CXXCPP=$CXXCPP + +fi + CXXCPP=$ac_cv_prog_CXXCPP +else + ac_cv_prog_CXXCPP=$CXXCPP +fi +{ echo "$as_me:$LINENO: result: $CXXCPP" >&5 +echo "${ECHO_T}$CXXCPP" >&6; } +ac_preproc_ok=false +for ac_cxx_preproc_warn_flag in '' yes +do + # Use a header file that comes with gcc, so configuring glibc + # with a fresh cross-compiler works. + # Prefer to if __STDC__ is defined, since + # exists even on freestanding compilers. + # On the NeXT, cc -E runs the code through the compiler's parser, + # not just through cpp. "Syntax error" is here to catch this case. + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ +#ifdef __STDC__ +# include +#else +# include +#endif + Syntax error +_ACEOF +if { (ac_try="$ac_cpp conftest.$ac_ext" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_cpp conftest.$ac_ext") 2>conftest.er1 + ac_status=$? + grep -v '^ *+' conftest.er1 >conftest.err + rm -f conftest.er1 + cat conftest.err >&5 + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } >/dev/null && { + test -z "$ac_cxx_preproc_warn_flag$ac_cxx_werror_flag" || + test ! -s conftest.err + }; then + : +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + + # Broken: fails on valid input. +continue +fi + +rm -f conftest.err conftest.$ac_ext + + # OK, works on sane cases. Now check whether nonexistent headers + # can be detected and how. + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ +#include +_ACEOF +if { (ac_try="$ac_cpp conftest.$ac_ext" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_cpp conftest.$ac_ext") 2>conftest.er1 + ac_status=$? + grep -v '^ *+' conftest.er1 >conftest.err + rm -f conftest.er1 + cat conftest.err >&5 + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } >/dev/null && { + test -z "$ac_cxx_preproc_warn_flag$ac_cxx_werror_flag" || + test ! -s conftest.err + }; then + # Broken: success on invalid input. +continue +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + + # Passes both tests. +ac_preproc_ok=: +break +fi + +rm -f conftest.err conftest.$ac_ext + +done +# Because of `break', _AC_PREPROC_IFELSE's cleaning code was skipped. +rm -f conftest.err conftest.$ac_ext +if $ac_preproc_ok; then + : +else + { { echo "$as_me:$LINENO: error: C++ preprocessor \"$CXXCPP\" fails sanity check +See \`config.log' for more details." >&5 +echo "$as_me: error: C++ preprocessor \"$CXXCPP\" fails sanity check +See \`config.log' for more details." >&2;} + { (exit 1); exit 1; }; } +fi + +ac_ext=c +ac_cpp='$CPP $CPPFLAGS' +ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5' +ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5' +ac_compiler_gnu=$ac_cv_c_compiler_gnu + + + + + + ac_ext=cpp +ac_cpp='$CXXCPP $CPPFLAGS' +ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5' +ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5' +ac_compiler_gnu=$ac_cv_cxx_compiler_gnu + + + { echo "$as_me:$LINENO: checking whether C++ has bool" >&5 +echo $ECHO_N "checking whether C++ has bool... $ECHO_C" >&6; } + if test "$cross_compiling" = yes; then + { echo "$as_me:$LINENO: WARNING: Don't cross-compile" >&5 +echo "$as_me: WARNING: Don't cross-compile" >&2;} + +else + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ +main() { bool b1=true; bool b2=false; } +_ACEOF +rm -f conftest$ac_exeext +if { (ac_try="$ac_link" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_link") 2>&5 + ac_status=$? + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } && { ac_try='./conftest$ac_exeext' + { (case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_try") 2>&5 + ac_status=$? + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); }; }; then + { echo "$as_me:$LINENO: result: yes" >&5 +echo "${ECHO_T}yes" >&6; } +else + echo "$as_me: program exited with status $ac_status" >&5 +echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + +( exit $ac_status ) + { echo "$as_me:$LINENO: result: no" >&5 +echo "${ECHO_T}no" >&6; } + cat >>confdefs.h <<\_ACEOF +#define CXX_HAS_NO_BOOL 1 +_ACEOF + +fi +rm -f core *.core core.conftest.* gmon.out bb.out conftest$ac_exeext conftest.$ac_objext conftest.$ac_ext +fi + + + + { echo "$as_me:$LINENO: checking whether C++ has buggy scoping in for-loops" >&5 +echo $ECHO_N "checking whether C++ has buggy scoping in for-loops... $ECHO_C" >&6; } + cat >conftest.$ac_ext <<_ACEOF +/* confdefs.h. */ +_ACEOF +cat confdefs.h >>conftest.$ac_ext +cat >>conftest.$ac_ext <<_ACEOF +/* end confdefs.h. */ +#include +int +main () +{ + + for (int i=0;i<10;i++) { } + for (int i=0;i<10;i++) { } + + ; + return 0; +} +_ACEOF +rm -f conftest.$ac_objext +if { (ac_try="$ac_compile" +case "(($ac_try" in + *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;; + *) ac_try_echo=$ac_try;; +esac +eval "echo \"\$as_me:$LINENO: $ac_try_echo\"") >&5 + (eval "$ac_compile") 2>conftest.er1 + ac_status=$? + grep -v '^ *+' conftest.er1 >conftest.err + rm -f conftest.er1 + cat conftest.err >&5 + echo "$as_me:$LINENO: \$? = $ac_status" >&5 + (exit $ac_status); } && { + test -z "$ac_cxx_werror_flag" || + test ! -s conftest.err + } && test -s conftest.$ac_objext; then + { echo "$as_me:$LINENO: result: no" >&5 +echo "${ECHO_T}no" >&6; } +else + echo "$as_me: failed program was:" >&5 +sed 's/^/| /' conftest.$ac_ext >&5 + + { echo "$as_me:$LINENO: result: yes" >&5 +echo "${ECHO_T}yes" >&6; } + cat >>confdefs.h <<\_ACEOF +#define CXX_HAS_BUGGY_FOR_LOOPS 1 +_ACEOF + +fi + +rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext + + { echo "$as_me:$LINENO: checking whether user wants assertions" >&5 +echo $ECHO_N "checking whether user wants assertions... $ECHO_C" >&6; } + # Check whether --enable-assert was given. +if test "${enable_assert+set}" = set; then + enableval=$enable_assert; cat >>confdefs.h <<\_ACEOF +#define NDEBUG 1 +_ACEOF + + { echo "$as_me:$LINENO: result: no" >&5 +echo "${ECHO_T}no" >&6; } +else + { echo "$as_me:$LINENO: result: yes" >&5 +echo "${ECHO_T}yes" >&6; } +fi + + + ac_ext=c +ac_cpp='$CPP $CPPFLAGS' +ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5' +ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5' +ac_compiler_gnu=$ac_cv_c_compiler_gnu + + + +# Make sure we can run config.sub. +$SHELL "$ac_aux_dir/config.sub" sun4 >/dev/null 2>&1 || + { { echo "$as_me:$LINENO: error: cannot run $SHELL $ac_aux_dir/config.sub" >&5 +echo "$as_me: error: cannot run $SHELL $ac_aux_dir/config.sub" >&2;} + { (exit 1); exit 1; }; } + +{ echo "$as_me:$LINENO: checking build system type" >&5 +echo $ECHO_N "checking build system type... $ECHO_C" >&6; } +if test "${ac_cv_build+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + ac_build_alias=$build_alias +test "x$ac_build_alias" = x && + ac_build_alias=`$SHELL "$ac_aux_dir/config.guess"` +test "x$ac_build_alias" = x && + { { echo "$as_me:$LINENO: error: cannot guess build type; you must specify one" >&5 +echo "$as_me: error: cannot guess build type; you must specify one" >&2;} + { (exit 1); exit 1; }; } +ac_cv_build=`$SHELL "$ac_aux_dir/config.sub" $ac_build_alias` || + { { echo "$as_me:$LINENO: error: $SHELL $ac_aux_dir/config.sub $ac_build_alias failed" >&5 +echo "$as_me: error: $SHELL $ac_aux_dir/config.sub $ac_build_alias failed" >&2;} + { (exit 1); exit 1; }; } + +fi +{ echo "$as_me:$LINENO: result: $ac_cv_build" >&5 +echo "${ECHO_T}$ac_cv_build" >&6; } +case $ac_cv_build in +*-*-*) ;; +*) { { echo "$as_me:$LINENO: error: invalid value of canonical build" >&5 +echo "$as_me: error: invalid value of canonical build" >&2;} + { (exit 1); exit 1; }; };; +esac +build=$ac_cv_build +ac_save_IFS=$IFS; IFS='-' +set x $ac_cv_build +shift +build_cpu=$1 +build_vendor=$2 +shift; shift +# Remember, the first character of IFS is used to create $*, +# except with old shells: +build_os=$* +IFS=$ac_save_IFS +case $build_os in *\ *) build_os=`echo "$build_os" | sed 's/ /-/g'`;; esac + + + + { echo "$as_me:$LINENO: checking host system type" >&5 +echo $ECHO_N "checking host system type... $ECHO_C" >&6; } +if test "${ac_cv_host+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + if test "x$host_alias" = x; then + ac_cv_host=$ac_cv_build +else + ac_cv_host=`$SHELL "$ac_aux_dir/config.sub" $host_alias` || + { { echo "$as_me:$LINENO: error: $SHELL $ac_aux_dir/config.sub $host_alias failed" >&5 +echo "$as_me: error: $SHELL $ac_aux_dir/config.sub $host_alias failed" >&2;} + { (exit 1); exit 1; }; } +fi + +fi +{ echo "$as_me:$LINENO: result: $ac_cv_host" >&5 +echo "${ECHO_T}$ac_cv_host" >&6; } +case $ac_cv_host in +*-*-*) ;; +*) { { echo "$as_me:$LINENO: error: invalid value of canonical host" >&5 +echo "$as_me: error: invalid value of canonical host" >&2;} + { (exit 1); exit 1; }; };; +esac +host=$ac_cv_host +ac_save_IFS=$IFS; IFS='-' +set x $ac_cv_host +shift +host_cpu=$1 +host_vendor=$2 +shift; shift +# Remember, the first character of IFS is used to create $*, +# except with old shells: +host_os=$* +IFS=$ac_save_IFS +case $host_os in *\ *) host_os=`echo "$host_os" | sed 's/ /-/g'`;; esac + + + if test -z "$host" + then + host=unknown + fi + canonical_host_type=$host + if test "$host" = unknown + then + { echo "$as_me:$LINENO: WARNING: configuring for unknown system type" >&5 +echo "$as_me: WARNING: configuring for unknown system type" >&2;} + fi + + cat >>confdefs.h <<_ACEOF +#define YOUR_OS "$canonical_host_type" +_ACEOF + + + + { echo "$as_me:$LINENO: checking whether user wants warnings" >&5 +echo $ECHO_N "checking whether user wants warnings... $ECHO_C" >&6; } + +# Check whether --with-warnings was given. +if test "${with_warnings+set}" = set; then + withval=$with_warnings; lf_warnings=yes +else + lf_warnings=no +fi + + { echo "$as_me:$LINENO: result: $lf_warnings" >&5 +echo "${ECHO_T}$lf_warnings" >&6; } + + cc_warning_flags="-Wall" + cxx_warning_flags="-Wall -Woverloaded-virtual -Wtemplate-debugging" + if test $lf_warnings = yes + then + if test -n "${CC}" + then + + echo 'void f(){}' > conftest.c + for i in $cc_warning_flags + do + { echo "$as_me:$LINENO: checking whether $CC accepts $i" >&5 +echo $ECHO_N "checking whether $CC accepts $i... $ECHO_C" >&6; } + if test -z "`${CC} $i -c conftest.c 2>&1`" + then + CFLAGS="${CFLAGS} $i" + { echo "$as_me:$LINENO: result: yes" >&5 +echo "${ECHO_T}yes" >&6; } + else + { echo "$as_me:$LINENO: result: no" >&5 +echo "${ECHO_T}no" >&6; } + fi + done + rm -f conftest.c conftest.o + + fi + if test -n "${CXX}" + then + + echo 'void f(){}' > conftest.cc + for i in $cxx_warning_flags + do + { echo "$as_me:$LINENO: checking whether $CXX accepts $i" >&5 +echo $ECHO_N "checking whether $CXX accepts $i... $ECHO_C" >&6; } + if test -z "`${CXX} $i -c conftest.cc 2>&1`" + then + CXXFLAGS="${CXXFLAGS} $i" + { echo "$as_me:$LINENO: result: yes" >&5 +echo "${ECHO_T}yes" >&6; } + else + { echo "$as_me:$LINENO: result: no" >&5 +echo "${ECHO_T}no" >&6; } + fi + done + rm -f conftest.cc conftest.o + + fi + fi + +if test -n "$ac_tool_prefix"; then + # Extract the first word of "${ac_tool_prefix}ranlib", so it can be a program name with args. +set dummy ${ac_tool_prefix}ranlib; ac_word=$2 +{ echo "$as_me:$LINENO: checking for $ac_word" >&5 +echo $ECHO_N "checking for $ac_word... $ECHO_C" >&6; } +if test "${ac_cv_prog_RANLIB+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + if test -n "$RANLIB"; then + ac_cv_prog_RANLIB="$RANLIB" # Let the user override the test. +else +as_save_IFS=$IFS; IFS=$PATH_SEPARATOR +for as_dir in $PATH +do + IFS=$as_save_IFS + test -z "$as_dir" && as_dir=. + for ac_exec_ext in '' $ac_executable_extensions; do + if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then + ac_cv_prog_RANLIB="${ac_tool_prefix}ranlib" + echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5 + break 2 + fi +done +done +IFS=$as_save_IFS + +fi +fi +RANLIB=$ac_cv_prog_RANLIB +if test -n "$RANLIB"; then + { echo "$as_me:$LINENO: result: $RANLIB" >&5 +echo "${ECHO_T}$RANLIB" >&6; } +else + { echo "$as_me:$LINENO: result: no" >&5 +echo "${ECHO_T}no" >&6; } +fi + + +fi +if test -z "$ac_cv_prog_RANLIB"; then + ac_ct_RANLIB=$RANLIB + # Extract the first word of "ranlib", so it can be a program name with args. +set dummy ranlib; ac_word=$2 +{ echo "$as_me:$LINENO: checking for $ac_word" >&5 +echo $ECHO_N "checking for $ac_word... $ECHO_C" >&6; } +if test "${ac_cv_prog_ac_ct_RANLIB+set}" = set; then + echo $ECHO_N "(cached) $ECHO_C" >&6 +else + if test -n "$ac_ct_RANLIB"; then + ac_cv_prog_ac_ct_RANLIB="$ac_ct_RANLIB" # Let the user override the test. +else +as_save_IFS=$IFS; IFS=$PATH_SEPARATOR +for as_dir in $PATH +do + IFS=$as_save_IFS + test -z "$as_dir" && as_dir=. + for ac_exec_ext in '' $ac_executable_extensions; do + if { test -f "$as_dir/$ac_word$ac_exec_ext" && $as_test_x "$as_dir/$ac_word$ac_exec_ext"; }; then + ac_cv_prog_ac_ct_RANLIB="ranlib" + echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5 + break 2 + fi +done +done +IFS=$as_save_IFS + +fi +fi +ac_ct_RANLIB=$ac_cv_prog_ac_ct_RANLIB +if test -n "$ac_ct_RANLIB"; then + { echo "$as_me:$LINENO: result: $ac_ct_RANLIB" >&5 +echo "${ECHO_T}$ac_ct_RANLIB" >&6; } +else + { echo "$as_me:$LINENO: result: no" >&5 +echo "${ECHO_T}no" >&6; } +fi + + if test "x$ac_ct_RANLIB" = x; then + RANLIB=":" + else + case $cross_compiling:$ac_tool_warned in +yes:) +{ echo "$as_me:$LINENO: WARNING: In the future, Autoconf will not detect cross-tools +whose name does not start with the host triplet. If you think this +configuration is useful to you, please write to autoconf@gnu.org." >&5 +echo "$as_me: WARNING: In the future, Autoconf will not detect cross-tools +whose name does not start with the host triplet. If you think this +configuration is useful to you, please write to autoconf@gnu.org." >&2;} +ac_tool_warned=yes ;; +esac + RANLIB=$ac_ct_RANLIB + fi +else + RANLIB="$ac_cv_prog_RANLIB" +fi + + +ac_config_files="$ac_config_files Makefile doc/Makefile m4/Makefile src/Makefile src/libfastx/Makefile src/fastx_clipper/Makefile src/fastq_to_fasta/Makefile src/fastx_quality_stats/Makefile src/fastq_quality_converter/Makefile src/fastx_trimmer/Makefile src/fastq_quality_filter/Makefile src/fastx_artifacts_filter/Makefile src/fastx_reverse_complement/Makefile src/fastx_collapser/Makefile src/seqalign_test/Makefile galaxy/Makefile galaxy/tools/Makefile galaxy/tools/fastx_toolkit/Makefile galaxy/tools/fastx_toolkit_with_gzip_and_output_label/Makefile galaxy/test-data/Makefile galaxy/static/Makefile galaxy/static/fastx_icons/Makefile galaxy/tool-data/Makefile scripts/Makefile" + + +cat >confcache <<\_ACEOF +# This file is a shell script that caches the results of configure +# tests run on this system so they can be shared between configure +# scripts and configure runs, see configure's option --config-cache. +# It is not useful on other systems. If it contains results you don't +# want to keep, you may remove or edit it. +# +# config.status only pays attention to the cache file if you give it +# the --recheck option to rerun configure. +# +# `ac_cv_env_foo' variables (set or unset) will be overridden when +# loading this file, other *unset* `ac_cv_foo' will be assigned the +# following values. + +_ACEOF + +# The following way of writing the cache mishandles newlines in values, +# but we know of no workaround that is simple, portable, and efficient. +# So, we kill variables containing newlines. +# Ultrix sh set writes to stderr and can't be redirected directly, +# and sets the high bit in the cache file unless we assign to the vars. +( + for ac_var in `(set) 2>&1 | sed -n 's/^\([a-zA-Z_][a-zA-Z0-9_]*\)=.*/\1/p'`; do + eval ac_val=\$$ac_var + case $ac_val in #( + *${as_nl}*) + case $ac_var in #( + *_cv_*) { echo "$as_me:$LINENO: WARNING: Cache variable $ac_var contains a newline." >&5 +echo "$as_me: WARNING: Cache variable $ac_var contains a newline." >&2;} ;; + esac + case $ac_var in #( + _ | IFS | as_nl) ;; #( + *) $as_unset $ac_var ;; + esac ;; + esac + done + + (set) 2>&1 | + case $as_nl`(ac_space=' '; set) 2>&1` in #( + *${as_nl}ac_space=\ *) + # `set' does not quote correctly, so add quotes (double-quote + # substitution turns \\\\ into \\, and sed turns \\ into \). + sed -n \ + "s/'/'\\\\''/g; + s/^\\([_$as_cr_alnum]*_cv_[_$as_cr_alnum]*\\)=\\(.*\\)/\\1='\\2'/p" + ;; #( + *) + # `set' quotes correctly as required by POSIX, so do not add quotes. + sed -n "/^[_$as_cr_alnum]*_cv_[_$as_cr_alnum]*=/p" + ;; + esac | + sort +) | + sed ' + /^ac_cv_env_/b end + t clear + :clear + s/^\([^=]*\)=\(.*[{}].*\)$/test "${\1+set}" = set || &/ + t end + s/^\([^=]*\)=\(.*\)$/\1=${\1=\2}/ + :end' >>confcache +if diff "$cache_file" confcache >/dev/null 2>&1; then :; else + if test -w "$cache_file"; then + test "x$cache_file" != "x/dev/null" && + { echo "$as_me:$LINENO: updating cache $cache_file" >&5 +echo "$as_me: updating cache $cache_file" >&6;} + cat confcache >$cache_file + else + { echo "$as_me:$LINENO: not updating unwritable cache $cache_file" >&5 +echo "$as_me: not updating unwritable cache $cache_file" >&6;} + fi +fi +rm -f confcache + +test "x$prefix" = xNONE && prefix=$ac_default_prefix +# Let make expand exec_prefix. +test "x$exec_prefix" = xNONE && exec_prefix='${prefix}' + +DEFS=-DHAVE_CONFIG_H + +ac_libobjs= +ac_ltlibobjs= +for ac_i in : $LIBOBJS; do test "x$ac_i" = x: && continue + # 1. Remove the extension, and $U if already installed. + ac_script='s/\$U\././;s/\.o$//;s/\.obj$//' + ac_i=`echo "$ac_i" | sed "$ac_script"` + # 2. Prepend LIBOBJDIR. When used with automake>=1.10 LIBOBJDIR + # will be set to the directory where LIBOBJS objects are built. + ac_libobjs="$ac_libobjs \${LIBOBJDIR}$ac_i\$U.$ac_objext" + ac_ltlibobjs="$ac_ltlibobjs \${LIBOBJDIR}$ac_i"'$U.lo' +done +LIBOBJS=$ac_libobjs + +LTLIBOBJS=$ac_ltlibobjs + + +if test -z "${AMDEP_TRUE}" && test -z "${AMDEP_FALSE}"; then + { { echo "$as_me:$LINENO: error: conditional \"AMDEP\" was never defined. +Usually this means the macro was only invoked conditionally." >&5 +echo "$as_me: error: conditional \"AMDEP\" was never defined. +Usually this means the macro was only invoked conditionally." >&2;} + { (exit 1); exit 1; }; } +fi +if test -z "${am__fastdepCC_TRUE}" && test -z "${am__fastdepCC_FALSE}"; then + { { echo "$as_me:$LINENO: error: conditional \"am__fastdepCC\" was never defined. +Usually this means the macro was only invoked conditionally." >&5 +echo "$as_me: error: conditional \"am__fastdepCC\" was never defined. +Usually this means the macro was only invoked conditionally." >&2;} + { (exit 1); exit 1; }; } +fi +if test -z "${am__fastdepCXX_TRUE}" && test -z "${am__fastdepCXX_FALSE}"; then + { { echo "$as_me:$LINENO: error: conditional \"am__fastdepCXX\" was never defined. +Usually this means the macro was only invoked conditionally." >&5 +echo "$as_me: error: conditional \"am__fastdepCXX\" was never defined. +Usually this means the macro was only invoked conditionally." >&2;} + { (exit 1); exit 1; }; } +fi + +: ${CONFIG_STATUS=./config.status} +ac_clean_files_save=$ac_clean_files +ac_clean_files="$ac_clean_files $CONFIG_STATUS" +{ echo "$as_me:$LINENO: creating $CONFIG_STATUS" >&5 +echo "$as_me: creating $CONFIG_STATUS" >&6;} +cat >$CONFIG_STATUS <<_ACEOF +#! $SHELL +# Generated by $as_me. +# Run this file to recreate the current configuration. +# Compiler output produced by configure, useful for debugging +# configure, is in config.log if it exists. + +debug=false +ac_cs_recheck=false +ac_cs_silent=false +SHELL=\${CONFIG_SHELL-$SHELL} +_ACEOF + +cat >>$CONFIG_STATUS <<\_ACEOF +## --------------------- ## +## M4sh Initialization. ## +## --------------------- ## + +# Be more Bourne compatible +DUALCASE=1; export DUALCASE # for MKS sh +if test -n "${ZSH_VERSION+set}" && (emulate sh) >/dev/null 2>&1; then + emulate sh + NULLCMD=: + # Zsh 3.x and 4.x performs word splitting on ${1+"$@"}, which + # is contrary to our usage. Disable this feature. + alias -g '${1+"$@"}'='"$@"' + setopt NO_GLOB_SUBST +else + case `(set -o) 2>/dev/null` in + *posix*) set -o posix ;; +esac + +fi + + + + +# PATH needs CR +# Avoid depending upon Character Ranges. +as_cr_letters='abcdefghijklmnopqrstuvwxyz' +as_cr_LETTERS='ABCDEFGHIJKLMNOPQRSTUVWXYZ' +as_cr_Letters=$as_cr_letters$as_cr_LETTERS +as_cr_digits='0123456789' +as_cr_alnum=$as_cr_Letters$as_cr_digits + +# The user is always right. +if test "${PATH_SEPARATOR+set}" != set; then + echo "#! /bin/sh" >conf$$.sh + echo "exit 0" >>conf$$.sh + chmod +x conf$$.sh + if (PATH="/nonexistent;."; conf$$.sh) >/dev/null 2>&1; then + PATH_SEPARATOR=';' + else + PATH_SEPARATOR=: + fi + rm -f conf$$.sh +fi + +# Support unset when possible. +if ( (MAIL=60; unset MAIL) || exit) >/dev/null 2>&1; then + as_unset=unset +else + as_unset=false +fi + + +# IFS +# We need space, tab and new line, in precisely that order. Quoting is +# there to prevent editors from complaining about space-tab. +# (If _AS_PATH_WALK were called with IFS unset, it would disable word +# splitting by setting IFS to empty value.) +as_nl=' +' +IFS=" "" $as_nl" + +# Find who we are. Look in the path if we contain no directory separator. +case $0 in + *[\\/]* ) as_myself=$0 ;; + *) as_save_IFS=$IFS; IFS=$PATH_SEPARATOR +for as_dir in $PATH +do + IFS=$as_save_IFS + test -z "$as_dir" && as_dir=. + test -r "$as_dir/$0" && as_myself=$as_dir/$0 && break +done +IFS=$as_save_IFS + + ;; +esac +# We did not find ourselves, most probably we were run as `sh COMMAND' +# in which case we are not to be found in the path. +if test "x$as_myself" = x; then + as_myself=$0 +fi +if test ! -f "$as_myself"; then + echo "$as_myself: error: cannot find myself; rerun with an absolute file name" >&2 + { (exit 1); exit 1; } +fi + +# Work around bugs in pre-3.0 UWIN ksh. +for as_var in ENV MAIL MAILPATH +do ($as_unset $as_var) >/dev/null 2>&1 && $as_unset $as_var +done +PS1='$ ' +PS2='> ' +PS4='+ ' + +# NLS nuisances. +for as_var in \ + LANG LANGUAGE LC_ADDRESS LC_ALL LC_COLLATE LC_CTYPE LC_IDENTIFICATION \ + LC_MEASUREMENT LC_MESSAGES LC_MONETARY LC_NAME LC_NUMERIC LC_PAPER \ + LC_TELEPHONE LC_TIME +do + if (set +x; test -z "`(eval $as_var=C; export $as_var) 2>&1`"); then + eval $as_var=C; export $as_var + else + ($as_unset $as_var) >/dev/null 2>&1 && $as_unset $as_var + fi +done + +# Required to use basename. +if expr a : '\(a\)' >/dev/null 2>&1 && + test "X`expr 00001 : '.*\(...\)'`" = X001; then + as_expr=expr +else + as_expr=false +fi + +if (basename -- /) >/dev/null 2>&1 && test "X`basename -- / 2>&1`" = "X/"; then + as_basename=basename +else + as_basename=false +fi + + +# Name of the executable. +as_me=`$as_basename -- "$0" || +$as_expr X/"$0" : '.*/\([^/][^/]*\)/*$' \| \ + X"$0" : 'X\(//\)$' \| \ + X"$0" : 'X\(/\)' \| . 2>/dev/null || +echo X/"$0" | + sed '/^.*\/\([^/][^/]*\)\/*$/{ + s//\1/ + q + } + /^X\/\(\/\/\)$/{ + s//\1/ + q + } + /^X\/\(\/\).*/{ + s//\1/ + q + } + s/.*/./; q'` + +# CDPATH. +$as_unset CDPATH + + + + as_lineno_1=$LINENO + as_lineno_2=$LINENO + test "x$as_lineno_1" != "x$as_lineno_2" && + test "x`expr $as_lineno_1 + 1`" = "x$as_lineno_2" || { + + # Create $as_me.lineno as a copy of $as_myself, but with $LINENO + # uniformly replaced by the line number. The first 'sed' inserts a + # line-number line after each line using $LINENO; the second 'sed' + # does the real work. The second script uses 'N' to pair each + # line-number line with the line containing $LINENO, and appends + # trailing '-' during substitution so that $LINENO is not a special + # case at line end. + # (Raja R Harinath suggested sed '=', and Paul Eggert wrote the + # scripts with optimization help from Paolo Bonzini. Blame Lee + # E. McMahon (1931-1989) for sed's syntax. :-) + sed -n ' + p + /[$]LINENO/= + ' <$as_myself | + sed ' + s/[$]LINENO.*/&-/ + t lineno + b + :lineno + N + :loop + s/[$]LINENO\([^'$as_cr_alnum'_].*\n\)\(.*\)/\2\1\2/ + t loop + s/-\n.*// + ' >$as_me.lineno && + chmod +x "$as_me.lineno" || + { echo "$as_me: error: cannot create $as_me.lineno; rerun with a POSIX shell" >&2 + { (exit 1); exit 1; }; } + + # Don't try to exec as it changes $[0], causing all sort of problems + # (the dirname of $[0] is not the place where we might find the + # original and so on. Autoconf is especially sensitive to this). + . "./$as_me.lineno" + # Exit status is that of the last command. + exit +} + + +if (as_dir=`dirname -- /` && test "X$as_dir" = X/) >/dev/null 2>&1; then + as_dirname=dirname +else + as_dirname=false +fi + +ECHO_C= ECHO_N= ECHO_T= +case `echo -n x` in +-n*) + case `echo 'x\c'` in + *c*) ECHO_T=' ';; # ECHO_T is single tab character. + *) ECHO_C='\c';; + esac;; +*) + ECHO_N='-n';; +esac + +if expr a : '\(a\)' >/dev/null 2>&1 && + test "X`expr 00001 : '.*\(...\)'`" = X001; then + as_expr=expr +else + as_expr=false +fi + +rm -f conf$$ conf$$.exe conf$$.file +if test -d conf$$.dir; then + rm -f conf$$.dir/conf$$.file +else + rm -f conf$$.dir + mkdir conf$$.dir +fi +echo >conf$$.file +if ln -s conf$$.file conf$$ 2>/dev/null; then + as_ln_s='ln -s' + # ... but there are two gotchas: + # 1) On MSYS, both `ln -s file dir' and `ln file dir' fail. + # 2) DJGPP < 2.04 has no symlinks; `ln -s' creates a wrapper executable. + # In both cases, we have to default to `cp -p'. + ln -s conf$$.file conf$$.dir 2>/dev/null && test ! -f conf$$.exe || + as_ln_s='cp -p' +elif ln conf$$.file conf$$ 2>/dev/null; then + as_ln_s=ln +else + as_ln_s='cp -p' +fi +rm -f conf$$ conf$$.exe conf$$.dir/conf$$.file conf$$.file +rmdir conf$$.dir 2>/dev/null + +if mkdir -p . 2>/dev/null; then + as_mkdir_p=: +else + test -d ./-p && rmdir ./-p + as_mkdir_p=false +fi + +if test -x / >/dev/null 2>&1; then + as_test_x='test -x' +else + if ls -dL / >/dev/null 2>&1; then + as_ls_L_option=L + else + as_ls_L_option= + fi + as_test_x=' + eval sh -c '\'' + if test -d "$1"; then + test -d "$1/."; + else + case $1 in + -*)set "./$1";; + esac; + case `ls -ld'$as_ls_L_option' "$1" 2>/dev/null` in + ???[sx]*):;;*)false;;esac;fi + '\'' sh + ' +fi +as_executable_p=$as_test_x + +# Sed expression to map a string onto a valid CPP name. +as_tr_cpp="eval sed 'y%*$as_cr_letters%P$as_cr_LETTERS%;s%[^_$as_cr_alnum]%_%g'" + +# Sed expression to map a string onto a valid variable name. +as_tr_sh="eval sed 'y%*+%pp%;s%[^_$as_cr_alnum]%_%g'" + + +exec 6>&1 + +# Save the log message, to keep $[0] and so on meaningful, and to +# report actual input values of CONFIG_FILES etc. instead of their +# values after options handling. +ac_log=" +This file was extended by FASTX Toolkit $as_me 0.0.6, which was +generated by GNU Autoconf 2.61. Invocation command line was + + CONFIG_FILES = $CONFIG_FILES + CONFIG_HEADERS = $CONFIG_HEADERS + CONFIG_LINKS = $CONFIG_LINKS + CONFIG_COMMANDS = $CONFIG_COMMANDS + $ $0 $@ + +on `(hostname || uname -n) 2>/dev/null | sed 1q` +" + +_ACEOF + +cat >>$CONFIG_STATUS <<_ACEOF +# Files that config.status was made for. +config_files="$ac_config_files" +config_headers="$ac_config_headers" +config_commands="$ac_config_commands" + +_ACEOF + +cat >>$CONFIG_STATUS <<\_ACEOF +ac_cs_usage="\ +\`$as_me' instantiates files from templates according to the +current configuration. + +Usage: $0 [OPTIONS] [FILE]... + + -h, --help print this help, then exit + -V, --version print version number and configuration settings, then exit + -q, --quiet do not print progress messages + -d, --debug don't remove temporary files + --recheck update $as_me by reconfiguring in the same conditions + --file=FILE[:TEMPLATE] + instantiate the configuration file FILE + --header=FILE[:TEMPLATE] + instantiate the configuration header FILE + +Configuration files: +$config_files + +Configuration headers: +$config_headers + +Configuration commands: +$config_commands + +Report bugs to ." + +_ACEOF +cat >>$CONFIG_STATUS <<_ACEOF +ac_cs_version="\\ +FASTX Toolkit config.status 0.0.6 +configured by $0, generated by GNU Autoconf 2.61, + with options \\"`echo "$ac_configure_args" | sed 's/^ //; s/[\\""\`\$]/\\\\&/g'`\\" + +Copyright (C) 2006 Free Software Foundation, Inc. +This config.status script is free software; the Free Software Foundation +gives unlimited permission to copy, distribute and modify it." + +ac_pwd='$ac_pwd' +srcdir='$srcdir' +INSTALL='$INSTALL' +MKDIR_P='$MKDIR_P' +_ACEOF + +cat >>$CONFIG_STATUS <<\_ACEOF +# If no file are specified by the user, then we need to provide default +# value. By we need to know if files were specified by the user. +ac_need_defaults=: +while test $# != 0 +do + case $1 in + --*=*) + ac_option=`expr "X$1" : 'X\([^=]*\)='` + ac_optarg=`expr "X$1" : 'X[^=]*=\(.*\)'` + ac_shift=: + ;; + *) + ac_option=$1 + ac_optarg=$2 + ac_shift=shift + ;; + esac + + case $ac_option in + # Handling of the options. + -recheck | --recheck | --rechec | --reche | --rech | --rec | --re | --r) + ac_cs_recheck=: ;; + --version | --versio | --versi | --vers | --ver | --ve | --v | -V ) + echo "$ac_cs_version"; exit ;; + --debug | --debu | --deb | --de | --d | -d ) + debug=: ;; + --file | --fil | --fi | --f ) + $ac_shift + CONFIG_FILES="$CONFIG_FILES $ac_optarg" + ac_need_defaults=false;; + --header | --heade | --head | --hea ) + $ac_shift + CONFIG_HEADERS="$CONFIG_HEADERS $ac_optarg" + ac_need_defaults=false;; + --he | --h) + # Conflict between --help and --header + { echo "$as_me: error: ambiguous option: $1 +Try \`$0 --help' for more information." >&2 + { (exit 1); exit 1; }; };; + --help | --hel | -h ) + echo "$ac_cs_usage"; exit ;; + -q | -quiet | --quiet | --quie | --qui | --qu | --q \ + | -silent | --silent | --silen | --sile | --sil | --si | --s) + ac_cs_silent=: ;; + + # This is an error. + -*) { echo "$as_me: error: unrecognized option: $1 +Try \`$0 --help' for more information." >&2 + { (exit 1); exit 1; }; } ;; + + *) ac_config_targets="$ac_config_targets $1" + ac_need_defaults=false ;; + + esac + shift +done + +ac_configure_extra_args= + +if $ac_cs_silent; then + exec 6>/dev/null + ac_configure_extra_args="$ac_configure_extra_args --silent" +fi + +_ACEOF +cat >>$CONFIG_STATUS <<_ACEOF +if \$ac_cs_recheck; then + echo "running CONFIG_SHELL=$SHELL $SHELL $0 "$ac_configure_args \$ac_configure_extra_args " --no-create --no-recursion" >&6 + CONFIG_SHELL=$SHELL + export CONFIG_SHELL + exec $SHELL "$0"$ac_configure_args \$ac_configure_extra_args --no-create --no-recursion +fi + +_ACEOF +cat >>$CONFIG_STATUS <<\_ACEOF +exec 5>>config.log +{ + echo + sed 'h;s/./-/g;s/^.../## /;s/...$/ ##/;p;x;p;x' <<_ASBOX +## Running $as_me. ## +_ASBOX + echo "$ac_log" +} >&5 + +_ACEOF +cat >>$CONFIG_STATUS <<_ACEOF +# +# INIT-COMMANDS +# +AMDEP_TRUE="$AMDEP_TRUE" ac_aux_dir="$ac_aux_dir" + +_ACEOF + +cat >>$CONFIG_STATUS <<\_ACEOF + +# Handling of arguments. +for ac_config_target in $ac_config_targets +do + case $ac_config_target in + "config.h") CONFIG_HEADERS="$CONFIG_HEADERS config.h" ;; + "depfiles") CONFIG_COMMANDS="$CONFIG_COMMANDS depfiles" ;; + "Makefile") CONFIG_FILES="$CONFIG_FILES Makefile" ;; + "doc/Makefile") CONFIG_FILES="$CONFIG_FILES doc/Makefile" ;; + "m4/Makefile") CONFIG_FILES="$CONFIG_FILES m4/Makefile" ;; + "src/Makefile") CONFIG_FILES="$CONFIG_FILES src/Makefile" ;; + "src/libfastx/Makefile") CONFIG_FILES="$CONFIG_FILES src/libfastx/Makefile" ;; + "src/fastx_clipper/Makefile") CONFIG_FILES="$CONFIG_FILES src/fastx_clipper/Makefile" ;; + "src/fastq_to_fasta/Makefile") CONFIG_FILES="$CONFIG_FILES src/fastq_to_fasta/Makefile" ;; + "src/fastx_quality_stats/Makefile") CONFIG_FILES="$CONFIG_FILES src/fastx_quality_stats/Makefile" ;; + "src/fastq_quality_converter/Makefile") CONFIG_FILES="$CONFIG_FILES src/fastq_quality_converter/Makefile" ;; + "src/fastx_trimmer/Makefile") CONFIG_FILES="$CONFIG_FILES src/fastx_trimmer/Makefile" ;; + "src/fastq_quality_filter/Makefile") CONFIG_FILES="$CONFIG_FILES src/fastq_quality_filter/Makefile" ;; + "src/fastx_artifacts_filter/Makefile") CONFIG_FILES="$CONFIG_FILES src/fastx_artifacts_filter/Makefile" ;; + "src/fastx_reverse_complement/Makefile") CONFIG_FILES="$CONFIG_FILES src/fastx_reverse_complement/Makefile" ;; + "src/fastx_collapser/Makefile") CONFIG_FILES="$CONFIG_FILES src/fastx_collapser/Makefile" ;; + "src/seqalign_test/Makefile") CONFIG_FILES="$CONFIG_FILES src/seqalign_test/Makefile" ;; + "galaxy/Makefile") CONFIG_FILES="$CONFIG_FILES galaxy/Makefile" ;; + "galaxy/tools/Makefile") CONFIG_FILES="$CONFIG_FILES galaxy/tools/Makefile" ;; + "galaxy/tools/fastx_toolkit/Makefile") CONFIG_FILES="$CONFIG_FILES galaxy/tools/fastx_toolkit/Makefile" ;; + "galaxy/tools/fastx_toolkit_with_gzip_and_output_label/Makefile") CONFIG_FILES="$CONFIG_FILES galaxy/tools/fastx_toolkit_with_gzip_and_output_label/Makefile" ;; + "galaxy/test-data/Makefile") CONFIG_FILES="$CONFIG_FILES galaxy/test-data/Makefile" ;; + "galaxy/static/Makefile") CONFIG_FILES="$CONFIG_FILES galaxy/static/Makefile" ;; + "galaxy/static/fastx_icons/Makefile") CONFIG_FILES="$CONFIG_FILES galaxy/static/fastx_icons/Makefile" ;; + "galaxy/tool-data/Makefile") CONFIG_FILES="$CONFIG_FILES galaxy/tool-data/Makefile" ;; + "scripts/Makefile") CONFIG_FILES="$CONFIG_FILES scripts/Makefile" ;; + + *) { { echo "$as_me:$LINENO: error: invalid argument: $ac_config_target" >&5 +echo "$as_me: error: invalid argument: $ac_config_target" >&2;} + { (exit 1); exit 1; }; };; + esac +done + + +# If the user did not use the arguments to specify the items to instantiate, +# then the envvar interface is used. Set only those that are not. +# We use the long form for the default assignment because of an extremely +# bizarre bug on SunOS 4.1.3. +if $ac_need_defaults; then + test "${CONFIG_FILES+set}" = set || CONFIG_FILES=$config_files + test "${CONFIG_HEADERS+set}" = set || CONFIG_HEADERS=$config_headers + test "${CONFIG_COMMANDS+set}" = set || CONFIG_COMMANDS=$config_commands +fi + +# Have a temporary directory for convenience. Make it in the build tree +# simply because there is no reason against having it here, and in addition, +# creating and moving files from /tmp can sometimes cause problems. +# Hook for its removal unless debugging. +# Note that there is a small window in which the directory will not be cleaned: +# after its creation but before its name has been assigned to `$tmp'. +$debug || +{ + tmp= + trap 'exit_status=$? + { test -z "$tmp" || test ! -d "$tmp" || rm -fr "$tmp"; } && exit $exit_status +' 0 + trap '{ (exit 1); exit 1; }' 1 2 13 15 +} +# Create a (secure) tmp directory for tmp files. + +{ + tmp=`(umask 077 && mktemp -d "./confXXXXXX") 2>/dev/null` && + test -n "$tmp" && test -d "$tmp" +} || +{ + tmp=./conf$$-$RANDOM + (umask 077 && mkdir "$tmp") +} || +{ + echo "$me: cannot create a temporary directory in ." >&2 + { (exit 1); exit 1; } +} + +# +# Set up the sed scripts for CONFIG_FILES section. +# + +# No need to generate the scripts if there are no CONFIG_FILES. +# This happens for instance when ./config.status config.h +if test -n "$CONFIG_FILES"; then + +_ACEOF + + + +ac_delim='%!_!# ' +for ac_last_try in false false false false false :; do + cat >conf$$subs.sed <<_ACEOF +SHELL!$SHELL$ac_delim +PATH_SEPARATOR!$PATH_SEPARATOR$ac_delim +PACKAGE_NAME!$PACKAGE_NAME$ac_delim +PACKAGE_TARNAME!$PACKAGE_TARNAME$ac_delim +PACKAGE_VERSION!$PACKAGE_VERSION$ac_delim +PACKAGE_STRING!$PACKAGE_STRING$ac_delim +PACKAGE_BUGREPORT!$PACKAGE_BUGREPORT$ac_delim +exec_prefix!$exec_prefix$ac_delim +prefix!$prefix$ac_delim +program_transform_name!$program_transform_name$ac_delim +bindir!$bindir$ac_delim +sbindir!$sbindir$ac_delim +libexecdir!$libexecdir$ac_delim +datarootdir!$datarootdir$ac_delim +datadir!$datadir$ac_delim +sysconfdir!$sysconfdir$ac_delim +sharedstatedir!$sharedstatedir$ac_delim +localstatedir!$localstatedir$ac_delim +includedir!$includedir$ac_delim +oldincludedir!$oldincludedir$ac_delim +docdir!$docdir$ac_delim +infodir!$infodir$ac_delim +htmldir!$htmldir$ac_delim +dvidir!$dvidir$ac_delim +pdfdir!$pdfdir$ac_delim +psdir!$psdir$ac_delim +libdir!$libdir$ac_delim +localedir!$localedir$ac_delim +mandir!$mandir$ac_delim +DEFS!$DEFS$ac_delim +ECHO_C!$ECHO_C$ac_delim +ECHO_N!$ECHO_N$ac_delim +ECHO_T!$ECHO_T$ac_delim +LIBS!$LIBS$ac_delim +build_alias!$build_alias$ac_delim +host_alias!$host_alias$ac_delim +target_alias!$target_alias$ac_delim +INSTALL_PROGRAM!$INSTALL_PROGRAM$ac_delim +INSTALL_SCRIPT!$INSTALL_SCRIPT$ac_delim +INSTALL_DATA!$INSTALL_DATA$ac_delim +am__isrc!$am__isrc$ac_delim +CYGPATH_W!$CYGPATH_W$ac_delim +PACKAGE!$PACKAGE$ac_delim +VERSION!$VERSION$ac_delim +ACLOCAL!$ACLOCAL$ac_delim +AUTOCONF!$AUTOCONF$ac_delim +AUTOMAKE!$AUTOMAKE$ac_delim +AUTOHEADER!$AUTOHEADER$ac_delim +MAKEINFO!$MAKEINFO$ac_delim +install_sh!$install_sh$ac_delim +STRIP!$STRIP$ac_delim +INSTALL_STRIP_PROGRAM!$INSTALL_STRIP_PROGRAM$ac_delim +mkdir_p!$mkdir_p$ac_delim +AWK!$AWK$ac_delim +SET_MAKE!$SET_MAKE$ac_delim +am__leading_dot!$am__leading_dot$ac_delim +AMTAR!$AMTAR$ac_delim +am__tar!$am__tar$ac_delim +am__untar!$am__untar$ac_delim +CC!$CC$ac_delim +CFLAGS!$CFLAGS$ac_delim +LDFLAGS!$LDFLAGS$ac_delim +CPPFLAGS!$CPPFLAGS$ac_delim +ac_ct_CC!$ac_ct_CC$ac_delim +EXEEXT!$EXEEXT$ac_delim +OBJEXT!$OBJEXT$ac_delim +DEPDIR!$DEPDIR$ac_delim +am__include!$am__include$ac_delim +am__quote!$am__quote$ac_delim +AMDEP_TRUE!$AMDEP_TRUE$ac_delim +AMDEP_FALSE!$AMDEP_FALSE$ac_delim +AMDEPBACKSLASH!$AMDEPBACKSLASH$ac_delim +CCDEPMODE!$CCDEPMODE$ac_delim +am__fastdepCC_TRUE!$am__fastdepCC_TRUE$ac_delim +am__fastdepCC_FALSE!$am__fastdepCC_FALSE$ac_delim +CPP!$CPP$ac_delim +GREP!$GREP$ac_delim +EGREP!$EGREP$ac_delim +CXX!$CXX$ac_delim +CXXFLAGS!$CXXFLAGS$ac_delim +ac_ct_CXX!$ac_ct_CXX$ac_delim +CXXDEPMODE!$CXXDEPMODE$ac_delim +am__fastdepCXX_TRUE!$am__fastdepCXX_TRUE$ac_delim +am__fastdepCXX_FALSE!$am__fastdepCXX_FALSE$ac_delim +CXXCPP!$CXXCPP$ac_delim +build!$build$ac_delim +build_cpu!$build_cpu$ac_delim +build_vendor!$build_vendor$ac_delim +build_os!$build_os$ac_delim +host!$host$ac_delim +host_cpu!$host_cpu$ac_delim +host_vendor!$host_vendor$ac_delim +host_os!$host_os$ac_delim +canonical_host_type!$canonical_host_type$ac_delim +RANLIB!$RANLIB$ac_delim +LIBOBJS!$LIBOBJS$ac_delim +LTLIBOBJS!$LTLIBOBJS$ac_delim +_ACEOF + + if test `sed -n "s/.*$ac_delim\$/X/p" conf$$subs.sed | grep -c X` = 97; then + break + elif $ac_last_try; then + { { echo "$as_me:$LINENO: error: could not make $CONFIG_STATUS" >&5 +echo "$as_me: error: could not make $CONFIG_STATUS" >&2;} + { (exit 1); exit 1; }; } + else + ac_delim="$ac_delim!$ac_delim _$ac_delim!! " + fi +done + +ac_eof=`sed -n '/^CEOF[0-9]*$/s/CEOF/0/p' conf$$subs.sed` +if test -n "$ac_eof"; then + ac_eof=`echo "$ac_eof" | sort -nru | sed 1q` + ac_eof=`expr $ac_eof + 1` +fi + +cat >>$CONFIG_STATUS <<_ACEOF +cat >"\$tmp/subs-1.sed" <<\CEOF$ac_eof +/@[a-zA-Z_][a-zA-Z_0-9]*@/!b +_ACEOF +sed ' +s/[,\\&]/\\&/g; s/@/@|#_!!_#|/g +s/^/s,@/; s/!/@,|#_!!_#|/ +:n +t n +s/'"$ac_delim"'$/,g/; t +s/$/\\/; p +N; s/^.*\n//; s/[,\\&]/\\&/g; s/@/@|#_!!_#|/g; b n +' >>$CONFIG_STATUS >$CONFIG_STATUS <<_ACEOF +CEOF$ac_eof +_ACEOF + + +# VPATH may cause trouble with some makes, so we remove $(srcdir), +# ${srcdir} and @srcdir@ from VPATH if srcdir is ".", strip leading and +# trailing colons and then remove the whole line if VPATH becomes empty +# (actually we leave an empty line to preserve line numbers). +if test "x$srcdir" = x.; then + ac_vpsub='/^[ ]*VPATH[ ]*=/{ +s/:*\$(srcdir):*/:/ +s/:*\${srcdir}:*/:/ +s/:*@srcdir@:*/:/ +s/^\([^=]*=[ ]*\):*/\1/ +s/:*$// +s/^[^=]*=[ ]*$// +}' +fi + +cat >>$CONFIG_STATUS <<\_ACEOF +fi # test -n "$CONFIG_FILES" + + +for ac_tag in :F $CONFIG_FILES :H $CONFIG_HEADERS :C $CONFIG_COMMANDS +do + case $ac_tag in + :[FHLC]) ac_mode=$ac_tag; continue;; + esac + case $ac_mode$ac_tag in + :[FHL]*:*);; + :L* | :C*:*) { { echo "$as_me:$LINENO: error: Invalid tag $ac_tag." >&5 +echo "$as_me: error: Invalid tag $ac_tag." >&2;} + { (exit 1); exit 1; }; };; + :[FH]-) ac_tag=-:-;; + :[FH]*) ac_tag=$ac_tag:$ac_tag.in;; + esac + ac_save_IFS=$IFS + IFS=: + set x $ac_tag + IFS=$ac_save_IFS + shift + ac_file=$1 + shift + + case $ac_mode in + :L) ac_source=$1;; + :[FH]) + ac_file_inputs= + for ac_f + do + case $ac_f in + -) ac_f="$tmp/stdin";; + *) # Look for the file first in the build tree, then in the source tree + # (if the path is not absolute). The absolute path cannot be DOS-style, + # because $ac_f cannot contain `:'. + test -f "$ac_f" || + case $ac_f in + [\\/$]*) false;; + *) test -f "$srcdir/$ac_f" && ac_f="$srcdir/$ac_f";; + esac || + { { echo "$as_me:$LINENO: error: cannot find input file: $ac_f" >&5 +echo "$as_me: error: cannot find input file: $ac_f" >&2;} + { (exit 1); exit 1; }; };; + esac + ac_file_inputs="$ac_file_inputs $ac_f" + done + + # Let's still pretend it is `configure' which instantiates (i.e., don't + # use $as_me), people would be surprised to read: + # /* config.h. Generated by config.status. */ + configure_input="Generated from "`IFS=: + echo $* | sed 's|^[^:]*/||;s|:[^:]*/|, |g'`" by configure." + if test x"$ac_file" != x-; then + configure_input="$ac_file. $configure_input" + { echo "$as_me:$LINENO: creating $ac_file" >&5 +echo "$as_me: creating $ac_file" >&6;} + fi + + case $ac_tag in + *:-:* | *:-) cat >"$tmp/stdin";; + esac + ;; + esac + + ac_dir=`$as_dirname -- "$ac_file" || +$as_expr X"$ac_file" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \ + X"$ac_file" : 'X\(//\)[^/]' \| \ + X"$ac_file" : 'X\(//\)$' \| \ + X"$ac_file" : 'X\(/\)' \| . 2>/dev/null || +echo X"$ac_file" | + sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{ + s//\1/ + q + } + /^X\(\/\/\)[^/].*/{ + s//\1/ + q + } + /^X\(\/\/\)$/{ + s//\1/ + q + } + /^X\(\/\).*/{ + s//\1/ + q + } + s/.*/./; q'` + { as_dir="$ac_dir" + case $as_dir in #( + -*) as_dir=./$as_dir;; + esac + test -d "$as_dir" || { $as_mkdir_p && mkdir -p "$as_dir"; } || { + as_dirs= + while :; do + case $as_dir in #( + *\'*) as_qdir=`echo "$as_dir" | sed "s/'/'\\\\\\\\''/g"`;; #( + *) as_qdir=$as_dir;; + esac + as_dirs="'$as_qdir' $as_dirs" + as_dir=`$as_dirname -- "$as_dir" || +$as_expr X"$as_dir" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \ + X"$as_dir" : 'X\(//\)[^/]' \| \ + X"$as_dir" : 'X\(//\)$' \| \ + X"$as_dir" : 'X\(/\)' \| . 2>/dev/null || +echo X"$as_dir" | + sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{ + s//\1/ + q + } + /^X\(\/\/\)[^/].*/{ + s//\1/ + q + } + /^X\(\/\/\)$/{ + s//\1/ + q + } + /^X\(\/\).*/{ + s//\1/ + q + } + s/.*/./; q'` + test -d "$as_dir" && break + done + test -z "$as_dirs" || eval "mkdir $as_dirs" + } || test -d "$as_dir" || { { echo "$as_me:$LINENO: error: cannot create directory $as_dir" >&5 +echo "$as_me: error: cannot create directory $as_dir" >&2;} + { (exit 1); exit 1; }; }; } + ac_builddir=. + +case "$ac_dir" in +.) ac_dir_suffix= ac_top_builddir_sub=. ac_top_build_prefix= ;; +*) + ac_dir_suffix=/`echo "$ac_dir" | sed 's,^\.[\\/],,'` + # A ".." for each directory in $ac_dir_suffix. + ac_top_builddir_sub=`echo "$ac_dir_suffix" | sed 's,/[^\\/]*,/..,g;s,/,,'` + case $ac_top_builddir_sub in + "") ac_top_builddir_sub=. ac_top_build_prefix= ;; + *) ac_top_build_prefix=$ac_top_builddir_sub/ ;; + esac ;; +esac +ac_abs_top_builddir=$ac_pwd +ac_abs_builddir=$ac_pwd$ac_dir_suffix +# for backward compatibility: +ac_top_builddir=$ac_top_build_prefix + +case $srcdir in + .) # We are building in place. + ac_srcdir=. + ac_top_srcdir=$ac_top_builddir_sub + ac_abs_top_srcdir=$ac_pwd ;; + [\\/]* | ?:[\\/]* ) # Absolute name. + ac_srcdir=$srcdir$ac_dir_suffix; + ac_top_srcdir=$srcdir + ac_abs_top_srcdir=$srcdir ;; + *) # Relative name. + ac_srcdir=$ac_top_build_prefix$srcdir$ac_dir_suffix + ac_top_srcdir=$ac_top_build_prefix$srcdir + ac_abs_top_srcdir=$ac_pwd/$srcdir ;; +esac +ac_abs_srcdir=$ac_abs_top_srcdir$ac_dir_suffix + + + case $ac_mode in + :F) + # + # CONFIG_FILE + # + + case $INSTALL in + [\\/$]* | ?:[\\/]* ) ac_INSTALL=$INSTALL ;; + *) ac_INSTALL=$ac_top_build_prefix$INSTALL ;; + esac + ac_MKDIR_P=$MKDIR_P + case $MKDIR_P in + [\\/$]* | ?:[\\/]* ) ;; + */*) ac_MKDIR_P=$ac_top_build_prefix$MKDIR_P ;; + esac +_ACEOF + +cat >>$CONFIG_STATUS <<\_ACEOF +# If the template does not know about datarootdir, expand it. +# FIXME: This hack should be removed a few years after 2.60. +ac_datarootdir_hack=; ac_datarootdir_seen= + +case `sed -n '/datarootdir/ { + p + q +} +/@datadir@/p +/@docdir@/p +/@infodir@/p +/@localedir@/p +/@mandir@/p +' $ac_file_inputs` in +*datarootdir*) ac_datarootdir_seen=yes;; +*@datadir@*|*@docdir@*|*@infodir@*|*@localedir@*|*@mandir@*) + { echo "$as_me:$LINENO: WARNING: $ac_file_inputs seems to ignore the --datarootdir setting" >&5 +echo "$as_me: WARNING: $ac_file_inputs seems to ignore the --datarootdir setting" >&2;} +_ACEOF +cat >>$CONFIG_STATUS <<_ACEOF + ac_datarootdir_hack=' + s&@datadir@&$datadir&g + s&@docdir@&$docdir&g + s&@infodir@&$infodir&g + s&@localedir@&$localedir&g + s&@mandir@&$mandir&g + s&\\\${datarootdir}&$datarootdir&g' ;; +esac +_ACEOF + +# Neutralize VPATH when `$srcdir' = `.'. +# Shell code in configure.ac might set extrasub. +# FIXME: do we really want to maintain this feature? +cat >>$CONFIG_STATUS <<_ACEOF + sed "$ac_vpsub +$extrasub +_ACEOF +cat >>$CONFIG_STATUS <<\_ACEOF +:t +/@[a-zA-Z_][a-zA-Z_0-9]*@/!b +s&@configure_input@&$configure_input&;t t +s&@top_builddir@&$ac_top_builddir_sub&;t t +s&@srcdir@&$ac_srcdir&;t t +s&@abs_srcdir@&$ac_abs_srcdir&;t t +s&@top_srcdir@&$ac_top_srcdir&;t t +s&@abs_top_srcdir@&$ac_abs_top_srcdir&;t t +s&@builddir@&$ac_builddir&;t t +s&@abs_builddir@&$ac_abs_builddir&;t t +s&@abs_top_builddir@&$ac_abs_top_builddir&;t t +s&@INSTALL@&$ac_INSTALL&;t t +s&@MKDIR_P@&$ac_MKDIR_P&;t t +$ac_datarootdir_hack +" $ac_file_inputs | sed -f "$tmp/subs-1.sed" | sed 's/|#_!!_#|//g' >$tmp/out + +test -z "$ac_datarootdir_hack$ac_datarootdir_seen" && + { ac_out=`sed -n '/\${datarootdir}/p' "$tmp/out"`; test -n "$ac_out"; } && + { ac_out=`sed -n '/^[ ]*datarootdir[ ]*:*=/p' "$tmp/out"`; test -z "$ac_out"; } && + { echo "$as_me:$LINENO: WARNING: $ac_file contains a reference to the variable \`datarootdir' +which seems to be undefined. Please make sure it is defined." >&5 +echo "$as_me: WARNING: $ac_file contains a reference to the variable \`datarootdir' +which seems to be undefined. Please make sure it is defined." >&2;} + + rm -f "$tmp/stdin" + case $ac_file in + -) cat "$tmp/out"; rm -f "$tmp/out";; + *) rm -f "$ac_file"; mv "$tmp/out" $ac_file;; + esac + ;; + :H) + # + # CONFIG_HEADER + # +_ACEOF + +# Transform confdefs.h into a sed script `conftest.defines', that +# substitutes the proper values into config.h.in to produce config.h. +rm -f conftest.defines conftest.tail +# First, append a space to every undef/define line, to ease matching. +echo 's/$/ /' >conftest.defines +# Then, protect against being on the right side of a sed subst, or in +# an unquoted here document, in config.status. If some macros were +# called several times there might be several #defines for the same +# symbol, which is useless. But do not sort them, since the last +# AC_DEFINE must be honored. +ac_word_re=[_$as_cr_Letters][_$as_cr_alnum]* +# These sed commands are passed to sed as "A NAME B PARAMS C VALUE D", where +# NAME is the cpp macro being defined, VALUE is the value it is being given. +# PARAMS is the parameter list in the macro definition--in most cases, it's +# just an empty string. +ac_dA='s,^\\([ #]*\\)[^ ]*\\([ ]*' +ac_dB='\\)[ (].*,\\1define\\2' +ac_dC=' ' +ac_dD=' ,' + +uniq confdefs.h | + sed -n ' + t rset + :rset + s/^[ ]*#[ ]*define[ ][ ]*// + t ok + d + :ok + s/[\\&,]/\\&/g + s/^\('"$ac_word_re"'\)\(([^()]*)\)[ ]*\(.*\)/ '"$ac_dA"'\1'"$ac_dB"'\2'"${ac_dC}"'\3'"$ac_dD"'/p + s/^\('"$ac_word_re"'\)[ ]*\(.*\)/'"$ac_dA"'\1'"$ac_dB$ac_dC"'\2'"$ac_dD"'/p + ' >>conftest.defines + +# Remove the space that was appended to ease matching. +# Then replace #undef with comments. This is necessary, for +# example, in the case of _POSIX_SOURCE, which is predefined and required +# on some systems where configure will not decide to define it. +# (The regexp can be short, since the line contains either #define or #undef.) +echo 's/ $// +s,^[ #]*u.*,/* & */,' >>conftest.defines + +# Break up conftest.defines: +ac_max_sed_lines=50 + +# First sed command is: sed -f defines.sed $ac_file_inputs >"$tmp/out1" +# Second one is: sed -f defines.sed "$tmp/out1" >"$tmp/out2" +# Third one will be: sed -f defines.sed "$tmp/out2" >"$tmp/out1" +# et cetera. +ac_in='$ac_file_inputs' +ac_out='"$tmp/out1"' +ac_nxt='"$tmp/out2"' + +while : +do + # Write a here document: + cat >>$CONFIG_STATUS <<_ACEOF + # First, check the format of the line: + cat >"\$tmp/defines.sed" <<\\CEOF +/^[ ]*#[ ]*undef[ ][ ]*$ac_word_re[ ]*\$/b def +/^[ ]*#[ ]*define[ ][ ]*$ac_word_re[( ]/b def +b +:def +_ACEOF + sed ${ac_max_sed_lines}q conftest.defines >>$CONFIG_STATUS + echo 'CEOF + sed -f "$tmp/defines.sed"' "$ac_in >$ac_out" >>$CONFIG_STATUS + ac_in=$ac_out; ac_out=$ac_nxt; ac_nxt=$ac_in + sed 1,${ac_max_sed_lines}d conftest.defines >conftest.tail + grep . conftest.tail >/dev/null || break + rm -f conftest.defines + mv conftest.tail conftest.defines +done +rm -f conftest.defines conftest.tail + +echo "ac_result=$ac_in" >>$CONFIG_STATUS +cat >>$CONFIG_STATUS <<\_ACEOF + if test x"$ac_file" != x-; then + echo "/* $configure_input */" >"$tmp/config.h" + cat "$ac_result" >>"$tmp/config.h" + if diff $ac_file "$tmp/config.h" >/dev/null 2>&1; then + { echo "$as_me:$LINENO: $ac_file is unchanged" >&5 +echo "$as_me: $ac_file is unchanged" >&6;} + else + rm -f $ac_file + mv "$tmp/config.h" $ac_file + fi + else + echo "/* $configure_input */" + cat "$ac_result" + fi + rm -f "$tmp/out12" +# Compute $ac_file's index in $config_headers. +_am_arg=$ac_file +_am_stamp_count=1 +for _am_header in $config_headers :; do + case $_am_header in + $_am_arg | $_am_arg:* ) + break ;; + * ) + _am_stamp_count=`expr $_am_stamp_count + 1` ;; + esac +done +echo "timestamp for $_am_arg" >`$as_dirname -- "$_am_arg" || +$as_expr X"$_am_arg" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \ + X"$_am_arg" : 'X\(//\)[^/]' \| \ + X"$_am_arg" : 'X\(//\)$' \| \ + X"$_am_arg" : 'X\(/\)' \| . 2>/dev/null || +echo X"$_am_arg" | + sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{ + s//\1/ + q + } + /^X\(\/\/\)[^/].*/{ + s//\1/ + q + } + /^X\(\/\/\)$/{ + s//\1/ + q + } + /^X\(\/\).*/{ + s//\1/ + q + } + s/.*/./; q'`/stamp-h$_am_stamp_count + ;; + + :C) { echo "$as_me:$LINENO: executing $ac_file commands" >&5 +echo "$as_me: executing $ac_file commands" >&6;} + ;; + esac + + + case $ac_file$ac_mode in + "depfiles":C) test x"$AMDEP_TRUE" != x"" || for mf in $CONFIG_FILES; do + # Strip MF so we end up with the name of the file. + mf=`echo "$mf" | sed -e 's/:.*$//'` + # Check whether this is an Automake generated Makefile or not. + # We used to match only the files named `Makefile.in', but + # some people rename them; so instead we look at the file content. + # Grep'ing the first line is not enough: some people post-process + # each Makefile.in and add a new line on top of each file to say so. + # Grep'ing the whole file is not good either: AIX grep has a line + # limit of 2048, but all sed's we know have understand at least 4000. + if sed -n 's,^#.*generated by automake.*,X,p' "$mf" | grep X >/dev/null 2>&1; then + dirpart=`$as_dirname -- "$mf" || +$as_expr X"$mf" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \ + X"$mf" : 'X\(//\)[^/]' \| \ + X"$mf" : 'X\(//\)$' \| \ + X"$mf" : 'X\(/\)' \| . 2>/dev/null || +echo X"$mf" | + sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{ + s//\1/ + q + } + /^X\(\/\/\)[^/].*/{ + s//\1/ + q + } + /^X\(\/\/\)$/{ + s//\1/ + q + } + /^X\(\/\).*/{ + s//\1/ + q + } + s/.*/./; q'` + else + continue + fi + # Extract the definition of DEPDIR, am__include, and am__quote + # from the Makefile without running `make'. + DEPDIR=`sed -n 's/^DEPDIR = //p' < "$mf"` + test -z "$DEPDIR" && continue + am__include=`sed -n 's/^am__include = //p' < "$mf"` + test -z "am__include" && continue + am__quote=`sed -n 's/^am__quote = //p' < "$mf"` + # When using ansi2knr, U may be empty or an underscore; expand it + U=`sed -n 's/^U = //p' < "$mf"` + # Find all dependency output files, they are included files with + # $(DEPDIR) in their names. We invoke sed twice because it is the + # simplest approach to changing $(DEPDIR) to its actual value in the + # expansion. + for file in `sed -n " + s/^$am__include $am__quote\(.*(DEPDIR).*\)$am__quote"'$/\1/p' <"$mf" | \ + sed -e 's/\$(DEPDIR)/'"$DEPDIR"'/g' -e 's/\$U/'"$U"'/g'`; do + # Make sure the directory exists. + test -f "$dirpart/$file" && continue + fdir=`$as_dirname -- "$file" || +$as_expr X"$file" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \ + X"$file" : 'X\(//\)[^/]' \| \ + X"$file" : 'X\(//\)$' \| \ + X"$file" : 'X\(/\)' \| . 2>/dev/null || +echo X"$file" | + sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{ + s//\1/ + q + } + /^X\(\/\/\)[^/].*/{ + s//\1/ + q + } + /^X\(\/\/\)$/{ + s//\1/ + q + } + /^X\(\/\).*/{ + s//\1/ + q + } + s/.*/./; q'` + { as_dir=$dirpart/$fdir + case $as_dir in #( + -*) as_dir=./$as_dir;; + esac + test -d "$as_dir" || { $as_mkdir_p && mkdir -p "$as_dir"; } || { + as_dirs= + while :; do + case $as_dir in #( + *\'*) as_qdir=`echo "$as_dir" | sed "s/'/'\\\\\\\\''/g"`;; #( + *) as_qdir=$as_dir;; + esac + as_dirs="'$as_qdir' $as_dirs" + as_dir=`$as_dirname -- "$as_dir" || +$as_expr X"$as_dir" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \ + X"$as_dir" : 'X\(//\)[^/]' \| \ + X"$as_dir" : 'X\(//\)$' \| \ + X"$as_dir" : 'X\(/\)' \| . 2>/dev/null || +echo X"$as_dir" | + sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{ + s//\1/ + q + } + /^X\(\/\/\)[^/].*/{ + s//\1/ + q + } + /^X\(\/\/\)$/{ + s//\1/ + q + } + /^X\(\/\).*/{ + s//\1/ + q + } + s/.*/./; q'` + test -d "$as_dir" && break + done + test -z "$as_dirs" || eval "mkdir $as_dirs" + } || test -d "$as_dir" || { { echo "$as_me:$LINENO: error: cannot create directory $as_dir" >&5 +echo "$as_me: error: cannot create directory $as_dir" >&2;} + { (exit 1); exit 1; }; }; } + # echo "creating $dirpart/$file" + echo '# dummy' > "$dirpart/$file" + done +done + ;; + + esac +done # for ac_tag + + +{ (exit 0); exit 0; } +_ACEOF +chmod +x $CONFIG_STATUS +ac_clean_files=$ac_clean_files_save + + +# configure is writing to config.log, and then calls config.status. +# config.status does its own redirection, appending to config.log. +# Unfortunately, on DOS this fails, as config.log is still kept open +# by configure, so config.status won't be able to write to it; its +# output is simply discarded. So we exec the FD to /dev/null, +# effectively closing config.log, so it can be properly (re)opened and +# appended to by config.status. When coming back to configure, we +# need to make the FD available again. +if test "$no_create" != yes; then + ac_cs_success=: + ac_config_status_args= + test "$silent" = yes && + ac_config_status_args="$ac_config_status_args --quiet" + exec 5>/dev/null + $SHELL $CONFIG_STATUS $ac_config_status_args || ac_cs_success=false + exec 5>>config.log + # Use ||, not &&, to avoid exiting from the if with $? = 1, which + # would make configure fail if this is the last instruction. + $ac_cs_success || { (exit 1); exit 1; } +fi + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/configure.ac --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/configure.ac Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,92 @@ +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +AC_INIT([FASTX Toolkit], + [0.0.6], + [Assaf Gordon gordon@cshl.edu], + [fastx_toolkit]) +AC_CONFIG_AUX_DIR(config) +AM_CONFIG_HEADER(config.h) +AM_INIT_AUTOMAKE([dist-bzip2]) + +# 23dec08, Gordon +# Only added those things because 'autoheader' was complaining... +AC_DEFINE([CXX_HAS_BUGGY_FOR_LOOPS], [], [Description]) +AC_DEFINE([CXX_HAS_NO_BOOL], [], [Description]) +AC_DEFINE([NDEBUG], [], [Description]) +AC_DEFINE([YOUR_OS], [], [Description]) + +dnl --enable-wall +EXTRA_CHECKS="-Wall -Wextra -Wformat-nonliteral -Wformat-security -Wswitch-default -Wswitch-enum -Wunused-parameter -Wfloat-equal -Werror" +AC_ARG_ENABLE(wall, +[ --enable-wall Enable many common GCC warnings (-Wall,-Wextra, -Werror etc., default enabled)], +[case "${enableval}" in + yes) wall=true ;; + no) wall=false ;; + *) AC_MSG_ERROR(bad value ${enableval} for --enable-wall) ;; +esac],[wall=true]) +if test "$wall" = "true" +then + CFLAGS="${CFLAGS} ${EXTRA_CHECKS}" + CXXFLAGS="${CXXFLAGS} ${EXTRA_CHECKS}" +fi + +dnl --enable-debug +AC_ARG_ENABLE(debug, +[ --enable-debug Enable debug mode (default enabled)], +[case "${enableval}" in + yes) debug=true ;; + no) debug=false ;; + *) AC_MSG_ERROR(bad value ${enableval} for --enable-debug) ;; +esac],[debug=true]) +if test "$debug" = "true" +then + CFLAGS="${CFLAGS} -DDEBUG -g -O1" + CXXFLAGS="${CFLAGS} -DDEBUG -g -O1" +else + CFLAGS="${CFLAGS} -O3" + CXXFLAGS="${CFLAGS} -O3" +fi + + +LF_CONFIGURE_CC +LF_CONFIGURE_CXX +LF_HOST_TYPE +LF_SET_WARNINGS +AC_PROG_RANLIB + +AC_CONFIG_FILES([ + Makefile + doc/Makefile + m4/Makefile + src/Makefile + src/libfastx/Makefile + src/fastx_clipper/Makefile + src/fastq_to_fasta/Makefile + src/fastx_quality_stats/Makefile + src/fastq_quality_converter/Makefile + src/fastx_trimmer/Makefile + src/fastq_quality_filter/Makefile + src/fastx_artifacts_filter/Makefile + src/fastx_reverse_complement/Makefile + src/fastx_collapser/Makefile + src/seqalign_test/Makefile + galaxy/Makefile + galaxy/tools/Makefile + galaxy/tools/fastx_toolkit/Makefile + galaxy/tools/fastx_toolkit_with_gzip_and_output_label/Makefile + galaxy/test-data/Makefile + galaxy/static/Makefile + galaxy/static/fastx_icons/Makefile + galaxy/tool-data/Makefile + scripts/Makefile +]) + +AC_OUTPUT diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/doc/Makefile.am --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/doc/Makefile.am Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,10 @@ +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/doc/Makefile.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/doc/Makefile.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,316 @@ +# Makefile.in generated by automake 1.10.1 from Makefile.am. +# @configure_input@ + +# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, +# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This Makefile.in is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +@SET_MAKE@ + +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. +VPATH = @srcdir@ +pkgdatadir = $(datadir)/@PACKAGE@ +pkglibdir = $(libdir)/@PACKAGE@ +pkgincludedir = $(includedir)/@PACKAGE@ +am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd +install_sh_DATA = $(install_sh) -c -m 644 +install_sh_PROGRAM = $(install_sh) -c +install_sh_SCRIPT = $(install_sh) -c +INSTALL_HEADER = $(INSTALL_DATA) +transform = $(program_transform_name) +NORMAL_INSTALL = : +PRE_INSTALL = : +POST_INSTALL = : +NORMAL_UNINSTALL = : +PRE_UNINSTALL = : +POST_UNINSTALL = : +build_triplet = @build@ +host_triplet = @host@ +subdir = doc +DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in +ACLOCAL_M4 = $(top_srcdir)/aclocal.m4 +am__aclocal_m4_deps = $(top_srcdir)/configure.ac +am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \ + $(ACLOCAL_M4) +mkinstalldirs = $(install_sh) -d +CONFIG_HEADER = $(top_builddir)/config.h +CONFIG_CLEAN_FILES = +SOURCES = +DIST_SOURCES = +DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST) +ACLOCAL = @ACLOCAL@ +AMTAR = @AMTAR@ +AUTOCONF = @AUTOCONF@ +AUTOHEADER = @AUTOHEADER@ +AUTOMAKE = @AUTOMAKE@ +AWK = @AWK@ +CC = @CC@ +CCDEPMODE = @CCDEPMODE@ +CFLAGS = @CFLAGS@ +CPP = @CPP@ +CPPFLAGS = @CPPFLAGS@ +CXX = @CXX@ +CXXCPP = @CXXCPP@ +CXXDEPMODE = @CXXDEPMODE@ +CXXFLAGS = @CXXFLAGS@ +CYGPATH_W = @CYGPATH_W@ +DEFS = @DEFS@ +DEPDIR = @DEPDIR@ +ECHO_C = @ECHO_C@ +ECHO_N = @ECHO_N@ +ECHO_T = @ECHO_T@ +EGREP = @EGREP@ +EXEEXT = @EXEEXT@ +GREP = @GREP@ +INSTALL = @INSTALL@ +INSTALL_DATA = @INSTALL_DATA@ +INSTALL_PROGRAM = @INSTALL_PROGRAM@ +INSTALL_SCRIPT = @INSTALL_SCRIPT@ +INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@ +LDFLAGS = @LDFLAGS@ +LIBOBJS = @LIBOBJS@ +LIBS = @LIBS@ +LTLIBOBJS = @LTLIBOBJS@ +MAKEINFO = @MAKEINFO@ +MKDIR_P = @MKDIR_P@ +OBJEXT = @OBJEXT@ +PACKAGE = @PACKAGE@ +PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@ +PACKAGE_NAME = @PACKAGE_NAME@ +PACKAGE_STRING = @PACKAGE_STRING@ +PACKAGE_TARNAME = @PACKAGE_TARNAME@ +PACKAGE_VERSION = @PACKAGE_VERSION@ +PATH_SEPARATOR = @PATH_SEPARATOR@ +RANLIB = @RANLIB@ +SET_MAKE = @SET_MAKE@ +SHELL = @SHELL@ +STRIP = @STRIP@ +VERSION = @VERSION@ +abs_builddir = @abs_builddir@ +abs_srcdir = @abs_srcdir@ +abs_top_builddir = @abs_top_builddir@ +abs_top_srcdir = @abs_top_srcdir@ +ac_ct_CC = @ac_ct_CC@ +ac_ct_CXX = @ac_ct_CXX@ +am__include = @am__include@ +am__leading_dot = @am__leading_dot@ +am__quote = @am__quote@ +am__tar = @am__tar@ +am__untar = @am__untar@ +bindir = @bindir@ +build = @build@ +build_alias = @build_alias@ +build_cpu = @build_cpu@ +build_os = @build_os@ +build_vendor = @build_vendor@ +builddir = @builddir@ +canonical_host_type = @canonical_host_type@ +datadir = @datadir@ +datarootdir = @datarootdir@ +docdir = @docdir@ +dvidir = @dvidir@ +exec_prefix = @exec_prefix@ +host = @host@ +host_alias = @host_alias@ +host_cpu = @host_cpu@ +host_os = @host_os@ +host_vendor = @host_vendor@ +htmldir = @htmldir@ +includedir = @includedir@ +infodir = @infodir@ +install_sh = @install_sh@ +libdir = @libdir@ +libexecdir = @libexecdir@ +localedir = @localedir@ +localstatedir = @localstatedir@ +mandir = @mandir@ +mkdir_p = @mkdir_p@ +oldincludedir = @oldincludedir@ +pdfdir = @pdfdir@ +prefix = @prefix@ +program_transform_name = @program_transform_name@ +psdir = @psdir@ +sbindir = @sbindir@ +sharedstatedir = @sharedstatedir@ +srcdir = @srcdir@ +sysconfdir = @sysconfdir@ +target_alias = @target_alias@ +top_builddir = @top_builddir@ +top_srcdir = @top_srcdir@ +all: all-am + +.SUFFIXES: +$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps) + @for dep in $?; do \ + case '$(am__configure_deps)' in \ + *$$dep*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh \ + && exit 0; \ + exit 1;; \ + esac; \ + done; \ + echo ' cd $(top_srcdir) && $(AUTOMAKE) --gnu doc/Makefile'; \ + cd $(top_srcdir) && \ + $(AUTOMAKE) --gnu doc/Makefile +.PRECIOUS: Makefile +Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status + @case '$?' in \ + *config.status*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \ + *) \ + echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \ + cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \ + esac; + +$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +$(top_srcdir)/configure: $(am__configure_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +$(ACLOCAL_M4): $(am__aclocal_m4_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +tags: TAGS +TAGS: + +ctags: CTAGS +CTAGS: + + +distdir: $(DISTFILES) + @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + list='$(DISTFILES)'; \ + dist_files=`for file in $$list; do echo $$file; done | \ + sed -e "s|^$$srcdirstrip/||;t" \ + -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \ + case $$dist_files in \ + */*) $(MKDIR_P) `echo "$$dist_files" | \ + sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \ + sort -u` ;; \ + esac; \ + for file in $$dist_files; do \ + if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \ + if test -d $$d/$$file; then \ + dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \ + if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \ + cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \ + fi; \ + cp -pR $$d/$$file $(distdir)$$dir || exit 1; \ + else \ + test -f $(distdir)/$$file \ + || cp -p $$d/$$file $(distdir)/$$file \ + || exit 1; \ + fi; \ + done +check-am: all-am +check: check-am +all-am: Makefile +installdirs: +install: install-am +install-exec: install-exec-am +install-data: install-data-am +uninstall: uninstall-am + +install-am: all-am + @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am + +installcheck: installcheck-am +install-strip: + $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \ + install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \ + `test -z '$(STRIP)' || \ + echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install +mostlyclean-generic: + +clean-generic: + +distclean-generic: + -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES) + +maintainer-clean-generic: + @echo "This command is intended for maintainers to use" + @echo "it deletes files that may require special tools to rebuild." +clean: clean-am + +clean-am: clean-generic mostlyclean-am + +distclean: distclean-am + -rm -f Makefile +distclean-am: clean-am distclean-generic + +dvi: dvi-am + +dvi-am: + +html: html-am + +info: info-am + +info-am: + +install-data-am: + +install-dvi: install-dvi-am + +install-exec-am: + +install-html: install-html-am + +install-info: install-info-am + +install-man: + +install-pdf: install-pdf-am + +install-ps: install-ps-am + +installcheck-am: + +maintainer-clean: maintainer-clean-am + -rm -f Makefile +maintainer-clean-am: distclean-am maintainer-clean-generic + +mostlyclean: mostlyclean-am + +mostlyclean-am: mostlyclean-generic + +pdf: pdf-am + +pdf-am: + +ps: ps-am + +ps-am: + +uninstall-am: + +.MAKE: install-am install-strip + +.PHONY: all all-am check check-am clean clean-generic distclean \ + distclean-generic distdir dvi dvi-am html html-am info info-am \ + install install-am install-data install-data-am install-dvi \ + install-dvi-am install-exec install-exec-am install-html \ + install-html-am install-info install-info-am install-man \ + install-pdf install-pdf-am install-ps install-ps-am \ + install-strip installcheck installcheck-am installdirs \ + maintainer-clean maintainer-clean-generic mostlyclean \ + mostlyclean-generic pdf pdf-am ps ps-am uninstall uninstall-am + +# Tell versions [3.59,3.63) of GNU make to not export all variables. +# Otherwise a system limit (for SysV at least) may be exceeded. +.NOEXPORT: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/Makefile.am --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/Makefile.am Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,13 @@ +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +SUBDIRS = tools test-data static tool-data + +EXTRA_DIST = README fastx_toolkit_conf.xml diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/Makefile.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/Makefile.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,476 @@ +# Makefile.in generated by automake 1.10.1 from Makefile.am. +# @configure_input@ + +# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, +# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This Makefile.in is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +@SET_MAKE@ + +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. +VPATH = @srcdir@ +pkgdatadir = $(datadir)/@PACKAGE@ +pkglibdir = $(libdir)/@PACKAGE@ +pkgincludedir = $(includedir)/@PACKAGE@ +am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd +install_sh_DATA = $(install_sh) -c -m 644 +install_sh_PROGRAM = $(install_sh) -c +install_sh_SCRIPT = $(install_sh) -c +INSTALL_HEADER = $(INSTALL_DATA) +transform = $(program_transform_name) +NORMAL_INSTALL = : +PRE_INSTALL = : +POST_INSTALL = : +NORMAL_UNINSTALL = : +PRE_UNINSTALL = : +POST_UNINSTALL = : +build_triplet = @build@ +host_triplet = @host@ +subdir = galaxy +DIST_COMMON = README $(srcdir)/Makefile.am $(srcdir)/Makefile.in +ACLOCAL_M4 = $(top_srcdir)/aclocal.m4 +am__aclocal_m4_deps = $(top_srcdir)/configure.ac +am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \ + $(ACLOCAL_M4) +mkinstalldirs = $(install_sh) -d +CONFIG_HEADER = $(top_builddir)/config.h +CONFIG_CLEAN_FILES = +SOURCES = +DIST_SOURCES = +RECURSIVE_TARGETS = all-recursive check-recursive dvi-recursive \ + html-recursive info-recursive install-data-recursive \ + install-dvi-recursive install-exec-recursive \ + install-html-recursive install-info-recursive \ + install-pdf-recursive install-ps-recursive install-recursive \ + installcheck-recursive installdirs-recursive pdf-recursive \ + ps-recursive uninstall-recursive +RECURSIVE_CLEAN_TARGETS = mostlyclean-recursive clean-recursive \ + distclean-recursive maintainer-clean-recursive +ETAGS = etags +CTAGS = ctags +DIST_SUBDIRS = $(SUBDIRS) +DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST) +ACLOCAL = @ACLOCAL@ +AMTAR = @AMTAR@ +AUTOCONF = @AUTOCONF@ +AUTOHEADER = @AUTOHEADER@ +AUTOMAKE = @AUTOMAKE@ +AWK = @AWK@ +CC = @CC@ +CCDEPMODE = @CCDEPMODE@ +CFLAGS = @CFLAGS@ +CPP = @CPP@ +CPPFLAGS = @CPPFLAGS@ +CXX = @CXX@ +CXXCPP = @CXXCPP@ +CXXDEPMODE = @CXXDEPMODE@ +CXXFLAGS = @CXXFLAGS@ +CYGPATH_W = @CYGPATH_W@ +DEFS = @DEFS@ +DEPDIR = @DEPDIR@ +ECHO_C = @ECHO_C@ +ECHO_N = @ECHO_N@ +ECHO_T = @ECHO_T@ +EGREP = @EGREP@ +EXEEXT = @EXEEXT@ +GREP = @GREP@ +INSTALL = @INSTALL@ +INSTALL_DATA = @INSTALL_DATA@ +INSTALL_PROGRAM = @INSTALL_PROGRAM@ +INSTALL_SCRIPT = @INSTALL_SCRIPT@ +INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@ +LDFLAGS = @LDFLAGS@ +LIBOBJS = @LIBOBJS@ +LIBS = @LIBS@ +LTLIBOBJS = @LTLIBOBJS@ +MAKEINFO = @MAKEINFO@ +MKDIR_P = @MKDIR_P@ +OBJEXT = @OBJEXT@ +PACKAGE = @PACKAGE@ +PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@ +PACKAGE_NAME = @PACKAGE_NAME@ +PACKAGE_STRING = @PACKAGE_STRING@ +PACKAGE_TARNAME = @PACKAGE_TARNAME@ +PACKAGE_VERSION = @PACKAGE_VERSION@ +PATH_SEPARATOR = @PATH_SEPARATOR@ +RANLIB = @RANLIB@ +SET_MAKE = @SET_MAKE@ +SHELL = @SHELL@ +STRIP = @STRIP@ +VERSION = @VERSION@ +abs_builddir = @abs_builddir@ +abs_srcdir = @abs_srcdir@ +abs_top_builddir = @abs_top_builddir@ +abs_top_srcdir = @abs_top_srcdir@ +ac_ct_CC = @ac_ct_CC@ +ac_ct_CXX = @ac_ct_CXX@ +am__include = @am__include@ +am__leading_dot = @am__leading_dot@ +am__quote = @am__quote@ +am__tar = @am__tar@ +am__untar = @am__untar@ +bindir = @bindir@ +build = @build@ +build_alias = @build_alias@ +build_cpu = @build_cpu@ +build_os = @build_os@ +build_vendor = @build_vendor@ +builddir = @builddir@ +canonical_host_type = @canonical_host_type@ +datadir = @datadir@ +datarootdir = @datarootdir@ +docdir = @docdir@ +dvidir = @dvidir@ +exec_prefix = @exec_prefix@ +host = @host@ +host_alias = @host_alias@ +host_cpu = @host_cpu@ +host_os = @host_os@ +host_vendor = @host_vendor@ +htmldir = @htmldir@ +includedir = @includedir@ +infodir = @infodir@ +install_sh = @install_sh@ +libdir = @libdir@ +libexecdir = @libexecdir@ +localedir = @localedir@ +localstatedir = @localstatedir@ +mandir = @mandir@ +mkdir_p = @mkdir_p@ +oldincludedir = @oldincludedir@ +pdfdir = @pdfdir@ +prefix = @prefix@ +program_transform_name = @program_transform_name@ +psdir = @psdir@ +sbindir = @sbindir@ +sharedstatedir = @sharedstatedir@ +srcdir = @srcdir@ +sysconfdir = @sysconfdir@ +target_alias = @target_alias@ +top_builddir = @top_builddir@ +top_srcdir = @top_srcdir@ +SUBDIRS = tools test-data static tool-data +EXTRA_DIST = README fastx_toolkit_conf.xml +all: all-recursive + +.SUFFIXES: +$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps) + @for dep in $?; do \ + case '$(am__configure_deps)' in \ + *$$dep*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh \ + && exit 0; \ + exit 1;; \ + esac; \ + done; \ + echo ' cd $(top_srcdir) && $(AUTOMAKE) --gnu galaxy/Makefile'; \ + cd $(top_srcdir) && \ + $(AUTOMAKE) --gnu galaxy/Makefile +.PRECIOUS: Makefile +Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status + @case '$?' in \ + *config.status*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \ + *) \ + echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \ + cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \ + esac; + +$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +$(top_srcdir)/configure: $(am__configure_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +$(ACLOCAL_M4): $(am__aclocal_m4_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +# This directory's subdirectories are mostly independent; you can cd +# into them and run `make' without going through this Makefile. +# To change the values of `make' variables: instead of editing Makefiles, +# (1) if the variable is set in `config.status', edit `config.status' +# (which will cause the Makefiles to be regenerated when you run `make'); +# (2) otherwise, pass the desired values on the `make' command line. +$(RECURSIVE_TARGETS): + @failcom='exit 1'; \ + for f in x $$MAKEFLAGS; do \ + case $$f in \ + *=* | --[!k]*);; \ + *k*) failcom='fail=yes';; \ + esac; \ + done; \ + dot_seen=no; \ + target=`echo $@ | sed s/-recursive//`; \ + list='$(SUBDIRS)'; for subdir in $$list; do \ + echo "Making $$target in $$subdir"; \ + if test "$$subdir" = "."; then \ + dot_seen=yes; \ + local_target="$$target-am"; \ + else \ + local_target="$$target"; \ + fi; \ + (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) $$local_target) \ + || eval $$failcom; \ + done; \ + if test "$$dot_seen" = "no"; then \ + $(MAKE) $(AM_MAKEFLAGS) "$$target-am" || exit 1; \ + fi; test -z "$$fail" + +$(RECURSIVE_CLEAN_TARGETS): + @failcom='exit 1'; \ + for f in x $$MAKEFLAGS; do \ + case $$f in \ + *=* | --[!k]*);; \ + *k*) failcom='fail=yes';; \ + esac; \ + done; \ + dot_seen=no; \ + case "$@" in \ + distclean-* | maintainer-clean-*) list='$(DIST_SUBDIRS)' ;; \ + *) list='$(SUBDIRS)' ;; \ + esac; \ + rev=''; for subdir in $$list; do \ + if test "$$subdir" = "."; then :; else \ + rev="$$subdir $$rev"; \ + fi; \ + done; \ + rev="$$rev ."; \ + target=`echo $@ | sed s/-recursive//`; \ + for subdir in $$rev; do \ + echo "Making $$target in $$subdir"; \ + if test "$$subdir" = "."; then \ + local_target="$$target-am"; \ + else \ + local_target="$$target"; \ + fi; \ + (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) $$local_target) \ + || eval $$failcom; \ + done && test -z "$$fail" +tags-recursive: + list='$(SUBDIRS)'; for subdir in $$list; do \ + test "$$subdir" = . || (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) tags); \ + done +ctags-recursive: + list='$(SUBDIRS)'; for subdir in $$list; do \ + test "$$subdir" = . || (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) ctags); \ + done + +ID: $(HEADERS) $(SOURCES) $(LISP) $(TAGS_FILES) + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonemtpy = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + mkid -fID $$unique +tags: TAGS + +TAGS: tags-recursive $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + here=`pwd`; \ + if ($(ETAGS) --etags-include --version) >/dev/null 2>&1; then \ + include_option=--etags-include; \ + empty_fix=.; \ + else \ + include_option=--include; \ + empty_fix=; \ + fi; \ + list='$(SUBDIRS)'; for subdir in $$list; do \ + if test "$$subdir" = .; then :; else \ + test ! -f $$subdir/TAGS || \ + tags="$$tags $$include_option=$$here/$$subdir/TAGS"; \ + fi; \ + done; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + if test -z "$(ETAGS_ARGS)$$tags$$unique"; then :; else \ + test -n "$$unique" || unique=$$empty_fix; \ + $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \ + $$tags $$unique; \ + fi +ctags: CTAGS +CTAGS: ctags-recursive $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + test -z "$(CTAGS_ARGS)$$tags$$unique" \ + || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \ + $$tags $$unique + +GTAGS: + here=`$(am__cd) $(top_builddir) && pwd` \ + && cd $(top_srcdir) \ + && gtags -i $(GTAGS_ARGS) $$here + +distclean-tags: + -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags + +distdir: $(DISTFILES) + @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + list='$(DISTFILES)'; \ + dist_files=`for file in $$list; do echo $$file; done | \ + sed -e "s|^$$srcdirstrip/||;t" \ + -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \ + case $$dist_files in \ + */*) $(MKDIR_P) `echo "$$dist_files" | \ + sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \ + sort -u` ;; \ + esac; \ + for file in $$dist_files; do \ + if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \ + if test -d $$d/$$file; then \ + dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \ + if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \ + cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \ + fi; \ + cp -pR $$d/$$file $(distdir)$$dir || exit 1; \ + else \ + test -f $(distdir)/$$file \ + || cp -p $$d/$$file $(distdir)/$$file \ + || exit 1; \ + fi; \ + done + list='$(DIST_SUBDIRS)'; for subdir in $$list; do \ + if test "$$subdir" = .; then :; else \ + test -d "$(distdir)/$$subdir" \ + || $(MKDIR_P) "$(distdir)/$$subdir" \ + || exit 1; \ + distdir=`$(am__cd) $(distdir) && pwd`; \ + top_distdir=`$(am__cd) $(top_distdir) && pwd`; \ + (cd $$subdir && \ + $(MAKE) $(AM_MAKEFLAGS) \ + top_distdir="$$top_distdir" \ + distdir="$$distdir/$$subdir" \ + am__remove_distdir=: \ + am__skip_length_check=: \ + distdir) \ + || exit 1; \ + fi; \ + done +check-am: all-am +check: check-recursive +all-am: Makefile +installdirs: installdirs-recursive +installdirs-am: +install: install-recursive +install-exec: install-exec-recursive +install-data: install-data-recursive +uninstall: uninstall-recursive + +install-am: all-am + @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am + +installcheck: installcheck-recursive +install-strip: + $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \ + install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \ + `test -z '$(STRIP)' || \ + echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install +mostlyclean-generic: + +clean-generic: + +distclean-generic: + -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES) + +maintainer-clean-generic: + @echo "This command is intended for maintainers to use" + @echo "it deletes files that may require special tools to rebuild." +clean: clean-recursive + +clean-am: clean-generic mostlyclean-am + +distclean: distclean-recursive + -rm -f Makefile +distclean-am: clean-am distclean-generic distclean-tags + +dvi: dvi-recursive + +dvi-am: + +html: html-recursive + +info: info-recursive + +info-am: + +install-data-am: + +install-dvi: install-dvi-recursive + +install-exec-am: + +install-html: install-html-recursive + +install-info: install-info-recursive + +install-man: + +install-pdf: install-pdf-recursive + +install-ps: install-ps-recursive + +installcheck-am: + +maintainer-clean: maintainer-clean-recursive + -rm -f Makefile +maintainer-clean-am: distclean-am maintainer-clean-generic + +mostlyclean: mostlyclean-recursive + +mostlyclean-am: mostlyclean-generic + +pdf: pdf-recursive + +pdf-am: + +ps: ps-recursive + +ps-am: + +uninstall-am: + +.MAKE: $(RECURSIVE_CLEAN_TARGETS) $(RECURSIVE_TARGETS) install-am \ + install-strip + +.PHONY: $(RECURSIVE_CLEAN_TARGETS) $(RECURSIVE_TARGETS) CTAGS GTAGS \ + all all-am check check-am clean clean-generic ctags \ + ctags-recursive distclean distclean-generic distclean-tags \ + distdir dvi dvi-am html html-am info info-am install \ + install-am install-data install-data-am install-dvi \ + install-dvi-am install-exec install-exec-am install-html \ + install-html-am install-info install-info-am install-man \ + install-pdf install-pdf-am install-ps install-ps-am \ + install-strip installcheck installcheck-am installdirs \ + installdirs-am maintainer-clean maintainer-clean-generic \ + mostlyclean mostlyclean-generic pdf pdf-am ps ps-am tags \ + tags-recursive uninstall uninstall-am + +# Tell versions [3.59,3.63) of GNU make to not export all variables. +# Otherwise a system limit (for SysV at least) may be exceeded. +.NOEXPORT: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/README --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/README Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,15 @@ +FASTX-Toolkit - Galaxy Files +============================ + +These files allows easy integration of the FASTX-toolkit tools in the +Galaxy framework. + +Installation +============ +See the README file. + +LICENSE +======= +All files under the 'galaxy' sub-directory are licensed under +Galaxy's license. see GALAXY-LICENSE file. +(The rest of the FASTX-Toolkit files are licensed under AGPLv3 or later). diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/fastx_toolkit_conf.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/fastx_toolkit_conf.xml Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,21 @@ +# +# Add the following sections to your Galaxy server's tool_conf.xml file. +# +
+ + + + +
+ +
+ + + + + + + + + +
diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/Makefile.am --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/static/Makefile.am Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,13 @@ +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +SUBDIRS = fastx_icons + + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/Makefile.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/static/Makefile.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,475 @@ +# Makefile.in generated by automake 1.10.1 from Makefile.am. +# @configure_input@ + +# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, +# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This Makefile.in is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +@SET_MAKE@ + +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. +VPATH = @srcdir@ +pkgdatadir = $(datadir)/@PACKAGE@ +pkglibdir = $(libdir)/@PACKAGE@ +pkgincludedir = $(includedir)/@PACKAGE@ +am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd +install_sh_DATA = $(install_sh) -c -m 644 +install_sh_PROGRAM = $(install_sh) -c +install_sh_SCRIPT = $(install_sh) -c +INSTALL_HEADER = $(INSTALL_DATA) +transform = $(program_transform_name) +NORMAL_INSTALL = : +PRE_INSTALL = : +POST_INSTALL = : +NORMAL_UNINSTALL = : +PRE_UNINSTALL = : +POST_UNINSTALL = : +build_triplet = @build@ +host_triplet = @host@ +subdir = galaxy/static +DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in +ACLOCAL_M4 = $(top_srcdir)/aclocal.m4 +am__aclocal_m4_deps = $(top_srcdir)/configure.ac +am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \ + $(ACLOCAL_M4) +mkinstalldirs = $(install_sh) -d +CONFIG_HEADER = $(top_builddir)/config.h +CONFIG_CLEAN_FILES = +SOURCES = +DIST_SOURCES = +RECURSIVE_TARGETS = all-recursive check-recursive dvi-recursive \ + html-recursive info-recursive install-data-recursive \ + install-dvi-recursive install-exec-recursive \ + install-html-recursive install-info-recursive \ + install-pdf-recursive install-ps-recursive install-recursive \ + installcheck-recursive installdirs-recursive pdf-recursive \ + ps-recursive uninstall-recursive +RECURSIVE_CLEAN_TARGETS = mostlyclean-recursive clean-recursive \ + distclean-recursive maintainer-clean-recursive +ETAGS = etags +CTAGS = ctags +DIST_SUBDIRS = $(SUBDIRS) +DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST) +ACLOCAL = @ACLOCAL@ +AMTAR = @AMTAR@ +AUTOCONF = @AUTOCONF@ +AUTOHEADER = @AUTOHEADER@ +AUTOMAKE = @AUTOMAKE@ +AWK = @AWK@ +CC = @CC@ +CCDEPMODE = @CCDEPMODE@ +CFLAGS = @CFLAGS@ +CPP = @CPP@ +CPPFLAGS = @CPPFLAGS@ +CXX = @CXX@ +CXXCPP = @CXXCPP@ +CXXDEPMODE = @CXXDEPMODE@ +CXXFLAGS = @CXXFLAGS@ +CYGPATH_W = @CYGPATH_W@ +DEFS = @DEFS@ +DEPDIR = @DEPDIR@ +ECHO_C = @ECHO_C@ +ECHO_N = @ECHO_N@ +ECHO_T = @ECHO_T@ +EGREP = @EGREP@ +EXEEXT = @EXEEXT@ +GREP = @GREP@ +INSTALL = @INSTALL@ +INSTALL_DATA = @INSTALL_DATA@ +INSTALL_PROGRAM = @INSTALL_PROGRAM@ +INSTALL_SCRIPT = @INSTALL_SCRIPT@ +INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@ +LDFLAGS = @LDFLAGS@ +LIBOBJS = @LIBOBJS@ +LIBS = @LIBS@ +LTLIBOBJS = @LTLIBOBJS@ +MAKEINFO = @MAKEINFO@ +MKDIR_P = @MKDIR_P@ +OBJEXT = @OBJEXT@ +PACKAGE = @PACKAGE@ +PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@ +PACKAGE_NAME = @PACKAGE_NAME@ +PACKAGE_STRING = @PACKAGE_STRING@ +PACKAGE_TARNAME = @PACKAGE_TARNAME@ +PACKAGE_VERSION = @PACKAGE_VERSION@ +PATH_SEPARATOR = @PATH_SEPARATOR@ +RANLIB = @RANLIB@ +SET_MAKE = @SET_MAKE@ +SHELL = @SHELL@ +STRIP = @STRIP@ +VERSION = @VERSION@ +abs_builddir = @abs_builddir@ +abs_srcdir = @abs_srcdir@ +abs_top_builddir = @abs_top_builddir@ +abs_top_srcdir = @abs_top_srcdir@ +ac_ct_CC = @ac_ct_CC@ +ac_ct_CXX = @ac_ct_CXX@ +am__include = @am__include@ +am__leading_dot = @am__leading_dot@ +am__quote = @am__quote@ +am__tar = @am__tar@ +am__untar = @am__untar@ +bindir = @bindir@ +build = @build@ +build_alias = @build_alias@ +build_cpu = @build_cpu@ +build_os = @build_os@ +build_vendor = @build_vendor@ +builddir = @builddir@ +canonical_host_type = @canonical_host_type@ +datadir = @datadir@ +datarootdir = @datarootdir@ +docdir = @docdir@ +dvidir = @dvidir@ +exec_prefix = @exec_prefix@ +host = @host@ +host_alias = @host_alias@ +host_cpu = @host_cpu@ +host_os = @host_os@ +host_vendor = @host_vendor@ +htmldir = @htmldir@ +includedir = @includedir@ +infodir = @infodir@ +install_sh = @install_sh@ +libdir = @libdir@ +libexecdir = @libexecdir@ +localedir = @localedir@ +localstatedir = @localstatedir@ +mandir = @mandir@ +mkdir_p = @mkdir_p@ +oldincludedir = @oldincludedir@ +pdfdir = @pdfdir@ +prefix = @prefix@ +program_transform_name = @program_transform_name@ +psdir = @psdir@ +sbindir = @sbindir@ +sharedstatedir = @sharedstatedir@ +srcdir = @srcdir@ +sysconfdir = @sysconfdir@ +target_alias = @target_alias@ +top_builddir = @top_builddir@ +top_srcdir = @top_srcdir@ +SUBDIRS = fastx_icons +all: all-recursive + +.SUFFIXES: +$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps) + @for dep in $?; do \ + case '$(am__configure_deps)' in \ + *$$dep*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh \ + && exit 0; \ + exit 1;; \ + esac; \ + done; \ + echo ' cd $(top_srcdir) && $(AUTOMAKE) --gnu galaxy/static/Makefile'; \ + cd $(top_srcdir) && \ + $(AUTOMAKE) --gnu galaxy/static/Makefile +.PRECIOUS: Makefile +Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status + @case '$?' in \ + *config.status*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \ + *) \ + echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \ + cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \ + esac; + +$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +$(top_srcdir)/configure: $(am__configure_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +$(ACLOCAL_M4): $(am__aclocal_m4_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +# This directory's subdirectories are mostly independent; you can cd +# into them and run `make' without going through this Makefile. +# To change the values of `make' variables: instead of editing Makefiles, +# (1) if the variable is set in `config.status', edit `config.status' +# (which will cause the Makefiles to be regenerated when you run `make'); +# (2) otherwise, pass the desired values on the `make' command line. +$(RECURSIVE_TARGETS): + @failcom='exit 1'; \ + for f in x $$MAKEFLAGS; do \ + case $$f in \ + *=* | --[!k]*);; \ + *k*) failcom='fail=yes';; \ + esac; \ + done; \ + dot_seen=no; \ + target=`echo $@ | sed s/-recursive//`; \ + list='$(SUBDIRS)'; for subdir in $$list; do \ + echo "Making $$target in $$subdir"; \ + if test "$$subdir" = "."; then \ + dot_seen=yes; \ + local_target="$$target-am"; \ + else \ + local_target="$$target"; \ + fi; \ + (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) $$local_target) \ + || eval $$failcom; \ + done; \ + if test "$$dot_seen" = "no"; then \ + $(MAKE) $(AM_MAKEFLAGS) "$$target-am" || exit 1; \ + fi; test -z "$$fail" + +$(RECURSIVE_CLEAN_TARGETS): + @failcom='exit 1'; \ + for f in x $$MAKEFLAGS; do \ + case $$f in \ + *=* | --[!k]*);; \ + *k*) failcom='fail=yes';; \ + esac; \ + done; \ + dot_seen=no; \ + case "$@" in \ + distclean-* | maintainer-clean-*) list='$(DIST_SUBDIRS)' ;; \ + *) list='$(SUBDIRS)' ;; \ + esac; \ + rev=''; for subdir in $$list; do \ + if test "$$subdir" = "."; then :; else \ + rev="$$subdir $$rev"; \ + fi; \ + done; \ + rev="$$rev ."; \ + target=`echo $@ | sed s/-recursive//`; \ + for subdir in $$rev; do \ + echo "Making $$target in $$subdir"; \ + if test "$$subdir" = "."; then \ + local_target="$$target-am"; \ + else \ + local_target="$$target"; \ + fi; \ + (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) $$local_target) \ + || eval $$failcom; \ + done && test -z "$$fail" +tags-recursive: + list='$(SUBDIRS)'; for subdir in $$list; do \ + test "$$subdir" = . || (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) tags); \ + done +ctags-recursive: + list='$(SUBDIRS)'; for subdir in $$list; do \ + test "$$subdir" = . || (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) ctags); \ + done + +ID: $(HEADERS) $(SOURCES) $(LISP) $(TAGS_FILES) + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonemtpy = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + mkid -fID $$unique +tags: TAGS + +TAGS: tags-recursive $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + here=`pwd`; \ + if ($(ETAGS) --etags-include --version) >/dev/null 2>&1; then \ + include_option=--etags-include; \ + empty_fix=.; \ + else \ + include_option=--include; \ + empty_fix=; \ + fi; \ + list='$(SUBDIRS)'; for subdir in $$list; do \ + if test "$$subdir" = .; then :; else \ + test ! -f $$subdir/TAGS || \ + tags="$$tags $$include_option=$$here/$$subdir/TAGS"; \ + fi; \ + done; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + if test -z "$(ETAGS_ARGS)$$tags$$unique"; then :; else \ + test -n "$$unique" || unique=$$empty_fix; \ + $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \ + $$tags $$unique; \ + fi +ctags: CTAGS +CTAGS: ctags-recursive $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + test -z "$(CTAGS_ARGS)$$tags$$unique" \ + || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \ + $$tags $$unique + +GTAGS: + here=`$(am__cd) $(top_builddir) && pwd` \ + && cd $(top_srcdir) \ + && gtags -i $(GTAGS_ARGS) $$here + +distclean-tags: + -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags + +distdir: $(DISTFILES) + @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + list='$(DISTFILES)'; \ + dist_files=`for file in $$list; do echo $$file; done | \ + sed -e "s|^$$srcdirstrip/||;t" \ + -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \ + case $$dist_files in \ + */*) $(MKDIR_P) `echo "$$dist_files" | \ + sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \ + sort -u` ;; \ + esac; \ + for file in $$dist_files; do \ + if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \ + if test -d $$d/$$file; then \ + dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \ + if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \ + cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \ + fi; \ + cp -pR $$d/$$file $(distdir)$$dir || exit 1; \ + else \ + test -f $(distdir)/$$file \ + || cp -p $$d/$$file $(distdir)/$$file \ + || exit 1; \ + fi; \ + done + list='$(DIST_SUBDIRS)'; for subdir in $$list; do \ + if test "$$subdir" = .; then :; else \ + test -d "$(distdir)/$$subdir" \ + || $(MKDIR_P) "$(distdir)/$$subdir" \ + || exit 1; \ + distdir=`$(am__cd) $(distdir) && pwd`; \ + top_distdir=`$(am__cd) $(top_distdir) && pwd`; \ + (cd $$subdir && \ + $(MAKE) $(AM_MAKEFLAGS) \ + top_distdir="$$top_distdir" \ + distdir="$$distdir/$$subdir" \ + am__remove_distdir=: \ + am__skip_length_check=: \ + distdir) \ + || exit 1; \ + fi; \ + done +check-am: all-am +check: check-recursive +all-am: Makefile +installdirs: installdirs-recursive +installdirs-am: +install: install-recursive +install-exec: install-exec-recursive +install-data: install-data-recursive +uninstall: uninstall-recursive + +install-am: all-am + @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am + +installcheck: installcheck-recursive +install-strip: + $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \ + install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \ + `test -z '$(STRIP)' || \ + echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install +mostlyclean-generic: + +clean-generic: + +distclean-generic: + -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES) + +maintainer-clean-generic: + @echo "This command is intended for maintainers to use" + @echo "it deletes files that may require special tools to rebuild." +clean: clean-recursive + +clean-am: clean-generic mostlyclean-am + +distclean: distclean-recursive + -rm -f Makefile +distclean-am: clean-am distclean-generic distclean-tags + +dvi: dvi-recursive + +dvi-am: + +html: html-recursive + +info: info-recursive + +info-am: + +install-data-am: + +install-dvi: install-dvi-recursive + +install-exec-am: + +install-html: install-html-recursive + +install-info: install-info-recursive + +install-man: + +install-pdf: install-pdf-recursive + +install-ps: install-ps-recursive + +installcheck-am: + +maintainer-clean: maintainer-clean-recursive + -rm -f Makefile +maintainer-clean-am: distclean-am maintainer-clean-generic + +mostlyclean: mostlyclean-recursive + +mostlyclean-am: mostlyclean-generic + +pdf: pdf-recursive + +pdf-am: + +ps: ps-recursive + +ps-am: + +uninstall-am: + +.MAKE: $(RECURSIVE_CLEAN_TARGETS) $(RECURSIVE_TARGETS) install-am \ + install-strip + +.PHONY: $(RECURSIVE_CLEAN_TARGETS) $(RECURSIVE_TARGETS) CTAGS GTAGS \ + all all-am check check-am clean clean-generic ctags \ + ctags-recursive distclean distclean-generic distclean-tags \ + distdir dvi dvi-am html html-am info info-am install \ + install-am install-data install-data-am install-dvi \ + install-dvi-am install-exec install-exec-am install-html \ + install-html-am install-info install-info-am install-man \ + install-pdf install-pdf-am install-ps install-ps-am \ + install-strip installcheck installcheck-am installdirs \ + installdirs-am maintainer-clean maintainer-clean-generic \ + mostlyclean mostlyclean-generic pdf pdf-am ps ps-am tags \ + tags-recursive uninstall uninstall-am + +# Tell versions [3.59,3.63) of GNU make to not export all variables. +# Otherwise a system limit (for SysV at least) may be exceeded. +.NOEXPORT: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/Makefile.am --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/static/fastx_icons/Makefile.am Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,22 @@ +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +EXTRA_DIST = fastx_clipper_example.png \ + fastx_clipper_illustration.png \ + barcode_splitter_output_example.png \ + fastq_nucleotides_distribution_1.png \ + fastq_nucleotides_distribution_2.png \ + fastq_nucleotides_distribution_3.png \ + fastq_nucleotides_distribution_4.png \ + fasta_clipping_histogram_1.png \ + fasta_clipping_histogram_2.png \ + fastq_quality_boxplot_1.png \ + fastq_quality_boxplot_2.png \ + fastq_quality_boxplot_3.png diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/Makefile.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/static/fastx_icons/Makefile.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,329 @@ +# Makefile.in generated by automake 1.10.1 from Makefile.am. +# @configure_input@ + +# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, +# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This Makefile.in is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +@SET_MAKE@ + +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. +VPATH = @srcdir@ +pkgdatadir = $(datadir)/@PACKAGE@ +pkglibdir = $(libdir)/@PACKAGE@ +pkgincludedir = $(includedir)/@PACKAGE@ +am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd +install_sh_DATA = $(install_sh) -c -m 644 +install_sh_PROGRAM = $(install_sh) -c +install_sh_SCRIPT = $(install_sh) -c +INSTALL_HEADER = $(INSTALL_DATA) +transform = $(program_transform_name) +NORMAL_INSTALL = : +PRE_INSTALL = : +POST_INSTALL = : +NORMAL_UNINSTALL = : +PRE_UNINSTALL = : +POST_UNINSTALL = : +build_triplet = @build@ +host_triplet = @host@ +subdir = galaxy/static/fastx_icons +DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in +ACLOCAL_M4 = $(top_srcdir)/aclocal.m4 +am__aclocal_m4_deps = $(top_srcdir)/configure.ac +am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \ + $(ACLOCAL_M4) +mkinstalldirs = $(install_sh) -d +CONFIG_HEADER = $(top_builddir)/config.h +CONFIG_CLEAN_FILES = +SOURCES = +DIST_SOURCES = +DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST) +ACLOCAL = @ACLOCAL@ +AMTAR = @AMTAR@ +AUTOCONF = @AUTOCONF@ +AUTOHEADER = @AUTOHEADER@ +AUTOMAKE = @AUTOMAKE@ +AWK = @AWK@ +CC = @CC@ +CCDEPMODE = @CCDEPMODE@ +CFLAGS = @CFLAGS@ +CPP = @CPP@ +CPPFLAGS = @CPPFLAGS@ +CXX = @CXX@ +CXXCPP = @CXXCPP@ +CXXDEPMODE = @CXXDEPMODE@ +CXXFLAGS = @CXXFLAGS@ +CYGPATH_W = @CYGPATH_W@ +DEFS = @DEFS@ +DEPDIR = @DEPDIR@ +ECHO_C = @ECHO_C@ +ECHO_N = @ECHO_N@ +ECHO_T = @ECHO_T@ +EGREP = @EGREP@ +EXEEXT = @EXEEXT@ +GREP = @GREP@ +INSTALL = @INSTALL@ +INSTALL_DATA = @INSTALL_DATA@ +INSTALL_PROGRAM = @INSTALL_PROGRAM@ +INSTALL_SCRIPT = @INSTALL_SCRIPT@ +INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@ +LDFLAGS = @LDFLAGS@ +LIBOBJS = @LIBOBJS@ +LIBS = @LIBS@ +LTLIBOBJS = @LTLIBOBJS@ +MAKEINFO = @MAKEINFO@ +MKDIR_P = @MKDIR_P@ +OBJEXT = @OBJEXT@ +PACKAGE = @PACKAGE@ +PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@ +PACKAGE_NAME = @PACKAGE_NAME@ +PACKAGE_STRING = @PACKAGE_STRING@ +PACKAGE_TARNAME = @PACKAGE_TARNAME@ +PACKAGE_VERSION = @PACKAGE_VERSION@ +PATH_SEPARATOR = @PATH_SEPARATOR@ +RANLIB = @RANLIB@ +SET_MAKE = @SET_MAKE@ +SHELL = @SHELL@ +STRIP = @STRIP@ +VERSION = @VERSION@ +abs_builddir = @abs_builddir@ +abs_srcdir = @abs_srcdir@ +abs_top_builddir = @abs_top_builddir@ +abs_top_srcdir = @abs_top_srcdir@ +ac_ct_CC = @ac_ct_CC@ +ac_ct_CXX = @ac_ct_CXX@ +am__include = @am__include@ +am__leading_dot = @am__leading_dot@ +am__quote = @am__quote@ +am__tar = @am__tar@ +am__untar = @am__untar@ +bindir = @bindir@ +build = @build@ +build_alias = @build_alias@ +build_cpu = @build_cpu@ +build_os = @build_os@ +build_vendor = @build_vendor@ +builddir = @builddir@ +canonical_host_type = @canonical_host_type@ +datadir = @datadir@ +datarootdir = @datarootdir@ +docdir = @docdir@ +dvidir = @dvidir@ +exec_prefix = @exec_prefix@ +host = @host@ +host_alias = @host_alias@ +host_cpu = @host_cpu@ +host_os = @host_os@ +host_vendor = @host_vendor@ +htmldir = @htmldir@ +includedir = @includedir@ +infodir = @infodir@ +install_sh = @install_sh@ +libdir = @libdir@ +libexecdir = @libexecdir@ +localedir = @localedir@ +localstatedir = @localstatedir@ +mandir = @mandir@ +mkdir_p = @mkdir_p@ +oldincludedir = @oldincludedir@ +pdfdir = @pdfdir@ +prefix = @prefix@ +program_transform_name = @program_transform_name@ +psdir = @psdir@ +sbindir = @sbindir@ +sharedstatedir = @sharedstatedir@ +srcdir = @srcdir@ +sysconfdir = @sysconfdir@ +target_alias = @target_alias@ +top_builddir = @top_builddir@ +top_srcdir = @top_srcdir@ +EXTRA_DIST = fastx_clipper_example.png \ + fastx_clipper_illustration.png \ + barcode_splitter_output_example.png \ + fastq_nucleotides_distribution_1.png \ + fastq_nucleotides_distribution_2.png \ + fastq_nucleotides_distribution_3.png \ + fastq_nucleotides_distribution_4.png \ + fasta_clipping_histogram_1.png \ + fasta_clipping_histogram_2.png \ + fastq_quality_boxplot_1.png \ + fastq_quality_boxplot_2.png \ + fastq_quality_boxplot_3.png + +all: all-am + +.SUFFIXES: +$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps) + @for dep in $?; do \ + case '$(am__configure_deps)' in \ + *$$dep*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh \ + && exit 0; \ + exit 1;; \ + esac; \ + done; \ + echo ' cd $(top_srcdir) && $(AUTOMAKE) --gnu galaxy/static/fastx_icons/Makefile'; \ + cd $(top_srcdir) && \ + $(AUTOMAKE) --gnu galaxy/static/fastx_icons/Makefile +.PRECIOUS: Makefile +Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status + @case '$?' in \ + *config.status*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \ + *) \ + echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \ + cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \ + esac; + +$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +$(top_srcdir)/configure: $(am__configure_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +$(ACLOCAL_M4): $(am__aclocal_m4_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +tags: TAGS +TAGS: + +ctags: CTAGS +CTAGS: + + +distdir: $(DISTFILES) + @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + list='$(DISTFILES)'; \ + dist_files=`for file in $$list; do echo $$file; done | \ + sed -e "s|^$$srcdirstrip/||;t" \ + -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \ + case $$dist_files in \ + */*) $(MKDIR_P) `echo "$$dist_files" | \ + sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \ + sort -u` ;; \ + esac; \ + for file in $$dist_files; do \ + if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \ + if test -d $$d/$$file; then \ + dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \ + if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \ + cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \ + fi; \ + cp -pR $$d/$$file $(distdir)$$dir || exit 1; \ + else \ + test -f $(distdir)/$$file \ + || cp -p $$d/$$file $(distdir)/$$file \ + || exit 1; \ + fi; \ + done +check-am: all-am +check: check-am +all-am: Makefile +installdirs: +install: install-am +install-exec: install-exec-am +install-data: install-data-am +uninstall: uninstall-am + +install-am: all-am + @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am + +installcheck: installcheck-am +install-strip: + $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \ + install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \ + `test -z '$(STRIP)' || \ + echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install +mostlyclean-generic: + +clean-generic: + +distclean-generic: + -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES) + +maintainer-clean-generic: + @echo "This command is intended for maintainers to use" + @echo "it deletes files that may require special tools to rebuild." +clean: clean-am + +clean-am: clean-generic mostlyclean-am + +distclean: distclean-am + -rm -f Makefile +distclean-am: clean-am distclean-generic + +dvi: dvi-am + +dvi-am: + +html: html-am + +info: info-am + +info-am: + +install-data-am: + +install-dvi: install-dvi-am + +install-exec-am: + +install-html: install-html-am + +install-info: install-info-am + +install-man: + +install-pdf: install-pdf-am + +install-ps: install-ps-am + +installcheck-am: + +maintainer-clean: maintainer-clean-am + -rm -f Makefile +maintainer-clean-am: distclean-am maintainer-clean-generic + +mostlyclean: mostlyclean-am + +mostlyclean-am: mostlyclean-generic + +pdf: pdf-am + +pdf-am: + +ps: ps-am + +ps-am: + +uninstall-am: + +.MAKE: install-am install-strip + +.PHONY: all all-am check check-am clean clean-generic distclean \ + distclean-generic distdir dvi dvi-am html html-am info info-am \ + install install-am install-data install-data-am install-dvi \ + install-dvi-am install-exec install-exec-am install-html \ + install-html-am install-info install-info-am install-man \ + install-pdf install-pdf-am install-ps install-ps-am \ + install-strip installcheck installcheck-am installdirs \ + maintainer-clean maintainer-clean-generic mostlyclean \ + mostlyclean-generic pdf pdf-am ps ps-am uninstall uninstall-am + +# Tell versions [3.59,3.63) of GNU make to not export all variables. +# Otherwise a system limit (for SysV at least) may be exceeded. +.NOEXPORT: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/barcode_splitter_output_example.png Binary file fastx_toolkit-0.0.6/galaxy/static/fastx_icons/barcode_splitter_output_example.png has changed diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fasta_clipping_histogram_1.png Binary file fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fasta_clipping_histogram_1.png has changed diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fasta_clipping_histogram_2.png Binary file fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fasta_clipping_histogram_2.png has changed diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_nucleotides_distribution_1.png Binary file fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_nucleotides_distribution_1.png has changed diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_nucleotides_distribution_2.png Binary file fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_nucleotides_distribution_2.png has changed diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_nucleotides_distribution_3.png Binary file fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_nucleotides_distribution_3.png has changed diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_nucleotides_distribution_4.png Binary file fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_nucleotides_distribution_4.png has changed diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_quality_boxplot_1.png Binary file fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_quality_boxplot_1.png has changed diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_quality_boxplot_2.png Binary file fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_quality_boxplot_2.png has changed diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_quality_boxplot_3.png Binary file fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_quality_boxplot_3.png has changed diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastx_clipper_example.png Binary file fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastx_clipper_example.png has changed diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastx_clipper_illustration.png Binary file fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastx_clipper_illustration.png has changed diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/Makefile.am --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/Makefile.am Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,45 @@ +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +EXTRA_DIST = fastq_qual_conv1a.out \ + fastq_qual_conv1.fastq \ + fastq_qual_conv1.out \ + fastq_qual_conv2.fastq \ + fastq_qual_conv2n.out \ + fastq_qual_conv2.out \ + fastq_qual_filter1a.out \ + fastq_qual_filter1b.out \ + fastq_qual_filter1.fastq \ + fastq_stats1.fastq \ + fastq_stats1.out \ + fastq_to_fasta1a.out \ + fastq_to_fasta1b.out \ + fastq_to_fasta1.fastq \ + fastx_artifacts1.fasta \ + fastx_artifacts1.out \ + fastx_artifacts2.fastq \ + fastx_artifacts2.out \ + fastx_clipper1a.out \ + fastx_clipper1.fastq \ + fastx_rev_comp1.fasta \ + fastx_rev_comp2.fastq \ + fastx_reverse_complement1.out \ + fastx_reverse_complement2.out \ + fastx_trimmer1.fasta \ + fastx_trimmer1.out \ + fastx_trimmer2.fastq \ + fastx_trimmer2.out \ + fasta_collapser1.fasta \ + fasta_collapser1.out \ + fastx_barcode_splitter1.fastq \ + fastx_barcode_splitter1.txt \ + fastx_barcode_splitter1.out + + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/Makefile.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/Makefile.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,350 @@ +# Makefile.in generated by automake 1.10.1 from Makefile.am. +# @configure_input@ + +# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, +# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This Makefile.in is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +@SET_MAKE@ + +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. +VPATH = @srcdir@ +pkgdatadir = $(datadir)/@PACKAGE@ +pkglibdir = $(libdir)/@PACKAGE@ +pkgincludedir = $(includedir)/@PACKAGE@ +am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd +install_sh_DATA = $(install_sh) -c -m 644 +install_sh_PROGRAM = $(install_sh) -c +install_sh_SCRIPT = $(install_sh) -c +INSTALL_HEADER = $(INSTALL_DATA) +transform = $(program_transform_name) +NORMAL_INSTALL = : +PRE_INSTALL = : +POST_INSTALL = : +NORMAL_UNINSTALL = : +PRE_UNINSTALL = : +POST_UNINSTALL = : +build_triplet = @build@ +host_triplet = @host@ +subdir = galaxy/test-data +DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in +ACLOCAL_M4 = $(top_srcdir)/aclocal.m4 +am__aclocal_m4_deps = $(top_srcdir)/configure.ac +am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \ + $(ACLOCAL_M4) +mkinstalldirs = $(install_sh) -d +CONFIG_HEADER = $(top_builddir)/config.h +CONFIG_CLEAN_FILES = +SOURCES = +DIST_SOURCES = +DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST) +ACLOCAL = @ACLOCAL@ +AMTAR = @AMTAR@ +AUTOCONF = @AUTOCONF@ +AUTOHEADER = @AUTOHEADER@ +AUTOMAKE = @AUTOMAKE@ +AWK = @AWK@ +CC = @CC@ +CCDEPMODE = @CCDEPMODE@ +CFLAGS = @CFLAGS@ +CPP = @CPP@ +CPPFLAGS = @CPPFLAGS@ +CXX = @CXX@ +CXXCPP = @CXXCPP@ +CXXDEPMODE = @CXXDEPMODE@ +CXXFLAGS = @CXXFLAGS@ +CYGPATH_W = @CYGPATH_W@ +DEFS = @DEFS@ +DEPDIR = @DEPDIR@ +ECHO_C = @ECHO_C@ +ECHO_N = @ECHO_N@ +ECHO_T = @ECHO_T@ +EGREP = @EGREP@ +EXEEXT = @EXEEXT@ +GREP = @GREP@ +INSTALL = @INSTALL@ +INSTALL_DATA = @INSTALL_DATA@ +INSTALL_PROGRAM = @INSTALL_PROGRAM@ +INSTALL_SCRIPT = @INSTALL_SCRIPT@ +INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@ +LDFLAGS = @LDFLAGS@ +LIBOBJS = @LIBOBJS@ +LIBS = @LIBS@ +LTLIBOBJS = @LTLIBOBJS@ +MAKEINFO = @MAKEINFO@ +MKDIR_P = @MKDIR_P@ +OBJEXT = @OBJEXT@ +PACKAGE = @PACKAGE@ +PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@ +PACKAGE_NAME = @PACKAGE_NAME@ +PACKAGE_STRING = @PACKAGE_STRING@ +PACKAGE_TARNAME = @PACKAGE_TARNAME@ +PACKAGE_VERSION = @PACKAGE_VERSION@ +PATH_SEPARATOR = @PATH_SEPARATOR@ +RANLIB = @RANLIB@ +SET_MAKE = @SET_MAKE@ +SHELL = @SHELL@ +STRIP = @STRIP@ +VERSION = @VERSION@ +abs_builddir = @abs_builddir@ +abs_srcdir = @abs_srcdir@ +abs_top_builddir = @abs_top_builddir@ +abs_top_srcdir = @abs_top_srcdir@ +ac_ct_CC = @ac_ct_CC@ +ac_ct_CXX = @ac_ct_CXX@ +am__include = @am__include@ +am__leading_dot = @am__leading_dot@ +am__quote = @am__quote@ +am__tar = @am__tar@ +am__untar = @am__untar@ +bindir = @bindir@ +build = @build@ +build_alias = @build_alias@ +build_cpu = @build_cpu@ +build_os = @build_os@ +build_vendor = @build_vendor@ +builddir = @builddir@ +canonical_host_type = @canonical_host_type@ +datadir = @datadir@ +datarootdir = @datarootdir@ +docdir = @docdir@ +dvidir = @dvidir@ +exec_prefix = @exec_prefix@ +host = @host@ +host_alias = @host_alias@ +host_cpu = @host_cpu@ +host_os = @host_os@ +host_vendor = @host_vendor@ +htmldir = @htmldir@ +includedir = @includedir@ +infodir = @infodir@ +install_sh = @install_sh@ +libdir = @libdir@ +libexecdir = @libexecdir@ +localedir = @localedir@ +localstatedir = @localstatedir@ +mandir = @mandir@ +mkdir_p = @mkdir_p@ +oldincludedir = @oldincludedir@ +pdfdir = @pdfdir@ +prefix = @prefix@ +program_transform_name = @program_transform_name@ +psdir = @psdir@ +sbindir = @sbindir@ +sharedstatedir = @sharedstatedir@ +srcdir = @srcdir@ +sysconfdir = @sysconfdir@ +target_alias = @target_alias@ +top_builddir = @top_builddir@ +top_srcdir = @top_srcdir@ +EXTRA_DIST = fastq_qual_conv1a.out \ + fastq_qual_conv1.fastq \ + fastq_qual_conv1.out \ + fastq_qual_conv2.fastq \ + fastq_qual_conv2n.out \ + fastq_qual_conv2.out \ + fastq_qual_filter1a.out \ + fastq_qual_filter1b.out \ + fastq_qual_filter1.fastq \ + fastq_stats1.fastq \ + fastq_stats1.out \ + fastq_to_fasta1a.out \ + fastq_to_fasta1b.out \ + fastq_to_fasta1.fastq \ + fastx_artifacts1.fasta \ + fastx_artifacts1.out \ + fastx_artifacts2.fastq \ + fastx_artifacts2.out \ + fastx_clipper1a.out \ + fastx_clipper1.fastq \ + fastx_rev_comp1.fasta \ + fastx_rev_comp2.fastq \ + fastx_reverse_complement1.out \ + fastx_reverse_complement2.out \ + fastx_trimmer1.fasta \ + fastx_trimmer1.out \ + fastx_trimmer2.fastq \ + fastx_trimmer2.out \ + fasta_collapser1.fasta \ + fasta_collapser1.out \ + fastx_barcode_splitter1.fastq \ + fastx_barcode_splitter1.txt \ + fastx_barcode_splitter1.out + +all: all-am + +.SUFFIXES: +$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps) + @for dep in $?; do \ + case '$(am__configure_deps)' in \ + *$$dep*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh \ + && exit 0; \ + exit 1;; \ + esac; \ + done; \ + echo ' cd $(top_srcdir) && $(AUTOMAKE) --gnu galaxy/test-data/Makefile'; \ + cd $(top_srcdir) && \ + $(AUTOMAKE) --gnu galaxy/test-data/Makefile +.PRECIOUS: Makefile +Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status + @case '$?' in \ + *config.status*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \ + *) \ + echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \ + cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \ + esac; + +$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +$(top_srcdir)/configure: $(am__configure_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +$(ACLOCAL_M4): $(am__aclocal_m4_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +tags: TAGS +TAGS: + +ctags: CTAGS +CTAGS: + + +distdir: $(DISTFILES) + @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + list='$(DISTFILES)'; \ + dist_files=`for file in $$list; do echo $$file; done | \ + sed -e "s|^$$srcdirstrip/||;t" \ + -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \ + case $$dist_files in \ + */*) $(MKDIR_P) `echo "$$dist_files" | \ + sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \ + sort -u` ;; \ + esac; \ + for file in $$dist_files; do \ + if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \ + if test -d $$d/$$file; then \ + dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \ + if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \ + cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \ + fi; \ + cp -pR $$d/$$file $(distdir)$$dir || exit 1; \ + else \ + test -f $(distdir)/$$file \ + || cp -p $$d/$$file $(distdir)/$$file \ + || exit 1; \ + fi; \ + done +check-am: all-am +check: check-am +all-am: Makefile +installdirs: +install: install-am +install-exec: install-exec-am +install-data: install-data-am +uninstall: uninstall-am + +install-am: all-am + @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am + +installcheck: installcheck-am +install-strip: + $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \ + install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \ + `test -z '$(STRIP)' || \ + echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install +mostlyclean-generic: + +clean-generic: + +distclean-generic: + -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES) + +maintainer-clean-generic: + @echo "This command is intended for maintainers to use" + @echo "it deletes files that may require special tools to rebuild." +clean: clean-am + +clean-am: clean-generic mostlyclean-am + +distclean: distclean-am + -rm -f Makefile +distclean-am: clean-am distclean-generic + +dvi: dvi-am + +dvi-am: + +html: html-am + +info: info-am + +info-am: + +install-data-am: + +install-dvi: install-dvi-am + +install-exec-am: + +install-html: install-html-am + +install-info: install-info-am + +install-man: + +install-pdf: install-pdf-am + +install-ps: install-ps-am + +installcheck-am: + +maintainer-clean: maintainer-clean-am + -rm -f Makefile +maintainer-clean-am: distclean-am maintainer-clean-generic + +mostlyclean: mostlyclean-am + +mostlyclean-am: mostlyclean-generic + +pdf: pdf-am + +pdf-am: + +ps: ps-am + +ps-am: + +uninstall-am: + +.MAKE: install-am install-strip + +.PHONY: all all-am check check-am clean clean-generic distclean \ + distclean-generic distdir dvi dvi-am html html-am info info-am \ + install install-am install-data install-data-am install-dvi \ + install-dvi-am install-exec install-exec-am install-html \ + install-html-am install-info install-info-am install-man \ + install-pdf install-pdf-am install-ps install-ps-am \ + install-strip installcheck installcheck-am installdirs \ + maintainer-clean maintainer-clean-generic mostlyclean \ + mostlyclean-generic pdf pdf-am ps ps-am uninstall uninstall-am + +# Tell versions [3.59,3.63) of GNU make to not export all variables. +# Otherwise a system limit (for SysV at least) may be exceeded. +.NOEXPORT: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fasta_collapser1.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fasta_collapser1.fasta Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,84 @@ +>1 +TGTATTTACAATGACTAGAAA +>2 +ATTGCTGCTCGGATGGTCCGGCTGTGCACAC +>3 +AGTACAAGGACATGC +>4 +ATTGCTGCTCGGATGGTCCGGCTGTGCACAC +>5 +AGTACAAGGACATGC +>6 +ATTGCTGCTCGGATGGTCCGGCTGTGCACAC +>7 +AGTACAAGGACATGC +>8 +AGTACAAGGACATGC +>9 +ATTGCTGCTCGGATGGTCCGGCTGTGCACAC +>10 +AGTACAAGGACATGC +>11 +AGTACAAGGACATGC +>12 +ATTGCTGCTCGGATGGTCCGGCTGTGCACAC +>13 +CGATTGCCGAAGTCTACCA +>14 +AGTACAAGGACATGC +>15 +CCTTGTAGTGGATTCTGATGA +>16 +AGTACAAGGACATGC +>17 +AGTACAAGGACATGC +>18 +ATTGCTGCTCGGATGGTCCGGCTGTGCACAC +>19 +AGTACAAGGACATGC +>20 +ATTGCTGCTCGGATGGTCCGGCTGTGCACAC +>21 +AGTACAAGGACATGC +>22 +AGTACAAGGACATGC +>23 +CTGCTGCGATCGGTGTGC +>24 +AGTACAAGGACATGC +>25 +ACCATTCGAGCATAC +>26 +AGTACAAGGACATGC +>27 +TCAAATTCTAGATTTTTACGG +>28 +AGTACAAGGACATGC +>29 +TGATTTCCAGAGCCAAT +>30 +ATTGCTGCTCGGATGGTCCGGCTGTGCACAC +>31 +TTACCTCACGATATTGTAATA +>32 +ATGACTTCATCGTCCACCCTTTAGAACT +>33 +ATTGCTGCTCGGATGGTCCGGCTGTGCACAC +>34 +TTCAACGCCGCCGTGAAC +>35 +ATTGCTGCTCGGATGGTCCGGCTGTGCACAC +>36 +CTGCTGCGATCGGTGTGC +>37 +ATTGCTGCTCGGATGGTCCGGCTGTGCACAC +>38 +TTCAACGCCGCCGTGAAC +>39 +TTCAACGCCGCCGTGAAC +>40 +CTGCTGCGATCGGTGTGC +>41 +TTCAACGCCGCCGTGAAC +>42 +TTCAACGCCGCCGTGAAC diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fasta_collapser1.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fasta_collapser1.out Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,24 @@ +>1-3 +CTGCTGCGATCGGTGTGC +>2-1 +TTACCTCACGATATTGTAATA +>3-1 +CCTTGTAGTGGATTCTGATGA +>4-1 +TGATTTCCAGAGCCAAT +>5-11 +ATTGCTGCTCGGATGGTCCGGCTGTGCACAC +>6-1 +ACCATTCGAGCATAC +>7-1 +CGATTGCCGAAGTCTACCA +>8-5 +TTCAACGCCGCCGTGAAC +>9-1 +ATGACTTCATCGTCCACCCTTTAGAACT +>10-15 +AGTACAAGGACATGC +>11-1 +TCAAATTCTAGATTTTTACGG +>12-1 +TGTATTTACAATGACTAGAAA diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_conv1.fastq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_conv1.fastq Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,36 @@ +@CSHL_3_FC042AGLLWW:1:2:7:203 +GTACGCATGACCGAACCCCCCNCCCCCCCCCATGTC ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaaabbXEZabaaaaaaaa]]` +@CSHL_3_FC042AGLLWW:1:2:7:33 +CAATGCCTCTACTCATCCCAGTAGAGGCCCGTGGCC ++CSHL_3_FC042AGLLWW:1:2:7:33 +Waaa^aZaaW^U_XaWaa\WMEP^KEZXRPEEEGaa +@CSHL_3_FC042AGLLWW:1:2:7:169 +GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:169 +a_M^a\Uaaa_M_aaaaaaaaaaaaaaaV\ZUGUUR +@CSHL_3_FC042AGLLWW:1:2:7:1436 +AATTATTTATTAAATTTTAATAATATGGGAGACACT ++CSHL_3_FC042AGLLWW:1:2:7:1436 +a^aaaaaaaaaaaaaaa_U`aaaaa_S_aaaaaVV[ +@CSHL_3_FC042AGLLWW:1:2:7:292 +GGAGAAATACACACACACACTCATCGTCGTCCCCCG ++CSHL_3_FC042AGLLWW:1:2:7:292 +babaaaaaaaUMaaaaaaaaaaa\XEUUEP_]UERE +@CSHL_3_FC042AGLLWW:1:2:7:1819 +AATTCAAACCACCCCAACCCACACACAGAGATACCC ++CSHL_3_FC042AGLLWW:1:2:7:1819 +a\\QVVVLaaLOEXUWUUEKUULEMUEUUKULIQMU +@CSHL_3_FC042AGLLWW:1:2:7:1875 +GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:1875 +aaaaaaaaaXUXXEXaaaaa`_ZaaaaaaaaaXEXU +@CSHL_3_FC042AGLLWW:1:2:8:624 +ACTGGCGCTGTGGAGAGTGTCACACCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:8:624 +aa[S^`X`aa_]]OOXMU^_[MU_aaaaaaaaaaaa +@CSHL_3_FC042AGLLWW:1:2:8:250 +TGCCGCGCACACTGATGACGCGGCCGCTCGCGCTCT ++CSHL_3_FC042AGLLWW:1:2:8:250 +aaaaaaaa^aaaaaabbb[KXPEU[RXZ^JUKRKXE diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_conv1.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_conv1.out Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,36 @@ +@CSHL_3_FC042AGLLWW:1:2:7:203 +GTACGCATGACCGAACCCCCCNCCCCCCCCCATGTC ++CSHL_3_FC042AGLLWW:1:2:7:203 +33 33 34 30 22 30 33 21 29 32 33 33 30 33 26 33 33 33 34 34 24 5 26 33 34 33 33 33 33 33 33 33 33 29 29 32 +@CSHL_3_FC042AGLLWW:1:2:7:33 +CAATGCCTCTACTCATCCCAGTAGAGGCCCGTGGCC ++CSHL_3_FC042AGLLWW:1:2:7:33 +23 33 33 33 30 33 26 33 33 23 30 21 31 24 33 23 33 33 28 23 13 5 16 30 11 5 26 24 18 16 5 5 5 7 33 33 +@CSHL_3_FC042AGLLWW:1:2:7:169 +GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:169 +33 31 13 30 33 28 21 33 33 33 31 13 31 33 33 33 33 33 33 33 33 33 33 33 33 33 33 33 22 28 26 21 7 21 21 18 +@CSHL_3_FC042AGLLWW:1:2:7:1436 +AATTATTTATTAAATTTTAATAATATGGGAGACACT ++CSHL_3_FC042AGLLWW:1:2:7:1436 +33 30 33 33 33 33 33 33 33 33 33 33 33 33 33 33 33 31 21 32 33 33 33 33 33 31 19 31 33 33 33 33 33 22 22 27 +@CSHL_3_FC042AGLLWW:1:2:7:292 +GGAGAAATACACACACACACTCATCGTCGTCCCCCG ++CSHL_3_FC042AGLLWW:1:2:7:292 +34 33 34 33 33 33 33 33 33 33 21 13 33 33 33 33 33 33 33 33 33 33 33 28 24 5 21 21 5 16 31 29 21 5 18 5 +@CSHL_3_FC042AGLLWW:1:2:7:1819 +AATTCAAACCACCCCAACCCACACACAGAGATACCC ++CSHL_3_FC042AGLLWW:1:2:7:1819 +33 28 28 17 22 22 22 12 33 33 12 15 5 24 21 23 21 21 5 11 21 21 12 5 13 21 5 21 21 11 21 12 9 17 13 21 +@CSHL_3_FC042AGLLWW:1:2:7:1875 +GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:1875 +33 33 33 33 33 33 33 33 33 24 21 24 24 5 24 33 33 33 33 33 32 31 26 33 33 33 33 33 33 33 33 33 24 5 24 21 +@CSHL_3_FC042AGLLWW:1:2:8:624 +ACTGGCGCTGTGGAGAGTGTCACACCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:8:624 +33 33 27 19 30 32 24 32 33 33 31 29 29 15 15 24 13 21 30 31 27 13 21 31 33 33 33 33 33 33 33 33 33 33 33 33 +@CSHL_3_FC042AGLLWW:1:2:8:250 +TGCCGCGCACACTGATGACGCGGCCGCTCGCGCTCT ++CSHL_3_FC042AGLLWW:1:2:8:250 +33 33 33 33 33 33 33 33 30 33 33 33 33 33 33 34 34 34 27 11 24 16 5 21 27 18 24 26 30 10 21 11 18 11 24 5 diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_conv1a.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_conv1a.out Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,36 @@ +@CSHL_3_FC042AGLLWW:1:2:7:203 +GTACGCATGACCGAACCCCCCNCCCCCCCCCATGTC ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaaabbXEZabaaaaaaaa]]` +@CSHL_3_FC042AGLLWW:1:2:7:33 +CAATGCCTCTACTCATCCCAGTAGAGGCCCGTGGCC ++CSHL_3_FC042AGLLWW:1:2:7:33 +Waaa^aZaaW^U_XaWaa\WMEP^KEZXRPEEEGaa +@CSHL_3_FC042AGLLWW:1:2:7:169 +GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:169 +a_M^a\Uaaa_M_aaaaaaaaaaaaaaaV\ZUGUUR +@CSHL_3_FC042AGLLWW:1:2:7:1436 +AATTATTTATTAAATTTTAATAATATGGGAGACACT ++CSHL_3_FC042AGLLWW:1:2:7:1436 +a^aaaaaaaaaaaaaaa_U`aaaaa_S_aaaaaVV[ +@CSHL_3_FC042AGLLWW:1:2:7:292 +GGAGAAATACACACACACACTCATCGTCGTCCCCCG ++CSHL_3_FC042AGLLWW:1:2:7:292 +babaaaaaaaUMaaaaaaaaaaa\XEUUEP_]UERE +@CSHL_3_FC042AGLLWW:1:2:7:1819 +AATTCAAACCACCCCAACCCACACACAGAGATACCC ++CSHL_3_FC042AGLLWW:1:2:7:1819 +a\\QVVVLaaLOEXUWUUEKUULEMUEUUKULIQMU +@CSHL_3_FC042AGLLWW:1:2:7:1875 +GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:1875 +aaaaaaaaaXUXXEXaaaaa`_ZaaaaaaaaaXEXU +@CSHL_3_FC042AGLLWW:1:2:8:624 +ACTGGCGCTGTGGAGAGTGTCACACCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:8:624 +aa[S^`X`aa_]]OOXMU^_[MU_aaaaaaaaaaaa +@CSHL_3_FC042AGLLWW:1:2:8:250 +TGCCGCGCACACTGATGACGCGGCCGCTCGCGCTCT ++CSHL_3_FC042AGLLWW:1:2:8:250 +aaaaaaaa^aaaaaabbb[KXPEU[RXZ^JUKRKXE diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_conv2.fastq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_conv2.fastq Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,60 @@ +@CSHL_3_FC0420AGLLKK:2:1:233:1674 +GTTAGAGGGAATACACCCACTCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:233:1674 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 32 40 40 40 40 16 20 25 9 21 37 40 40 16 29 26 30 +@CSHL_3_FC0420AGLLKK:2:1:136:448 +GTTCTCAGGACCCCTTCAGTAGTNGGCACCATCAA ++CSHL_3_FC0420AGLLKK:2:1:136:448 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 -5 13 17 28 40 40 8 17 27 8 13 10 +@CSHL_3_FC0420AGLLKK:2:1:237:1037 +GTGATAGATTGTCTTGTTGTTCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:237:1037 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 4 40 40 26 35 40 38 40 6 40 40 0 3 26 32 27 14 11 26 11 +@CSHL_3_FC0420AGLLKK:2:1:1601:1525 +AAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAA ++CSHL_3_FC0420AGLLKK:2:1:1601:1525 +40 40 40 40 40 40 40 40 40 40 40 40 35 40 40 12 40 40 30 30 40 40 40 12 36 23 17 24 18 22 25 15 10 34 14 +@CSHL_3_FC0420AGLLKK:2:1:1805:1464 +GATGCGTTCGAGATGGGTGCGCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:1805:1464 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 16 23 28 40 21 40 9 37 13 20 21 7 11 14 14 6 23 10 +@CSHL_3_FC0420AGLLKK:2:1:1713:528 +AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA ++CSHL_3_FC0420AGLLKK:2:1:1713:528 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 32 40 12 38 15 22 20 17 14 12 10 7 22 11 +@CSHL_3_FC0420AGLLKK:2:1:126:1087 +GAGATATTCGAATGCATCATCAGATGGCACCATCA ++CSHL_3_FC0420AGLLKK:2:1:126:1087 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 25 40 40 40 40 40 40 40 31 40 40 11 10 23 40 13 12 17 37 17 22 +@CSHL_3_FC0420AGLLKK:2:1:1488:1323 +GTTTTTTCCCCTAATCTGAGTCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:1488:1323 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 39 22 31 40 40 12 29 22 0 7 12 8 18 7 3 18 9 +@CSHL_3_FC0420AGLLKK:2:1:913:199 +GTTCAGTGTTGGTGCACTGTGTTNTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:913:199 +40 40 39 40 40 40 40 40 40 40 40 40 4 40 40 24 34 20 33 21 36 32 40 -5 40 13 21 21 26 17 18 25 14 25 21 +@CSHL_3_FC0420AGLLKK:2:1:1236:1157 +AAAAAAAAAAAAAAAACAAAAAAAAAAAAAACAAA ++CSHL_3_FC0420AGLLKK:2:1:1236:1157 +40 40 40 40 40 40 40 40 40 40 40 40 40 35 40 40 40 40 40 33 40 37 40 40 40 18 16 20 23 22 31 26 10 22 19 +@CSHL_3_FC0420AGLLKK:2:1:928:765 +GTTTTCAGTTCGAGGTTCGTGCTNTAGGCATTATC ++CSHL_3_FC0420AGLLKK:2:1:928:765 +40 40 40 40 40 40 40 40 40 40 40 40 40 25 27 40 37 35 27 40 40 17 40 -5 36 11 19 15 19 16 11 12 12 23 11 +@CSHL_3_FC0420AGLLKK:2:1:727:1020 +GTAATATAGTTGATAAGAATCTGCAGAGAGAATCA ++CSHL_3_FC0420AGLLKK:2:1:727:1020 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 30 40 40 24 18 38 33 26 16 23 22 16 18 +@CSHL_3_FC0420AGLLKK:2:1:758:1799 +GTAGAGACCCCCTAATAGAGTCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:758:1799 +40 40 40 40 40 40 40 40 35 40 39 40 40 27 20 40 17 34 15 40 40 40 40 15 28 17 4 12 10 10 18 14 3 14 11 +@CSHL_3_FC0420AGLLKK:2:1:1818:550 +AAAAAAAAAAAAAAAACAAAAACAAAAAAAACAAA ++CSHL_3_FC0420AGLLKK:2:1:1818:550 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 36 32 40 33 40 40 38 37 40 28 29 27 22 13 20 19 17 17 13 33 18 +@CSHL_3_FC0420AGLLKK:2:1:1764:391 +CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC ++CSHL_3_FC0420AGLLKK:2:1:1764:391 +40 40 40 40 40 40 40 40 40 40 40 33 40 40 40 40 40 24 40 40 40 40 40 12 40 24 14 9 22 15 29 18 11 40 22 diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_conv2.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_conv2.out Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,60 @@ +@CSHL_3_FC0420AGLLKK:2:1:233:1674 +GTTAGAGGGAATACACCCACTCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:233:1674 +hhhhhhhhhhhhhhhhhh`hhhhPTYIUehhP]Z^ +@CSHL_3_FC0420AGLLKK:2:1:136:448 +GTTCTCAGGACCCCTTCAGTAGTNGGCACCATCAA ++CSHL_3_FC0420AGLLKK:2:1:136:448 +hhhhhhhhhhhhhhhhhhhhhhh;MQ\hhHQ[HMJ +@CSHL_3_FC0420AGLLKK:2:1:237:1037 +GTGATAGATTGTCTTGTTGTTCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:237:1037 +hhhhhhhhhhhhhhhDhhZchfhFhh@CZ`[NKZK +@CSHL_3_FC0420AGLLKK:2:1:1601:1525 +AAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAA ++CSHL_3_FC0420AGLLKK:2:1:1601:1525 +hhhhhhhhhhhhchhLhh^^hhhLdWQXRVYOJbN +@CSHL_3_FC0420AGLLKK:2:1:1805:1464 +GATGCGTTCGAGATGGGTGCGCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:1805:1464 +hhhhhhhhhhhhhhhhhPW\hUhIeMTUGKNNFWJ +@CSHL_3_FC0420AGLLKK:2:1:1713:528 +AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA ++CSHL_3_FC0420AGLLKK:2:1:1713:528 +hhhhhhhhhhhhhhhhhhhhh`hLfOVTQNLJGVK +@CSHL_3_FC0420AGLLKK:2:1:126:1087 +GAGATATTCGAATGCATCATCAGATGGCACCATCA ++CSHL_3_FC0420AGLLKK:2:1:126:1087 +hhhhhhhhhhhhhhYhhhhhhh_hhKJWhMLQeQV +@CSHL_3_FC0420AGLLKK:2:1:1488:1323 +GTTTTTTCCCCTAATCTGAGTCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:1488:1323 +hhhhhhhhhhhhhhhhhhgV_hhL]V@GLHRGCRI +@CSHL_3_FC0420AGLLKK:2:1:913:199 +GTTCAGTGTTGGTGCACTGTGTTNTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:913:199 +hhghhhhhhhhhDhhXbTaUd`h;hMUUZQRYNYU +@CSHL_3_FC0420AGLLKK:2:1:1236:1157 +AAAAAAAAAAAAAAAACAAAAAAAAAAAAAACAAA ++CSHL_3_FC0420AGLLKK:2:1:1236:1157 +hhhhhhhhhhhhhchhhhhahehhhRPTWV_ZJVS +@CSHL_3_FC0420AGLLKK:2:1:928:765 +GTTTTCAGTTCGAGGTTCGTGCTNTAGGCATTATC ++CSHL_3_FC0420AGLLKK:2:1:928:765 +hhhhhhhhhhhhhY[hec[hhQh;dKSOSPKLLWK +@CSHL_3_FC0420AGLLKK:2:1:727:1020 +GTAATATAGTTGATAAGAATCTGCAGAGAGAATCA ++CSHL_3_FC0420AGLLKK:2:1:727:1020 +hhhhhhhhhhhhhhhhhhhhhh^hhXRfaZPWVPR +@CSHL_3_FC0420AGLLKK:2:1:758:1799 +GTAGAGACCCCCTAATAGAGTCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:758:1799 +hhhhhhhhchghh[ThQbOhhhhO\QDLJJRNCNK +@CSHL_3_FC0420AGLLKK:2:1:1818:550 +AAAAAAAAAAAAAAAACAAAAACAAAAAAAACAAA ++CSHL_3_FC0420AGLLKK:2:1:1818:550 +hhhhhhhhhhhhhhd`hahhfeh\][VMTSQQMaR +@CSHL_3_FC0420AGLLKK:2:1:1764:391 +CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC ++CSHL_3_FC0420AGLLKK:2:1:1764:391 +hhhhhhhhhhhahhhhhXhhhhhLhXNIVO]RKhV diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_conv2n.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_conv2n.out Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,60 @@ +@CSHL_3_FC0420AGLLKK:2:1:233:1674 +GTTAGAGGGAATACACCCACTCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:233:1674 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 32 40 40 40 40 16 20 25 9 21 37 40 40 16 29 26 30 +@CSHL_3_FC0420AGLLKK:2:1:136:448 +GTTCTCAGGACCCCTTCAGTAGTNGGCACCATCAA ++CSHL_3_FC0420AGLLKK:2:1:136:448 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 -5 13 17 28 40 40 8 17 27 8 13 10 +@CSHL_3_FC0420AGLLKK:2:1:237:1037 +GTGATAGATTGTCTTGTTGTTCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:237:1037 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 4 40 40 26 35 40 38 40 6 40 40 0 3 26 32 27 14 11 26 11 +@CSHL_3_FC0420AGLLKK:2:1:1601:1525 +AAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAA ++CSHL_3_FC0420AGLLKK:2:1:1601:1525 +40 40 40 40 40 40 40 40 40 40 40 40 35 40 40 12 40 40 30 30 40 40 40 12 36 23 17 24 18 22 25 15 10 34 14 +@CSHL_3_FC0420AGLLKK:2:1:1805:1464 +GATGCGTTCGAGATGGGTGCGCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:1805:1464 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 16 23 28 40 21 40 9 37 13 20 21 7 11 14 14 6 23 10 +@CSHL_3_FC0420AGLLKK:2:1:1713:528 +AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA ++CSHL_3_FC0420AGLLKK:2:1:1713:528 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 32 40 12 38 15 22 20 17 14 12 10 7 22 11 +@CSHL_3_FC0420AGLLKK:2:1:126:1087 +GAGATATTCGAATGCATCATCAGATGGCACCATCA ++CSHL_3_FC0420AGLLKK:2:1:126:1087 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 25 40 40 40 40 40 40 40 31 40 40 11 10 23 40 13 12 17 37 17 22 +@CSHL_3_FC0420AGLLKK:2:1:1488:1323 +GTTTTTTCCCCTAATCTGAGTCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:1488:1323 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 39 22 31 40 40 12 29 22 0 7 12 8 18 7 3 18 9 +@CSHL_3_FC0420AGLLKK:2:1:913:199 +GTTCAGTGTTGGTGCACTGTGTTNTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:913:199 +40 40 39 40 40 40 40 40 40 40 40 40 4 40 40 24 34 20 33 21 36 32 40 -5 40 13 21 21 26 17 18 25 14 25 21 +@CSHL_3_FC0420AGLLKK:2:1:1236:1157 +AAAAAAAAAAAAAAAACAAAAAAAAAAAAAACAAA ++CSHL_3_FC0420AGLLKK:2:1:1236:1157 +40 40 40 40 40 40 40 40 40 40 40 40 40 35 40 40 40 40 40 33 40 37 40 40 40 18 16 20 23 22 31 26 10 22 19 +@CSHL_3_FC0420AGLLKK:2:1:928:765 +GTTTTCAGTTCGAGGTTCGTGCTNTAGGCATTATC ++CSHL_3_FC0420AGLLKK:2:1:928:765 +40 40 40 40 40 40 40 40 40 40 40 40 40 25 27 40 37 35 27 40 40 17 40 -5 36 11 19 15 19 16 11 12 12 23 11 +@CSHL_3_FC0420AGLLKK:2:1:727:1020 +GTAATATAGTTGATAAGAATCTGCAGAGAGAATCA ++CSHL_3_FC0420AGLLKK:2:1:727:1020 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 30 40 40 24 18 38 33 26 16 23 22 16 18 +@CSHL_3_FC0420AGLLKK:2:1:758:1799 +GTAGAGACCCCCTAATAGAGTCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:758:1799 +40 40 40 40 40 40 40 40 35 40 39 40 40 27 20 40 17 34 15 40 40 40 40 15 28 17 4 12 10 10 18 14 3 14 11 +@CSHL_3_FC0420AGLLKK:2:1:1818:550 +AAAAAAAAAAAAAAAACAAAAACAAAAAAAACAAA ++CSHL_3_FC0420AGLLKK:2:1:1818:550 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 36 32 40 33 40 40 38 37 40 28 29 27 22 13 20 19 17 17 13 33 18 +@CSHL_3_FC0420AGLLKK:2:1:1764:391 +CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC ++CSHL_3_FC0420AGLLKK:2:1:1764:391 +40 40 40 40 40 40 40 40 40 40 40 33 40 40 40 40 40 24 40 40 40 40 40 12 40 24 14 9 22 15 29 18 11 40 22 diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_filter1.fastq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_filter1.fastq Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,36 @@ +@CSHL_3_FC042AGLLWW:1:2:7:203 +GTACGCATGACCGAACCCCCCNCCCCCCAATTGGTT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaaaaaaaaabaaaaaaaa]]` +@CSHL_3_FC042AGLLWW:1:2:7:33 +CAATGCCTCCAATTGGTTAATCCCCCTATATATACT ++CSHL_3_FC042AGLLWW:1:2:7:33 +aaaaaaaaaW^U_XaWaa\WMEP^KEZXRPEEEGaa +@CSHL_3_FC042AGLLWW:1:2:7:169 +GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:169 +a_M^a\Uaaa_M_aaaZZZZZZUZUZaaV\ZUGUUR +@CSHL_3_FC042AGLLWW:1:2:7:1436 +AATTATTTATTAAATTTTAATAATATGGGAGACACT ++CSHL_3_FC042AGLLWW:1:2:7:1436 +a^aaaaaaaaaaaaaaa_U`aaaaa_S_aaaaaVV[ +@CSHL_3_FC042AGLLWW:1:2:7:292 +GGAGAAATACACACAATTGGTTAATCCCCCTATATA ++CSHL_3_FC042AGLLWW:1:2:7:292 +babaaaaaaaUMaaaaaaaaaaa\XEUUEP_]UERE +@CSHL_3_FC042AGLLWW:1:2:7:1819 +AATTCAAACCACCCCAACCCACACACAGAGATACAA ++CSHL_3_FC042AGLLWW:1:2:7:1819 +a\\QVVVLaaLOEXUWUUEKUULEMUEUUKULIQMU +@CSHL_3_FC042AGLLWW:1:2:7:1875 +GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:1875 +aaaaaaaaaXUXXEXaaaaa`_ZaaaaaaaaaXEXU +@CSHL_3_FC042AGLLWW:1:2:8:624 +ACTGCAATTGGTTAATCCCCCTATATAGCGCTGTGG ++CSHL_3_FC042AGLLWW:1:2:8:624 +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +@CSHL_3_FC042AGLLWW:1:2:8:250 +TGCCGCGCACACTGATGCAATTGGTTAATCCCCCTA ++CSHL_3_FC042AGLLWW:1:2:8:250 +aaaaaaaa^aaaaaabbb[KXPEU[RXZ^JUKRKXE diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_filter1a.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_filter1a.out Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,4 @@ +@CSHL_3_FC042AGLLWW:1:2:8:624 +ACTGCAATTGGTTAATCCCCCTATATAGCGCTGTGG ++CSHL_3_FC042AGLLWW:1:2:8:624 +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_filter1b.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_filter1b.out Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,24 @@ +@CSHL_3_FC042AGLLWW:1:2:7:203 +GTACGCATGACCGAACCCCCCNCCCCCCAATTGGTT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaaaaaaaaabaaaaaaaa]]` +@CSHL_3_FC042AGLLWW:1:2:7:169 +GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:169 +a_M^a\Uaaa_M_aaaZZZZZZUZUZaaV\ZUGUUR +@CSHL_3_FC042AGLLWW:1:2:7:1436 +AATTATTTATTAAATTTTAATAATATGGGAGACACT ++CSHL_3_FC042AGLLWW:1:2:7:1436 +a^aaaaaaaaaaaaaaa_U`aaaaa_S_aaaaaVV[ +@CSHL_3_FC042AGLLWW:1:2:7:292 +GGAGAAATACACACAATTGGTTAATCCCCCTATATA ++CSHL_3_FC042AGLLWW:1:2:7:292 +babaaaaaaaUMaaaaaaaaaaa\XEUUEP_]UERE +@CSHL_3_FC042AGLLWW:1:2:7:1875 +GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:1875 +aaaaaaaaaXUXXEXaaaaa`_ZaaaaaaaaaXEXU +@CSHL_3_FC042AGLLWW:1:2:8:624 +ACTGCAATTGGTTAATCCCCCTATATAGCGCTGTGG ++CSHL_3_FC042AGLLWW:1:2:8:624 +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_stats1.fastq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_stats1.fastq Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,36 @@ +@CSHL_3_FC042AGLLWW:1:2:7:203 +GTACGCATGACCGAACCCCCCNCCCCCCAATTGGTT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaaabbXEZabaaaaaaaa]]` +@CSHL_3_FC042AGLLWW:1:2:7:33 +CAATGCCTCCAATTGGTTAATCCCCCTATATATACT ++CSHL_3_FC042AGLLWW:1:2:7:33 +Waaa^aZaaW^U_XaWaa\WMEP^KEZXRPEEEGaa +@CSHL_3_FC042AGLLWW:1:2:7:169 +GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:169 +a_M^a\Uaaa_M_aaaaaaaaaaaaaaaV\ZUGUUR +@CSHL_3_FC042AGLLWW:1:2:7:1436 +AATTATTTATTAAATTTTAATAATATGGGAGACACT ++CSHL_3_FC042AGLLWW:1:2:7:1436 +a^aaaaaaaaaaaaaaa_U`aaaaa_S_aaaaaVV[ +@CSHL_3_FC042AGLLWW:1:2:7:292 +GGAGAAATACACACAATTGGTTAATCCCCCTATATA ++CSHL_3_FC042AGLLWW:1:2:7:292 +babaaaaaaaUMaaaaaaaaaaa\XEUUEP_]UERE +@CSHL_3_FC042AGLLWW:1:2:7:1819 +AATTCAAACCACCCCAACCCACACACAGAGATACAA ++CSHL_3_FC042AGLLWW:1:2:7:1819 +a\\QVVVLaaLOEXUWUUEKUULEMUEUUKULIQMU +@CSHL_3_FC042AGLLWW:1:2:7:1875 +GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:1875 +aaaaaaaaaXUXXEXaaaaa`_ZaaaaaaaaaXEXU +@CSHL_3_FC042AGLLWW:1:2:8:624 +ACTGCAATTGGTTAATCCCCCTATATAGCGCTGTGG ++CSHL_3_FC042AGLLWW:1:2:8:624 +aa[S^`X`aa_]]OOXMU^_[MU_aaaaaaaaaaaa +@CSHL_3_FC042AGLLWW:1:2:8:250 +TGCCGCGCACACTGATGCAATTGGTTAATCCCCCTA ++CSHL_3_FC042AGLLWW:1:2:8:250 +aaaaaaaa^aaaaaabbb[KXPEU[RXZ^JUKRKXE diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_stats1.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_stats1.out Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,37 @@ +column count min max sum mean Q1 med Q3 IQR lW rW A_Count C_Count G_Count T_Count N_Count +1 9 23 34 288 32.00 33 33 33 0 33 33 3 1 4 1 0 +2 9 28 33 287 31.89 31 33 33 2 28 33 3 3 2 1 0 +3 9 13 34 268 29.78 28 33 33 5 21 34 5 1 0 3 0 +4 9 17 33 261 29.00 30 33 33 3 26 33 1 2 3 3 0 +5 9 22 33 269 29.89 30 33 33 3 26 33 3 3 3 0 0 +6 9 22 33 277 30.78 30 33 33 3 26 33 5 3 0 1 0 +7 9 21 33 258 28.67 24 33 33 9 21 33 4 1 3 1 0 +8 9 12 33 263 29.22 32 33 33 1 31 33 2 1 1 5 0 +9 9 29 33 290 32.22 33 33 33 0 33 33 3 3 2 1 0 +10 9 23 33 277 30.78 32 33 33 1 31 33 1 4 2 2 0 +11 9 12 33 245 27.22 21 31 33 12 12 33 5 2 1 1 0 +12 9 13 33 214 23.78 15 24 33 18 13 33 2 4 2 1 0 +13 9 5 33 249 27.67 29 31 33 4 23 33 2 1 1 5 0 +14 9 5 33 233 25.89 24 33 33 9 11 33 3 3 2 1 0 +15 9 15 33 251 27.89 24 33 33 9 15 33 5 1 1 2 0 +16 9 23 34 269 29.89 24 33 33 9 23 34 3 1 2 3 0 +17 9 13 34 266 29.56 33 33 33 0 33 33 2 3 1 3 0 +18 9 21 34 272 30.22 31 33 33 2 28 34 0 5 1 3 0 +19 9 5 34 244 27.11 27 30 33 6 18 34 4 4 1 0 0 +20 9 11 34 241 26.78 23 32 33 10 11 34 3 4 2 0 0 +21 9 13 33 240 26.67 24 27 33 9 13 33 1 4 0 4 0 +22 9 5 33 190 21.11 13 21 33 20 5 33 1 4 0 3 1 +23 9 5 33 205 22.78 16 26 33 17 5 33 4 4 1 0 0 +24 9 5 33 247 27.44 28 31 33 5 21 33 1 5 1 2 0 +25 9 11 34 241 26.78 24 33 33 9 11 34 3 4 0 2 0 +26 9 5 33 212 23.56 18 31 33 15 5 33 0 6 0 3 0 +27 9 5 33 227 25.22 21 26 33 12 5 33 3 4 1 1 0 +28 9 21 33 255 28.33 24 31 33 9 21 33 2 4 3 0 0 +29 9 5 33 228 25.33 21 30 33 12 5 33 2 4 1 2 0 +30 9 10 33 213 23.67 16 28 33 17 10 33 3 4 2 0 0 +31 9 5 33 236 26.22 21 31 33 12 5 33 1 4 1 3 0 +32 9 5 33 210 23.33 12 29 33 21 5 33 3 3 0 3 0 +33 9 5 33 183 20.33 9 21 33 24 5 33 1 4 2 2 0 +34 9 5 33 150 16.67 7 17 22 15 5 33 3 4 1 1 0 +35 9 13 33 217 24.11 21 24 29 8 13 33 1 4 1 3 0 +36 9 5 33 195 21.67 18 21 32 14 5 33 3 2 1 3 0 diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_to_fasta1.fastq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_to_fasta1.fastq Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,36 @@ +@CSHL_3_FC042AGLLWW:1:2:7:203 +GTACGCATGACCGAACCCCCCNCCCCCCAATTGGTT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaaabbXEZabaaaaaaaa]]` +@CSHL_3_FC042AGLLWW:1:2:7:33 +CAATGCCTCCAATTGGTTAATCCCCCTATATATACT ++CSHL_3_FC042AGLLWW:1:2:7:33 +Waaa^aZaaW^U_XaWaa\WMEP^KEZXRPEEEGaa +@CSHL_3_FC042AGLLWW:1:2:7:169 +GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:169 +a_M^a\Uaaa_M_aaaaaaaaaaaaaaaV\ZUGUUR +@CSHL_3_FC042AGLLWW:1:2:7:1436 +AATTATTTATTAAATTTTAATAATATGGGAGACACT ++CSHL_3_FC042AGLLWW:1:2:7:1436 +a^aaaaaaaaaaaaaaa_U`aaaaa_S_aaaaaVV[ +@CSHL_3_FC042AGLLWW:1:2:7:292 +GGAGAAATACACACAATTGGTTAATCCCCCTATATA ++CSHL_3_FC042AGLLWW:1:2:7:292 +babaaaaaaaUMaaaaaaaaaaa\XEUUEP_]UERE +@CSHL_3_FC042AGLLWW:1:2:7:1819 +AATTCAAACCACCCCAACCCACACACAGAGATACAA ++CSHL_3_FC042AGLLWW:1:2:7:1819 +a\\QVVVLaaLOEXUWUUEKUULEMUEUUKULIQMU +@CSHL_3_FC042AGLLWW:1:2:7:1875 +GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:1875 +aaaaaaaaaXUXXEXaaaaa`_ZaaaaaaaaaXEXU +@CSHL_3_FC042AGLLWW:1:2:8:624 +ACTGCAATTGGTTAATCCCCCTATATAGCGCTGTGG ++CSHL_3_FC042AGLLWW:1:2:8:624 +aa[S^`X`aa_]]OOXMU^_[MU_aaaaaaaaaaaa +@CSHL_3_FC042AGLLWW:1:2:8:250 +TGCCGCGCACACTGATGCAATTGGTTAATCCCCCTA ++CSHL_3_FC042AGLLWW:1:2:8:250 +aaaaaaaa^aaaaaabbb[KXPEU[RXZ^JUKRKXE diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_to_fasta1a.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_to_fasta1a.out Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,16 @@ +>CSHL_3_FC042AGLLWW:1:2:7:33 +CAATGCCTCCAATTGGTTAATCCCCCTATATATACT +>CSHL_3_FC042AGLLWW:1:2:7:169 +GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCCC +>CSHL_3_FC042AGLLWW:1:2:7:1436 +AATTATTTATTAAATTTTAATAATATGGGAGACACT +>CSHL_3_FC042AGLLWW:1:2:7:292 +GGAGAAATACACACAATTGGTTAATCCCCCTATATA +>CSHL_3_FC042AGLLWW:1:2:7:1819 +AATTCAAACCACCCCAACCCACACACAGAGATACAA +>CSHL_3_FC042AGLLWW:1:2:7:1875 +GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCCC +>CSHL_3_FC042AGLLWW:1:2:8:624 +ACTGCAATTGGTTAATCCCCCTATATAGCGCTGTGG +>CSHL_3_FC042AGLLWW:1:2:8:250 +TGCCGCGCACACTGATGCAATTGGTTAATCCCCCTA diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_to_fasta1b.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_to_fasta1b.out Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,18 @@ +>1 +GTACGCATGACCGAACCCCCCNCCCCCCAATTGGTT +>2 +CAATGCCTCCAATTGGTTAATCCCCCTATATATACT +>3 +GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCCC +>4 +AATTATTTATTAAATTTTAATAATATGGGAGACACT +>5 +GGAGAAATACACACAATTGGTTAATCCCCCTATATA +>6 +AATTCAAACCACCCCAACCCACACACAGAGATACAA +>7 +GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCCC +>8 +ACTGCAATTGGTTAATCCCCCTATATAGCGCTGTGG +>9 +TGCCGCGCACACTGATGCAATTGGTTAATCCCCCTA diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_artifacts1.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_artifacts1.fasta Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,24 @@ +>CSHL_3_FC0420AGLLKK:2:1:233:1674 +GTTAGAGGGAATACACCCACTCTGTAGGCACCATC +>CSHL_3_FC0420AGLLKK:2:1:237:1037 +GTGATAGATTGTCTTGTTGTTCTGTAGGCACCATC +>CSHL_3_FC0420AGLLKK:2:1:1601:1525 +AAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAA +>CSHL_3_FC0420AGLLKK:2:1:1805:1464 +GATGCGTTCGAGATGGGTGCGCTGTAGGCACCATC +>CSHL_3_FC0420AGLLKK:2:1:1713:528 +AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA +>CSHL_3_FC0420AGLLKK:2:1:126:1087 +GAGATATTCGAATGCATCATCAGATGGCACCATCA +>CSHL_3_FC0420AGLLKK:2:1:1488:1323 +GTTTTTTCCCCTAATCTGAGTCTGTAGGCACCATC +>CSHL_3_FC0420AGLLKK:2:1:1236:1157 +AAAAAAAAAAAAAAAACAAAAAAAAAAAAAACAAA +>CSHL_3_FC0420AGLLKK:2:1:727:1020 +GTAATATAGTTGATAAGAATCTGCAGAGAGAATCA +>CSHL_3_FC0420AGLLKK:2:1:758:1799 +GTAGAGACCCCCTAATAGAGTCTGTAGGCACCATC +>CSHL_3_FC0420AGLLKK:2:1:1818:550 +AAAAAAAAAAAAAAAACAAAAACAAAAAAAACAAA +>CSHL_3_FC0420AGLLKK:2:1:1764:391 +CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_artifacts1.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_artifacts1.out Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,14 @@ +>CSHL_3_FC0420AGLLKK:2:1:233:1674 +GTTAGAGGGAATACACCCACTCTGTAGGCACCATC +>CSHL_3_FC0420AGLLKK:2:1:237:1037 +GTGATAGATTGTCTTGTTGTTCTGTAGGCACCATC +>CSHL_3_FC0420AGLLKK:2:1:1805:1464 +GATGCGTTCGAGATGGGTGCGCTGTAGGCACCATC +>CSHL_3_FC0420AGLLKK:2:1:126:1087 +GAGATATTCGAATGCATCATCAGATGGCACCATCA +>CSHL_3_FC0420AGLLKK:2:1:1488:1323 +GTTTTTTCCCCTAATCTGAGTCTGTAGGCACCATC +>CSHL_3_FC0420AGLLKK:2:1:727:1020 +GTAATATAGTTGATAAGAATCTGCAGAGAGAATCA +>CSHL_3_FC0420AGLLKK:2:1:758:1799 +GTAGAGACCCCCTAATAGAGTCTGTAGGCACCATC diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_artifacts2.fastq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_artifacts2.fastq Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,60 @@ +@CSHL_3_FC0420AGLLKK:2:1:233:1674 +GTTAGAGGGAATACACCCACTCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:233:1674 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 32 40 40 40 40 16 20 25 9 21 37 40 40 16 29 26 30 +@CSHL_3_FC0420AGLLKK:2:1:136:448 +GTTCTCAGGACCCCTTCAGTAGTNGGCACCATCAA ++CSHL_3_FC0420AGLLKK:2:1:136:448 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 -5 13 17 28 40 40 8 17 27 8 13 10 +@CSHL_3_FC0420AGLLKK:2:1:237:1037 +GTGATAGATTGTCTTGTTGTTCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:237:1037 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 4 40 40 26 35 40 38 40 6 40 40 0 3 26 32 27 14 11 26 11 +@CSHL_3_FC0420AGLLKK:2:1:1601:1525 +AAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAA ++CSHL_3_FC0420AGLLKK:2:1:1601:1525 +40 40 40 40 40 40 40 40 40 40 40 40 35 40 40 12 40 40 30 30 40 40 40 12 36 23 17 24 18 22 25 15 10 34 14 +@CSHL_3_FC0420AGLLKK:2:1:1805:1464 +GATGCGTTCGAGATGGGTGCGCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:1805:1464 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 16 23 28 40 21 40 9 37 13 20 21 7 11 14 14 6 23 10 +@CSHL_3_FC0420AGLLKK:2:1:1713:528 +AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA ++CSHL_3_FC0420AGLLKK:2:1:1713:528 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 32 40 12 38 15 22 20 17 14 12 10 7 22 11 +@CSHL_3_FC0420AGLLKK:2:1:126:1087 +GAGATATTCGAATGCATCATCAGATGGCACCATCA ++CSHL_3_FC0420AGLLKK:2:1:126:1087 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 25 40 40 40 40 40 40 40 31 40 40 11 10 23 40 13 12 17 37 17 22 +@CSHL_3_FC0420AGLLKK:2:1:1488:1323 +GTTTTTTCCCCTAATCTGAGTCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:1488:1323 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 39 22 31 40 40 12 29 22 0 7 12 8 18 7 3 18 9 +@CSHL_3_FC0420AGLLKK:2:1:913:199 +GTTCAGTGTTGGTGCACTGTGTTNTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:913:199 +40 40 39 40 40 40 40 40 40 40 40 40 4 40 40 24 34 20 33 21 36 32 40 -5 40 13 21 21 26 17 18 25 14 25 21 +@CSHL_3_FC0420AGLLKK:2:1:1236:1157 +AAAAAAAAAAAAAAAACAAAAAAAAAAAAAACAAA ++CSHL_3_FC0420AGLLKK:2:1:1236:1157 +40 40 40 40 40 40 40 40 40 40 40 40 40 35 40 40 40 40 40 33 40 37 40 40 40 18 16 20 23 22 31 26 10 22 19 +@CSHL_3_FC0420AGLLKK:2:1:928:765 +GTTTTCAGTTCGAGGTTCGTGCTNTAGGCATTATC ++CSHL_3_FC0420AGLLKK:2:1:928:765 +40 40 40 40 40 40 40 40 40 40 40 40 40 25 27 40 37 35 27 40 40 17 40 -5 36 11 19 15 19 16 11 12 12 23 11 +@CSHL_3_FC0420AGLLKK:2:1:727:1020 +GTAATATAGTTGATAAGAATCTGCAGAGAGAATCA ++CSHL_3_FC0420AGLLKK:2:1:727:1020 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 30 40 40 24 18 38 33 26 16 23 22 16 18 +@CSHL_3_FC0420AGLLKK:2:1:758:1799 +GTAGAGACCCCCTAATAGAGTCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:758:1799 +40 40 40 40 40 40 40 40 35 40 39 40 40 27 20 40 17 34 15 40 40 40 40 15 28 17 4 12 10 10 18 14 3 14 11 +@CSHL_3_FC0420AGLLKK:2:1:1818:550 +AAAAAAAAAAAAAAAACAAAAACAAAAAAAACAAA ++CSHL_3_FC0420AGLLKK:2:1:1818:550 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 36 32 40 33 40 40 38 37 40 28 29 27 22 13 20 19 17 17 13 33 18 +@CSHL_3_FC0420AGLLKK:2:1:1764:391 +CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC ++CSHL_3_FC0420AGLLKK:2:1:1764:391 +40 40 40 40 40 40 40 40 40 40 40 33 40 40 40 40 40 24 40 40 40 40 40 12 40 24 14 9 22 15 29 18 11 40 22 diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_artifacts2.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_artifacts2.out Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,40 @@ +@CSHL_3_FC0420AGLLKK:2:1:233:1674 +GTTAGAGGGAATACACCCACTCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:233:1674 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 32 40 40 40 40 16 20 25 9 21 37 40 40 16 29 26 30 +@CSHL_3_FC0420AGLLKK:2:1:136:448 +GTTCTCAGGACCCCTTCAGTAGTNGGCACCATCAA ++CSHL_3_FC0420AGLLKK:2:1:136:448 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 -5 13 17 28 40 40 8 17 27 8 13 10 +@CSHL_3_FC0420AGLLKK:2:1:237:1037 +GTGATAGATTGTCTTGTTGTTCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:237:1037 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 4 40 40 26 35 40 38 40 6 40 40 0 3 26 32 27 14 11 26 11 +@CSHL_3_FC0420AGLLKK:2:1:1805:1464 +GATGCGTTCGAGATGGGTGCGCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:1805:1464 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 16 23 28 40 21 40 9 37 13 20 21 7 11 14 14 6 23 10 +@CSHL_3_FC0420AGLLKK:2:1:126:1087 +GAGATATTCGAATGCATCATCAGATGGCACCATCA ++CSHL_3_FC0420AGLLKK:2:1:126:1087 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 25 40 40 40 40 40 40 40 31 40 40 11 10 23 40 13 12 17 37 17 22 +@CSHL_3_FC0420AGLLKK:2:1:1488:1323 +GTTTTTTCCCCTAATCTGAGTCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:1488:1323 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 39 22 31 40 40 12 29 22 0 7 12 8 18 7 3 18 9 +@CSHL_3_FC0420AGLLKK:2:1:913:199 +GTTCAGTGTTGGTGCACTGTGTTNTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:913:199 +40 40 39 40 40 40 40 40 40 40 40 40 4 40 40 24 34 20 33 21 36 32 40 -5 40 13 21 21 26 17 18 25 14 25 21 +@CSHL_3_FC0420AGLLKK:2:1:928:765 +GTTTTCAGTTCGAGGTTCGTGCTNTAGGCATTATC ++CSHL_3_FC0420AGLLKK:2:1:928:765 +40 40 40 40 40 40 40 40 40 40 40 40 40 25 27 40 37 35 27 40 40 17 40 -5 36 11 19 15 19 16 11 12 12 23 11 +@CSHL_3_FC0420AGLLKK:2:1:727:1020 +GTAATATAGTTGATAAGAATCTGCAGAGAGAATCA ++CSHL_3_FC0420AGLLKK:2:1:727:1020 +40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 30 40 40 24 18 38 33 26 16 23 22 16 18 +@CSHL_3_FC0420AGLLKK:2:1:758:1799 +GTAGAGACCCCCTAATAGAGTCTGTAGGCACCATC ++CSHL_3_FC0420AGLLKK:2:1:758:1799 +40 40 40 40 40 40 40 40 35 40 39 40 40 27 20 40 17 34 15 40 40 40 40 15 28 17 4 12 10 10 18 14 3 14 11 diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_barcode_splitter1.fastq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_barcode_splitter1.fastq Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,168 @@ +@CSHL_3_FC042AGLLWW:1:2:7:203 +GATCTAGTAGTAGTAGA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GATCTAGTAGTAGTAGA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GATCTAGTAGTAGTAGA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GATCTAGTAGTAGTAGA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GATCTAGTAGTAGTAGA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTCTAGTAGTAGTAGA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTCTTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTCTGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTATTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTATTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTATTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTACGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTACTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTACGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCGTTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCGTGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCGTTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCGTGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCTTTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCTTGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCTTGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCTTTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCTCGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCTCGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCTCTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCTCGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAATGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAATTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAATGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAATTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAATGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAATTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAATGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAATTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAATGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +TAGTTGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +TAGTTGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +TAGTTTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +TAGTTTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +TAGTTGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +TAGTTTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +TGTCTGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa \ No newline at end of file diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_barcode_splitter1.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_barcode_splitter1.out Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,24 @@ + + + + + + + + +

Copy these files to your local computer, as they will be soon deleted. +

+BarcodeCountLocation +
+BC111http://tango.cshl.edu/barcode_splits/2009-01-19_1719__fastx_barcode_splitter1_fastq__BC1.txt +
+BC212http://tango.cshl.edu/barcode_splits/2009-01-19_1719__fastx_barcode_splitter1_fastq__BC2.txt +
+BC39http://tango.cshl.edu/barcode_splits/2009-01-19_1719__fastx_barcode_splitter1_fastq__BC3.txt +
+BC41http://tango.cshl.edu/barcode_splits/2009-01-19_1719__fastx_barcode_splitter1_fastq__BC4.txt +
+unmatched9http://tango.cshl.edu/barcode_splits/2009-01-19_1719__fastx_barcode_splitter1_fastq__unmatched.txt +
+total42 +
diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_barcode_splitter1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_barcode_splitter1.txt Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,4 @@ +BC1 GATCT +BC2 ATCGT +BC3 GTGAT +BC4 TGTCT \ No newline at end of file diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_clipper1.fastq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_clipper1.fastq Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,36 @@ +@CSHL_3_FC042AGLLWW:1:2:7:203 +GTACGCATGACCGAACCCCCCNCCCCCCAATTGGTT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaaabbXEZabaaaaaaaa]]` +@CSHL_3_FC042AGLLWW:1:2:7:33 +CAATGCCTCCAATTGGTTAATCCCCCTATATATACT ++CSHL_3_FC042AGLLWW:1:2:7:33 +Waaa^aZaaW^U_XaWaa\WMEP^KEZXRPEEEGaa +@CSHL_3_FC042AGLLWW:1:2:7:169 +GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:169 +a_M^a\Uaaa_M_aaaaaaaaaaaaaaaV\ZUGUUR +@CSHL_3_FC042AGLLWW:1:2:7:1436 +AATTATTTATTAAATTTTAATAATATGGGAGACACT ++CSHL_3_FC042AGLLWW:1:2:7:1436 +a^aaaaaaaaaaaaaaa_U`aaaaa_S_aaaaaVV[ +@CSHL_3_FC042AGLLWW:1:2:7:292 +GGAGAAATACACACAATTGGTTAATCCCCCTATATA ++CSHL_3_FC042AGLLWW:1:2:7:292 +babaaaaaaaUMaaaaaaaaaaa\XEUUEP_]UERE +@CSHL_3_FC042AGLLWW:1:2:7:1819 +AATTCAAACCACCCCAACCCACACACAGAGATACAA ++CSHL_3_FC042AGLLWW:1:2:7:1819 +a\\QVVVLaaLOEXUWUUEKUULEMUEUUKULIQMU +@CSHL_3_FC042AGLLWW:1:2:7:1875 +GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:1875 +aaaaaaaaaXUXXEXaaaaa`_ZaaaaaaaaaXEXU +@CSHL_3_FC042AGLLWW:1:2:8:624 +ACTGCAATTGGTTAATCCCCCTATATAGCGCTGTGG ++CSHL_3_FC042AGLLWW:1:2:8:624 +aa[S^`X`aa_]]OOXMU^_[MU_aaaaaaaaaaaa +@CSHL_3_FC042AGLLWW:1:2:8:250 +TGCCGCGCACACTGATGCAATTGGTTAATCCCCCTA ++CSHL_3_FC042AGLLWW:1:2:8:250 +aaaaaaaa^aaaaaabbb[KXPEU[RXZ^JUKRKXE diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_clipper1a.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_clipper1a.out Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,20 @@ +@CSHL_3_FC042AGLLWW:1:2:7:203 +GTACGCATGACCGAACCCCCCNCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaaabbXEZabaa +@CSHL_3_FC042AGLLWW:1:2:7:169 +GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:169 +a_M^a\Uaaa_M_aaaaaaaaaaaaaaaV\ZUGUU +@CSHL_3_FC042AGLLWW:1:2:7:1819 +AATTCAAACCACCCCAACCCACACACAGAGATA ++CSHL_3_FC042AGLLWW:1:2:7:1819 +a\\QVVVLaaLOEXUWUUEKUULEMUEUUKULI +@CSHL_3_FC042AGLLWW:1:2:7:1875 +GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:1875 +aaaaaaaaaXUXXEXaaaaa`_ZaaaaaaaaaXEX +@CSHL_3_FC042AGLLWW:1:2:8:250 +TGCCGCGCACACTGATG ++CSHL_3_FC042AGLLWW:1:2:8:250 +aaaaaaaa^aaaaaabb diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_rev_comp1.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_rev_comp1.fasta Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,4 @@ +>CSHL__2_FC042NGABCD:8:1:120:202 +ACGATAGATCGGAAGAGCTAGTATGCCGTTTTCTGC +>CSHL__2_FC042NGABCD:8:1:103:1185 +ATCACGATAGATCGGCAGAGCTCGTTTACCGTCTTC diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_rev_comp2.fastq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_rev_comp2.fastq Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,8 @@ +@CSHL__2_FC042NGABCD:8:1:120:202 +ACGATAGATCGGAAGAGCTAGTATGCCGTTTTCTGC ++CSHL__2_FC042NGABCD:8:1:120:202 +40 40 40 40 20 40 40 40 40 6 40 40 28 40 40 25 40 20 40 -1 30 40 14 27 40 8 1 3 7 -1 11 10 -1 21 10 8 +@CSHL__2_FC042NGABCD:8:1:103:1185 +ATCACGATAGATCGGCAGAGCTCGTTTACCGTCTTC ++CSHL__2_FC042NGABCD:8:1:103:1185 +40 40 40 40 40 35 33 31 40 40 40 32 30 22 40 -0 9 22 17 14 8 36 15 34 22 12 23 3 10 -0 8 2 4 25 30 2 diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_reverse_complement1.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_reverse_complement1.out Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,4 @@ +>CSHL__2_FC042NGABCD:8:1:120:202 +GCAGAAAACGGCATACTAGCTCTTCCGATCTATCGT +>CSHL__2_FC042NGABCD:8:1:103:1185 +GAAGACGGTAAACGAGCTCTGCCGATCTATCGTGAT diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_reverse_complement2.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_reverse_complement2.out Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,8 @@ +@CSHL__2_FC042NGABCD:8:1:120:202 +GCAGAAAACGGCATACTAGCTCTTCCGATCTATCGT ++CSHL__2_FC042NGABCD:8:1:120:202 +8 10 21 -1 10 11 -1 7 3 1 8 40 27 14 40 30 -1 40 20 40 25 40 40 28 40 40 6 40 40 40 40 20 40 40 40 40 +@CSHL__2_FC042NGABCD:8:1:103:1185 +GAAGACGGTAAACGAGCTCTGCCGATCTATCGTGAT ++CSHL__2_FC042NGABCD:8:1:103:1185 +2 30 25 4 2 8 0 10 3 23 12 22 34 15 36 8 14 17 22 9 0 40 22 30 32 40 40 40 31 33 35 40 40 40 40 40 diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_trimmer1.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_trimmer1.fasta Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,4 @@ +>CSHL__2_FC042NGABCD:8:1:120:202 +ACGATAGATCGGAAGAGCTAGTATGCCGTTTTCTGC +>CSHL__2_FC042NGABCD:8:1:103:1185 +ATCACGATAGATCGGCAGAGCTCGTTTACCGTCTTC diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_trimmer1.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_trimmer1.out Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,4 @@ +>CSHL__2_FC042NGABCD:8:1:120:202 +TAGATCGGAAGAGCTAGTATGCCGTTTTCTGC +>CSHL__2_FC042NGABCD:8:1:103:1185 +CGATAGATCGGCAGAGCTCGTTTACCGTCTTC diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_trimmer2.fastq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_trimmer2.fastq Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,8 @@ +@CSHL__2_FC042NGABCD:8:1:120:202 +ACGATAGATCGGAAGAGCTAGTATGCCGTTTTCTGC ++CSHL__2_FC042NGABCD:8:1:120:202 +40 40 40 40 20 40 40 40 40 6 40 40 28 40 40 25 40 20 40 -1 30 40 14 27 40 8 1 3 7 -1 11 10 -1 21 10 8 +@CSHL__2_FC042NGABCD:8:1:103:1185 +ATCACGATAGATCGGCAGAGCTCGTTTACCGTCTTC ++CSHL__2_FC042NGABCD:8:1:103:1185 +40 40 40 40 40 35 33 31 40 40 40 32 30 22 40 -0 9 22 17 14 8 36 15 34 22 12 23 3 10 -0 8 2 4 25 30 2 diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_trimmer2.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_trimmer2.out Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,8 @@ +@CSHL__2_FC042NGABCD:8:1:120:202 +ACGATAGATCGGAAGAGCTAGTATGCC ++CSHL__2_FC042NGABCD:8:1:120:202 +40 40 40 40 20 40 40 40 40 6 40 40 28 40 40 25 40 20 40 -1 30 40 14 27 40 8 1 +@CSHL__2_FC042NGABCD:8:1:103:1185 +ATCACGATAGATCGGCAGAGCTCGTTT ++CSHL__2_FC042NGABCD:8:1:103:1185 +40 40 40 40 40 35 33 31 40 40 40 32 30 22 40 0 9 22 17 14 8 36 15 34 22 12 23 diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tool-data/Makefile.am --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tool-data/Makefile.am Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,11 @@ +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +EXTRA_DIST = fastx_clipper_sequences.txt diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tool-data/Makefile.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tool-data/Makefile.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,317 @@ +# Makefile.in generated by automake 1.10.1 from Makefile.am. +# @configure_input@ + +# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, +# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This Makefile.in is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +@SET_MAKE@ + +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. +VPATH = @srcdir@ +pkgdatadir = $(datadir)/@PACKAGE@ +pkglibdir = $(libdir)/@PACKAGE@ +pkgincludedir = $(includedir)/@PACKAGE@ +am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd +install_sh_DATA = $(install_sh) -c -m 644 +install_sh_PROGRAM = $(install_sh) -c +install_sh_SCRIPT = $(install_sh) -c +INSTALL_HEADER = $(INSTALL_DATA) +transform = $(program_transform_name) +NORMAL_INSTALL = : +PRE_INSTALL = : +POST_INSTALL = : +NORMAL_UNINSTALL = : +PRE_UNINSTALL = : +POST_UNINSTALL = : +build_triplet = @build@ +host_triplet = @host@ +subdir = galaxy/tool-data +DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in +ACLOCAL_M4 = $(top_srcdir)/aclocal.m4 +am__aclocal_m4_deps = $(top_srcdir)/configure.ac +am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \ + $(ACLOCAL_M4) +mkinstalldirs = $(install_sh) -d +CONFIG_HEADER = $(top_builddir)/config.h +CONFIG_CLEAN_FILES = +SOURCES = +DIST_SOURCES = +DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST) +ACLOCAL = @ACLOCAL@ +AMTAR = @AMTAR@ +AUTOCONF = @AUTOCONF@ +AUTOHEADER = @AUTOHEADER@ +AUTOMAKE = @AUTOMAKE@ +AWK = @AWK@ +CC = @CC@ +CCDEPMODE = @CCDEPMODE@ +CFLAGS = @CFLAGS@ +CPP = @CPP@ +CPPFLAGS = @CPPFLAGS@ +CXX = @CXX@ +CXXCPP = @CXXCPP@ +CXXDEPMODE = @CXXDEPMODE@ +CXXFLAGS = @CXXFLAGS@ +CYGPATH_W = @CYGPATH_W@ +DEFS = @DEFS@ +DEPDIR = @DEPDIR@ +ECHO_C = @ECHO_C@ +ECHO_N = @ECHO_N@ +ECHO_T = @ECHO_T@ +EGREP = @EGREP@ +EXEEXT = @EXEEXT@ +GREP = @GREP@ +INSTALL = @INSTALL@ +INSTALL_DATA = @INSTALL_DATA@ +INSTALL_PROGRAM = @INSTALL_PROGRAM@ +INSTALL_SCRIPT = @INSTALL_SCRIPT@ +INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@ +LDFLAGS = @LDFLAGS@ +LIBOBJS = @LIBOBJS@ +LIBS = @LIBS@ +LTLIBOBJS = @LTLIBOBJS@ +MAKEINFO = @MAKEINFO@ +MKDIR_P = @MKDIR_P@ +OBJEXT = @OBJEXT@ +PACKAGE = @PACKAGE@ +PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@ +PACKAGE_NAME = @PACKAGE_NAME@ +PACKAGE_STRING = @PACKAGE_STRING@ +PACKAGE_TARNAME = @PACKAGE_TARNAME@ +PACKAGE_VERSION = @PACKAGE_VERSION@ +PATH_SEPARATOR = @PATH_SEPARATOR@ +RANLIB = @RANLIB@ +SET_MAKE = @SET_MAKE@ +SHELL = @SHELL@ +STRIP = @STRIP@ +VERSION = @VERSION@ +abs_builddir = @abs_builddir@ +abs_srcdir = @abs_srcdir@ +abs_top_builddir = @abs_top_builddir@ +abs_top_srcdir = @abs_top_srcdir@ +ac_ct_CC = @ac_ct_CC@ +ac_ct_CXX = @ac_ct_CXX@ +am__include = @am__include@ +am__leading_dot = @am__leading_dot@ +am__quote = @am__quote@ +am__tar = @am__tar@ +am__untar = @am__untar@ +bindir = @bindir@ +build = @build@ +build_alias = @build_alias@ +build_cpu = @build_cpu@ +build_os = @build_os@ +build_vendor = @build_vendor@ +builddir = @builddir@ +canonical_host_type = @canonical_host_type@ +datadir = @datadir@ +datarootdir = @datarootdir@ +docdir = @docdir@ +dvidir = @dvidir@ +exec_prefix = @exec_prefix@ +host = @host@ +host_alias = @host_alias@ +host_cpu = @host_cpu@ +host_os = @host_os@ +host_vendor = @host_vendor@ +htmldir = @htmldir@ +includedir = @includedir@ +infodir = @infodir@ +install_sh = @install_sh@ +libdir = @libdir@ +libexecdir = @libexecdir@ +localedir = @localedir@ +localstatedir = @localstatedir@ +mandir = @mandir@ +mkdir_p = @mkdir_p@ +oldincludedir = @oldincludedir@ +pdfdir = @pdfdir@ +prefix = @prefix@ +program_transform_name = @program_transform_name@ +psdir = @psdir@ +sbindir = @sbindir@ +sharedstatedir = @sharedstatedir@ +srcdir = @srcdir@ +sysconfdir = @sysconfdir@ +target_alias = @target_alias@ +top_builddir = @top_builddir@ +top_srcdir = @top_srcdir@ +EXTRA_DIST = fastx_clipper_sequences.txt +all: all-am + +.SUFFIXES: +$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps) + @for dep in $?; do \ + case '$(am__configure_deps)' in \ + *$$dep*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh \ + && exit 0; \ + exit 1;; \ + esac; \ + done; \ + echo ' cd $(top_srcdir) && $(AUTOMAKE) --gnu galaxy/tool-data/Makefile'; \ + cd $(top_srcdir) && \ + $(AUTOMAKE) --gnu galaxy/tool-data/Makefile +.PRECIOUS: Makefile +Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status + @case '$?' in \ + *config.status*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \ + *) \ + echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \ + cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \ + esac; + +$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +$(top_srcdir)/configure: $(am__configure_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +$(ACLOCAL_M4): $(am__aclocal_m4_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +tags: TAGS +TAGS: + +ctags: CTAGS +CTAGS: + + +distdir: $(DISTFILES) + @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + list='$(DISTFILES)'; \ + dist_files=`for file in $$list; do echo $$file; done | \ + sed -e "s|^$$srcdirstrip/||;t" \ + -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \ + case $$dist_files in \ + */*) $(MKDIR_P) `echo "$$dist_files" | \ + sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \ + sort -u` ;; \ + esac; \ + for file in $$dist_files; do \ + if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \ + if test -d $$d/$$file; then \ + dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \ + if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \ + cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \ + fi; \ + cp -pR $$d/$$file $(distdir)$$dir || exit 1; \ + else \ + test -f $(distdir)/$$file \ + || cp -p $$d/$$file $(distdir)/$$file \ + || exit 1; \ + fi; \ + done +check-am: all-am +check: check-am +all-am: Makefile +installdirs: +install: install-am +install-exec: install-exec-am +install-data: install-data-am +uninstall: uninstall-am + +install-am: all-am + @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am + +installcheck: installcheck-am +install-strip: + $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \ + install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \ + `test -z '$(STRIP)' || \ + echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install +mostlyclean-generic: + +clean-generic: + +distclean-generic: + -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES) + +maintainer-clean-generic: + @echo "This command is intended for maintainers to use" + @echo "it deletes files that may require special tools to rebuild." +clean: clean-am + +clean-am: clean-generic mostlyclean-am + +distclean: distclean-am + -rm -f Makefile +distclean-am: clean-am distclean-generic + +dvi: dvi-am + +dvi-am: + +html: html-am + +info: info-am + +info-am: + +install-data-am: + +install-dvi: install-dvi-am + +install-exec-am: + +install-html: install-html-am + +install-info: install-info-am + +install-man: + +install-pdf: install-pdf-am + +install-ps: install-ps-am + +installcheck-am: + +maintainer-clean: maintainer-clean-am + -rm -f Makefile +maintainer-clean-am: distclean-am maintainer-clean-generic + +mostlyclean: mostlyclean-am + +mostlyclean-am: mostlyclean-generic + +pdf: pdf-am + +pdf-am: + +ps: ps-am + +ps-am: + +uninstall-am: + +.MAKE: install-am install-strip + +.PHONY: all all-am check check-am clean clean-generic distclean \ + distclean-generic distdir dvi dvi-am html html-am info info-am \ + install install-am install-data install-data-am install-dvi \ + install-dvi-am install-exec install-exec-am install-html \ + install-html-am install-info install-info-am install-man \ + install-pdf install-pdf-am install-ps install-ps-am \ + install-strip installcheck installcheck-am installdirs \ + maintainer-clean maintainer-clean-generic mostlyclean \ + mostlyclean-generic pdf pdf-am ps ps-am uninstall uninstall-am + +# Tell versions [3.59,3.63) of GNU make to not export all variables. +# Otherwise a system limit (for SysV at least) may be exceeded. +.NOEXPORT: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tool-data/fastx_clipper_sequences.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tool-data/fastx_clipper_sequences.txt Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,13 @@ +# +# Adapter/Linker sequences for FASTX-Clipper tool. +# +# Format: +# Adapter Sequence Descriptive name +# +# Example: +# AAATTTGATAAGATA Our-Adapter +# +# Some adapters can be found here: +# http://seqanswers.com/forums/showthread.php?t=198 + +TGTAGGCC Dummy-Adapter (don't use me) diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/Makefile.am --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/Makefile.am Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,11 @@ +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +SUBDIRS = fastx_toolkit fastx_toolkit_with_gzip_and_output_label diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/Makefile.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/Makefile.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,475 @@ +# Makefile.in generated by automake 1.10.1 from Makefile.am. +# @configure_input@ + +# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, +# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This Makefile.in is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +@SET_MAKE@ + +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. +VPATH = @srcdir@ +pkgdatadir = $(datadir)/@PACKAGE@ +pkglibdir = $(libdir)/@PACKAGE@ +pkgincludedir = $(includedir)/@PACKAGE@ +am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd +install_sh_DATA = $(install_sh) -c -m 644 +install_sh_PROGRAM = $(install_sh) -c +install_sh_SCRIPT = $(install_sh) -c +INSTALL_HEADER = $(INSTALL_DATA) +transform = $(program_transform_name) +NORMAL_INSTALL = : +PRE_INSTALL = : +POST_INSTALL = : +NORMAL_UNINSTALL = : +PRE_UNINSTALL = : +POST_UNINSTALL = : +build_triplet = @build@ +host_triplet = @host@ +subdir = galaxy/tools +DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in +ACLOCAL_M4 = $(top_srcdir)/aclocal.m4 +am__aclocal_m4_deps = $(top_srcdir)/configure.ac +am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \ + $(ACLOCAL_M4) +mkinstalldirs = $(install_sh) -d +CONFIG_HEADER = $(top_builddir)/config.h +CONFIG_CLEAN_FILES = +SOURCES = +DIST_SOURCES = +RECURSIVE_TARGETS = all-recursive check-recursive dvi-recursive \ + html-recursive info-recursive install-data-recursive \ + install-dvi-recursive install-exec-recursive \ + install-html-recursive install-info-recursive \ + install-pdf-recursive install-ps-recursive install-recursive \ + installcheck-recursive installdirs-recursive pdf-recursive \ + ps-recursive uninstall-recursive +RECURSIVE_CLEAN_TARGETS = mostlyclean-recursive clean-recursive \ + distclean-recursive maintainer-clean-recursive +ETAGS = etags +CTAGS = ctags +DIST_SUBDIRS = $(SUBDIRS) +DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST) +ACLOCAL = @ACLOCAL@ +AMTAR = @AMTAR@ +AUTOCONF = @AUTOCONF@ +AUTOHEADER = @AUTOHEADER@ +AUTOMAKE = @AUTOMAKE@ +AWK = @AWK@ +CC = @CC@ +CCDEPMODE = @CCDEPMODE@ +CFLAGS = @CFLAGS@ +CPP = @CPP@ +CPPFLAGS = @CPPFLAGS@ +CXX = @CXX@ +CXXCPP = @CXXCPP@ +CXXDEPMODE = @CXXDEPMODE@ +CXXFLAGS = @CXXFLAGS@ +CYGPATH_W = @CYGPATH_W@ +DEFS = @DEFS@ +DEPDIR = @DEPDIR@ +ECHO_C = @ECHO_C@ +ECHO_N = @ECHO_N@ +ECHO_T = @ECHO_T@ +EGREP = @EGREP@ +EXEEXT = @EXEEXT@ +GREP = @GREP@ +INSTALL = @INSTALL@ +INSTALL_DATA = @INSTALL_DATA@ +INSTALL_PROGRAM = @INSTALL_PROGRAM@ +INSTALL_SCRIPT = @INSTALL_SCRIPT@ +INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@ +LDFLAGS = @LDFLAGS@ +LIBOBJS = @LIBOBJS@ +LIBS = @LIBS@ +LTLIBOBJS = @LTLIBOBJS@ +MAKEINFO = @MAKEINFO@ +MKDIR_P = @MKDIR_P@ +OBJEXT = @OBJEXT@ +PACKAGE = @PACKAGE@ +PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@ +PACKAGE_NAME = @PACKAGE_NAME@ +PACKAGE_STRING = @PACKAGE_STRING@ +PACKAGE_TARNAME = @PACKAGE_TARNAME@ +PACKAGE_VERSION = @PACKAGE_VERSION@ +PATH_SEPARATOR = @PATH_SEPARATOR@ +RANLIB = @RANLIB@ +SET_MAKE = @SET_MAKE@ +SHELL = @SHELL@ +STRIP = @STRIP@ +VERSION = @VERSION@ +abs_builddir = @abs_builddir@ +abs_srcdir = @abs_srcdir@ +abs_top_builddir = @abs_top_builddir@ +abs_top_srcdir = @abs_top_srcdir@ +ac_ct_CC = @ac_ct_CC@ +ac_ct_CXX = @ac_ct_CXX@ +am__include = @am__include@ +am__leading_dot = @am__leading_dot@ +am__quote = @am__quote@ +am__tar = @am__tar@ +am__untar = @am__untar@ +bindir = @bindir@ +build = @build@ +build_alias = @build_alias@ +build_cpu = @build_cpu@ +build_os = @build_os@ +build_vendor = @build_vendor@ +builddir = @builddir@ +canonical_host_type = @canonical_host_type@ +datadir = @datadir@ +datarootdir = @datarootdir@ +docdir = @docdir@ +dvidir = @dvidir@ +exec_prefix = @exec_prefix@ +host = @host@ +host_alias = @host_alias@ +host_cpu = @host_cpu@ +host_os = @host_os@ +host_vendor = @host_vendor@ +htmldir = @htmldir@ +includedir = @includedir@ +infodir = @infodir@ +install_sh = @install_sh@ +libdir = @libdir@ +libexecdir = @libexecdir@ +localedir = @localedir@ +localstatedir = @localstatedir@ +mandir = @mandir@ +mkdir_p = @mkdir_p@ +oldincludedir = @oldincludedir@ +pdfdir = @pdfdir@ +prefix = @prefix@ +program_transform_name = @program_transform_name@ +psdir = @psdir@ +sbindir = @sbindir@ +sharedstatedir = @sharedstatedir@ +srcdir = @srcdir@ +sysconfdir = @sysconfdir@ +target_alias = @target_alias@ +top_builddir = @top_builddir@ +top_srcdir = @top_srcdir@ +SUBDIRS = fastx_toolkit fastx_toolkit_with_gzip_and_output_label +all: all-recursive + +.SUFFIXES: +$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps) + @for dep in $?; do \ + case '$(am__configure_deps)' in \ + *$$dep*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh \ + && exit 0; \ + exit 1;; \ + esac; \ + done; \ + echo ' cd $(top_srcdir) && $(AUTOMAKE) --gnu galaxy/tools/Makefile'; \ + cd $(top_srcdir) && \ + $(AUTOMAKE) --gnu galaxy/tools/Makefile +.PRECIOUS: Makefile +Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status + @case '$?' in \ + *config.status*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \ + *) \ + echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \ + cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \ + esac; + +$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +$(top_srcdir)/configure: $(am__configure_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +$(ACLOCAL_M4): $(am__aclocal_m4_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +# This directory's subdirectories are mostly independent; you can cd +# into them and run `make' without going through this Makefile. +# To change the values of `make' variables: instead of editing Makefiles, +# (1) if the variable is set in `config.status', edit `config.status' +# (which will cause the Makefiles to be regenerated when you run `make'); +# (2) otherwise, pass the desired values on the `make' command line. +$(RECURSIVE_TARGETS): + @failcom='exit 1'; \ + for f in x $$MAKEFLAGS; do \ + case $$f in \ + *=* | --[!k]*);; \ + *k*) failcom='fail=yes';; \ + esac; \ + done; \ + dot_seen=no; \ + target=`echo $@ | sed s/-recursive//`; \ + list='$(SUBDIRS)'; for subdir in $$list; do \ + echo "Making $$target in $$subdir"; \ + if test "$$subdir" = "."; then \ + dot_seen=yes; \ + local_target="$$target-am"; \ + else \ + local_target="$$target"; \ + fi; \ + (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) $$local_target) \ + || eval $$failcom; \ + done; \ + if test "$$dot_seen" = "no"; then \ + $(MAKE) $(AM_MAKEFLAGS) "$$target-am" || exit 1; \ + fi; test -z "$$fail" + +$(RECURSIVE_CLEAN_TARGETS): + @failcom='exit 1'; \ + for f in x $$MAKEFLAGS; do \ + case $$f in \ + *=* | --[!k]*);; \ + *k*) failcom='fail=yes';; \ + esac; \ + done; \ + dot_seen=no; \ + case "$@" in \ + distclean-* | maintainer-clean-*) list='$(DIST_SUBDIRS)' ;; \ + *) list='$(SUBDIRS)' ;; \ + esac; \ + rev=''; for subdir in $$list; do \ + if test "$$subdir" = "."; then :; else \ + rev="$$subdir $$rev"; \ + fi; \ + done; \ + rev="$$rev ."; \ + target=`echo $@ | sed s/-recursive//`; \ + for subdir in $$rev; do \ + echo "Making $$target in $$subdir"; \ + if test "$$subdir" = "."; then \ + local_target="$$target-am"; \ + else \ + local_target="$$target"; \ + fi; \ + (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) $$local_target) \ + || eval $$failcom; \ + done && test -z "$$fail" +tags-recursive: + list='$(SUBDIRS)'; for subdir in $$list; do \ + test "$$subdir" = . || (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) tags); \ + done +ctags-recursive: + list='$(SUBDIRS)'; for subdir in $$list; do \ + test "$$subdir" = . || (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) ctags); \ + done + +ID: $(HEADERS) $(SOURCES) $(LISP) $(TAGS_FILES) + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonemtpy = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + mkid -fID $$unique +tags: TAGS + +TAGS: tags-recursive $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + here=`pwd`; \ + if ($(ETAGS) --etags-include --version) >/dev/null 2>&1; then \ + include_option=--etags-include; \ + empty_fix=.; \ + else \ + include_option=--include; \ + empty_fix=; \ + fi; \ + list='$(SUBDIRS)'; for subdir in $$list; do \ + if test "$$subdir" = .; then :; else \ + test ! -f $$subdir/TAGS || \ + tags="$$tags $$include_option=$$here/$$subdir/TAGS"; \ + fi; \ + done; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + if test -z "$(ETAGS_ARGS)$$tags$$unique"; then :; else \ + test -n "$$unique" || unique=$$empty_fix; \ + $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \ + $$tags $$unique; \ + fi +ctags: CTAGS +CTAGS: ctags-recursive $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + test -z "$(CTAGS_ARGS)$$tags$$unique" \ + || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \ + $$tags $$unique + +GTAGS: + here=`$(am__cd) $(top_builddir) && pwd` \ + && cd $(top_srcdir) \ + && gtags -i $(GTAGS_ARGS) $$here + +distclean-tags: + -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags + +distdir: $(DISTFILES) + @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + list='$(DISTFILES)'; \ + dist_files=`for file in $$list; do echo $$file; done | \ + sed -e "s|^$$srcdirstrip/||;t" \ + -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \ + case $$dist_files in \ + */*) $(MKDIR_P) `echo "$$dist_files" | \ + sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \ + sort -u` ;; \ + esac; \ + for file in $$dist_files; do \ + if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \ + if test -d $$d/$$file; then \ + dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \ + if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \ + cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \ + fi; \ + cp -pR $$d/$$file $(distdir)$$dir || exit 1; \ + else \ + test -f $(distdir)/$$file \ + || cp -p $$d/$$file $(distdir)/$$file \ + || exit 1; \ + fi; \ + done + list='$(DIST_SUBDIRS)'; for subdir in $$list; do \ + if test "$$subdir" = .; then :; else \ + test -d "$(distdir)/$$subdir" \ + || $(MKDIR_P) "$(distdir)/$$subdir" \ + || exit 1; \ + distdir=`$(am__cd) $(distdir) && pwd`; \ + top_distdir=`$(am__cd) $(top_distdir) && pwd`; \ + (cd $$subdir && \ + $(MAKE) $(AM_MAKEFLAGS) \ + top_distdir="$$top_distdir" \ + distdir="$$distdir/$$subdir" \ + am__remove_distdir=: \ + am__skip_length_check=: \ + distdir) \ + || exit 1; \ + fi; \ + done +check-am: all-am +check: check-recursive +all-am: Makefile +installdirs: installdirs-recursive +installdirs-am: +install: install-recursive +install-exec: install-exec-recursive +install-data: install-data-recursive +uninstall: uninstall-recursive + +install-am: all-am + @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am + +installcheck: installcheck-recursive +install-strip: + $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \ + install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \ + `test -z '$(STRIP)' || \ + echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install +mostlyclean-generic: + +clean-generic: + +distclean-generic: + -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES) + +maintainer-clean-generic: + @echo "This command is intended for maintainers to use" + @echo "it deletes files that may require special tools to rebuild." +clean: clean-recursive + +clean-am: clean-generic mostlyclean-am + +distclean: distclean-recursive + -rm -f Makefile +distclean-am: clean-am distclean-generic distclean-tags + +dvi: dvi-recursive + +dvi-am: + +html: html-recursive + +info: info-recursive + +info-am: + +install-data-am: + +install-dvi: install-dvi-recursive + +install-exec-am: + +install-html: install-html-recursive + +install-info: install-info-recursive + +install-man: + +install-pdf: install-pdf-recursive + +install-ps: install-ps-recursive + +installcheck-am: + +maintainer-clean: maintainer-clean-recursive + -rm -f Makefile +maintainer-clean-am: distclean-am maintainer-clean-generic + +mostlyclean: mostlyclean-recursive + +mostlyclean-am: mostlyclean-generic + +pdf: pdf-recursive + +pdf-am: + +ps: ps-recursive + +ps-am: + +uninstall-am: + +.MAKE: $(RECURSIVE_CLEAN_TARGETS) $(RECURSIVE_TARGETS) install-am \ + install-strip + +.PHONY: $(RECURSIVE_CLEAN_TARGETS) $(RECURSIVE_TARGETS) CTAGS GTAGS \ + all all-am check check-am clean clean-generic ctags \ + ctags-recursive distclean distclean-generic distclean-tags \ + distdir dvi dvi-am html html-am info info-am install \ + install-am install-data install-data-am install-dvi \ + install-dvi-am install-exec install-exec-am install-html \ + install-html-am install-info install-info-am install-man \ + install-pdf install-pdf-am install-ps install-ps-am \ + install-strip installcheck installcheck-am installdirs \ + installdirs-am maintainer-clean maintainer-clean-generic \ + mostlyclean mostlyclean-generic pdf pdf-am ps ps-am tags \ + tags-recursive uninstall uninstall-am + +# Tell versions [3.59,3.63) of GNU make to not export all variables. +# Otherwise a system limit (for SysV at least) may be exceeded. +.NOEXPORT: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/Makefile.am --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/Makefile.am Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,23 @@ +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +EXTRA_DIST = fastq_quality_converter.xml \ + fastq_quality_filter.xml \ + fastx_quality_statistics.xml \ + fastq_to_fasta.xml \ + fastx_artifacts_filter.xml \ + fastx_clipper.xml \ + fastx_reverse_complement.xml \ + fastx_trimmer.xml \ + fastx_barcode_splitter.xml \ + fastx_nucleotides_distribution.xml \ + fastq_quality_boxplot.xml \ + fasta_clipping_histogram.xml \ + fastx_collapser.xml diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/Makefile.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/Makefile.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,330 @@ +# Makefile.in generated by automake 1.10.1 from Makefile.am. +# @configure_input@ + +# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, +# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This Makefile.in is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +@SET_MAKE@ + +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. +VPATH = @srcdir@ +pkgdatadir = $(datadir)/@PACKAGE@ +pkglibdir = $(libdir)/@PACKAGE@ +pkgincludedir = $(includedir)/@PACKAGE@ +am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd +install_sh_DATA = $(install_sh) -c -m 644 +install_sh_PROGRAM = $(install_sh) -c +install_sh_SCRIPT = $(install_sh) -c +INSTALL_HEADER = $(INSTALL_DATA) +transform = $(program_transform_name) +NORMAL_INSTALL = : +PRE_INSTALL = : +POST_INSTALL = : +NORMAL_UNINSTALL = : +PRE_UNINSTALL = : +POST_UNINSTALL = : +build_triplet = @build@ +host_triplet = @host@ +subdir = galaxy/tools/fastx_toolkit +DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in +ACLOCAL_M4 = $(top_srcdir)/aclocal.m4 +am__aclocal_m4_deps = $(top_srcdir)/configure.ac +am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \ + $(ACLOCAL_M4) +mkinstalldirs = $(install_sh) -d +CONFIG_HEADER = $(top_builddir)/config.h +CONFIG_CLEAN_FILES = +SOURCES = +DIST_SOURCES = +DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST) +ACLOCAL = @ACLOCAL@ +AMTAR = @AMTAR@ +AUTOCONF = @AUTOCONF@ +AUTOHEADER = @AUTOHEADER@ +AUTOMAKE = @AUTOMAKE@ +AWK = @AWK@ +CC = @CC@ +CCDEPMODE = @CCDEPMODE@ +CFLAGS = @CFLAGS@ +CPP = @CPP@ +CPPFLAGS = @CPPFLAGS@ +CXX = @CXX@ +CXXCPP = @CXXCPP@ +CXXDEPMODE = @CXXDEPMODE@ +CXXFLAGS = @CXXFLAGS@ +CYGPATH_W = @CYGPATH_W@ +DEFS = @DEFS@ +DEPDIR = @DEPDIR@ +ECHO_C = @ECHO_C@ +ECHO_N = @ECHO_N@ +ECHO_T = @ECHO_T@ +EGREP = @EGREP@ +EXEEXT = @EXEEXT@ +GREP = @GREP@ +INSTALL = @INSTALL@ +INSTALL_DATA = @INSTALL_DATA@ +INSTALL_PROGRAM = @INSTALL_PROGRAM@ +INSTALL_SCRIPT = @INSTALL_SCRIPT@ +INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@ +LDFLAGS = @LDFLAGS@ +LIBOBJS = @LIBOBJS@ +LIBS = @LIBS@ +LTLIBOBJS = @LTLIBOBJS@ +MAKEINFO = @MAKEINFO@ +MKDIR_P = @MKDIR_P@ +OBJEXT = @OBJEXT@ +PACKAGE = @PACKAGE@ +PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@ +PACKAGE_NAME = @PACKAGE_NAME@ +PACKAGE_STRING = @PACKAGE_STRING@ +PACKAGE_TARNAME = @PACKAGE_TARNAME@ +PACKAGE_VERSION = @PACKAGE_VERSION@ +PATH_SEPARATOR = @PATH_SEPARATOR@ +RANLIB = @RANLIB@ +SET_MAKE = @SET_MAKE@ +SHELL = @SHELL@ +STRIP = @STRIP@ +VERSION = @VERSION@ +abs_builddir = @abs_builddir@ +abs_srcdir = @abs_srcdir@ +abs_top_builddir = @abs_top_builddir@ +abs_top_srcdir = @abs_top_srcdir@ +ac_ct_CC = @ac_ct_CC@ +ac_ct_CXX = @ac_ct_CXX@ +am__include = @am__include@ +am__leading_dot = @am__leading_dot@ +am__quote = @am__quote@ +am__tar = @am__tar@ +am__untar = @am__untar@ +bindir = @bindir@ +build = @build@ +build_alias = @build_alias@ +build_cpu = @build_cpu@ +build_os = @build_os@ +build_vendor = @build_vendor@ +builddir = @builddir@ +canonical_host_type = @canonical_host_type@ +datadir = @datadir@ +datarootdir = @datarootdir@ +docdir = @docdir@ +dvidir = @dvidir@ +exec_prefix = @exec_prefix@ +host = @host@ +host_alias = @host_alias@ +host_cpu = @host_cpu@ +host_os = @host_os@ +host_vendor = @host_vendor@ +htmldir = @htmldir@ +includedir = @includedir@ +infodir = @infodir@ +install_sh = @install_sh@ +libdir = @libdir@ +libexecdir = @libexecdir@ +localedir = @localedir@ +localstatedir = @localstatedir@ +mandir = @mandir@ +mkdir_p = @mkdir_p@ +oldincludedir = @oldincludedir@ +pdfdir = @pdfdir@ +prefix = @prefix@ +program_transform_name = @program_transform_name@ +psdir = @psdir@ +sbindir = @sbindir@ +sharedstatedir = @sharedstatedir@ +srcdir = @srcdir@ +sysconfdir = @sysconfdir@ +target_alias = @target_alias@ +top_builddir = @top_builddir@ +top_srcdir = @top_srcdir@ +EXTRA_DIST = fastq_quality_converter.xml \ + fastq_quality_filter.xml \ + fastx_quality_statistics.xml \ + fastq_to_fasta.xml \ + fastx_artifacts_filter.xml \ + fastx_clipper.xml \ + fastx_reverse_complement.xml \ + fastx_trimmer.xml \ + fastx_barcode_splitter.xml \ + fastx_nucleotides_distribution.xml \ + fastq_quality_boxplot.xml \ + fasta_clipping_histogram.xml \ + fastx_collapser.xml + +all: all-am + +.SUFFIXES: +$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps) + @for dep in $?; do \ + case '$(am__configure_deps)' in \ + *$$dep*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh \ + && exit 0; \ + exit 1;; \ + esac; \ + done; \ + echo ' cd $(top_srcdir) && $(AUTOMAKE) --gnu galaxy/tools/fastx_toolkit/Makefile'; \ + cd $(top_srcdir) && \ + $(AUTOMAKE) --gnu galaxy/tools/fastx_toolkit/Makefile +.PRECIOUS: Makefile +Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status + @case '$?' in \ + *config.status*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \ + *) \ + echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \ + cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \ + esac; + +$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +$(top_srcdir)/configure: $(am__configure_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +$(ACLOCAL_M4): $(am__aclocal_m4_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +tags: TAGS +TAGS: + +ctags: CTAGS +CTAGS: + + +distdir: $(DISTFILES) + @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + list='$(DISTFILES)'; \ + dist_files=`for file in $$list; do echo $$file; done | \ + sed -e "s|^$$srcdirstrip/||;t" \ + -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \ + case $$dist_files in \ + */*) $(MKDIR_P) `echo "$$dist_files" | \ + sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \ + sort -u` ;; \ + esac; \ + for file in $$dist_files; do \ + if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \ + if test -d $$d/$$file; then \ + dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \ + if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \ + cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \ + fi; \ + cp -pR $$d/$$file $(distdir)$$dir || exit 1; \ + else \ + test -f $(distdir)/$$file \ + || cp -p $$d/$$file $(distdir)/$$file \ + || exit 1; \ + fi; \ + done +check-am: all-am +check: check-am +all-am: Makefile +installdirs: +install: install-am +install-exec: install-exec-am +install-data: install-data-am +uninstall: uninstall-am + +install-am: all-am + @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am + +installcheck: installcheck-am +install-strip: + $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \ + install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \ + `test -z '$(STRIP)' || \ + echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install +mostlyclean-generic: + +clean-generic: + +distclean-generic: + -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES) + +maintainer-clean-generic: + @echo "This command is intended for maintainers to use" + @echo "it deletes files that may require special tools to rebuild." +clean: clean-am + +clean-am: clean-generic mostlyclean-am + +distclean: distclean-am + -rm -f Makefile +distclean-am: clean-am distclean-generic + +dvi: dvi-am + +dvi-am: + +html: html-am + +info: info-am + +info-am: + +install-data-am: + +install-dvi: install-dvi-am + +install-exec-am: + +install-html: install-html-am + +install-info: install-info-am + +install-man: + +install-pdf: install-pdf-am + +install-ps: install-ps-am + +installcheck-am: + +maintainer-clean: maintainer-clean-am + -rm -f Makefile +maintainer-clean-am: distclean-am maintainer-clean-generic + +mostlyclean: mostlyclean-am + +mostlyclean-am: mostlyclean-generic + +pdf: pdf-am + +pdf-am: + +ps: ps-am + +ps-am: + +uninstall-am: + +.MAKE: install-am install-strip + +.PHONY: all all-am check check-am clean clean-generic distclean \ + distclean-generic distdir dvi dvi-am html html-am info info-am \ + install install-am install-data install-data-am install-dvi \ + install-dvi-am install-exec install-exec-am install-html \ + install-html-am install-info install-info-am install-man \ + install-pdf install-pdf-am install-ps install-ps-am \ + install-strip installcheck installcheck-am installdirs \ + maintainer-clean maintainer-clean-generic mostlyclean \ + mostlyclean-generic pdf pdf-am ps ps-am uninstall uninstall-am + +# Tell versions [3.59,3.63) of GNU make to not export all variables. +# Otherwise a system limit (for SysV at least) may be exceeded. +.NOEXPORT: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fasta_clipping_histogram.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fasta_clipping_histogram.xml Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,38 @@ + + chart + fasta_clipping_histogram.pl $input $outfile + + + + + + + + + + +**What it does** + +This tool creates a histogram image of sequence lengths distribution in a given fasta data set file. + +**TIP:** Use this tool after clipping your library (with **FASTX Clipper tool**), to visualize the clipping results. + +----- + +**Output Examples** + + +In the following library, most sequences are 24-mers to 27-mers. +This could indicate an abundance of endo-siRNAs (depending of course of what you've tried to sequence in the first place). + +.. image:: ./static/fastx_icons/fasta_clipping_histogram_1.png + + +In the following library, most sequences are 19,22 or 23-mers. +This could indicate an abundance of miRNAs (depending of course of what you've tried to sequence in the first place). + +.. image:: ./static/fastx_icons/fasta_clipping_histogram_2.png + + + + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastq_quality_boxplot.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastq_quality_boxplot.xml Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,47 @@ + + chart + + fastq_quality_boxplot_graph.sh -t '$input.name' -i $input -o $output + + + + + + + + + + +**What it does** + +Creates a boxplot graph for the quality scores in the library. + +.. class:: infomark + +**TIP:** Use the **FASTQ Statistics** tool to generate the report file needed for this tool. + +----- + +**Output Examples** + +* Black horizontal lines are medians +* Rectangular red boxes show the Inter-quartile Range (IQR) (top value is Q3, bottom value is Q1) +* Whiskers show outlier at max. 1.5*IQR + + +An excellent quality library (median quality is 40 for almost all 36 cycles): + +.. image:: ./static/fastx_icons/fastq_quality_boxplot_1.png + + +A relatively good quality library (median quality degrades towards later cycles): + +.. image:: ./static/fastx_icons/fastq_quality_boxplot_2.png + +A low quality library (median drops quickly): + +.. image:: ./static/fastx_icons/fastq_quality_boxplot_3.png + + + + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastq_quality_converter.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastq_quality_converter.xml Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,82 @@ + + (ASCII-Numeric) + zcat -f $input | fastq_quality_converter $QUAL_FORMAT -o $output + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +**What it does** + +Converts a solexa FASTQ file to/from numeric or ASCII quality format. + +.. class:: warningmark + +Re-scaling is **not** performed. (e.g. conversion from Phred scale to Solexa scale). + + +----- + +FASTQ with Numeric quality scores:: + + @CSHL__2_FC042AGWWWXX:8:1:120:202 + ACGATAGATCGGAAGAGCTAGTATGCCGTTTTCTGC + +CSHL__2_FC042AGWWWXX:8:1:120:202 + 40 40 40 40 20 40 40 40 40 6 40 40 28 40 40 25 40 20 40 -1 30 40 14 27 40 8 1 3 7 -1 11 10 -1 21 10 8 + @CSHL__2_FC042AGWWWXX:8:1:103:1185 + ATCACGATAGATCGGCAGAGCTCGTTTACCGTCTTC + +CSHL__2_FC042AGWWWXX:8:1:103:1185 + 40 40 40 40 40 35 33 31 40 40 40 32 30 22 40 -0 9 22 17 14 8 36 15 34 22 12 23 3 10 -0 8 2 4 25 30 2 + + +FASTQ with ASCII quality scores:: + + @CSHL__2_FC042AGWWWXX:8:1:120:202 + ACGATAGATCGGAAGAGCTAGTATGCCGTTTTCTGC + +CSHL__2_FC042AGWWWXX:8:1:120:202 + hhhhThhhhFhh\hhYhTh?^hN[hHACG?KJ?UJH + @CSHL__2_FC042AGWWWXX:8:1:103:1185 + ATCACGATAGATCGGCAGAGCTCGTTTACCGTCTTC + +CSHL__2_FC042AGWWWXX:8:1:103:1185 + hhhhhca_hhh`^Vh@IVQNHdObVLWCJ@HBDY^B + + + + + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastq_quality_filter.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastq_quality_filter.xml Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,73 @@ + + + + zcat -f '$input' | fastq_quality_filter -q $quality -p $percent -v -o $output + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +**What it does** + +This tool filters reads based on quality scores. + +.. class:: infomark + +Using **percent = 100** requires all cycles of all reads to be at least the quality cut-off value. + +.. class:: infomark + +Using **percent = 50** requires the median quality of the cycles (in each read) to be at least the quality cut-off value. + +-------- + +Quality score distribution (of all cycles) is calculated for each read. If it is lower than the quality cut-off value - the read is discarded. + + +**Example**:: + + @CSHL_4_FC042AGOOII:1:2:214:584 + GACAATAAAC + +CSHL_4_FC042AGOOII:1:2:214:584 + 30 30 30 30 30 30 30 30 20 10 + +Using **percent = 50** and **cut-off = 30** - This read will not be discarded (the median quality is higher than 30). + +Using **percent = 90** and **cut-off = 30** - This read will be discarded (90% of the cycles do no have quality equal to / higher than 30). + +Using **percent = 100** and **cut-off = 20** - This read will be discarded (not all cycles have quality equal to / higher than 20). + + + + + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastq_to_fasta.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastq_to_fasta.xml Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,70 @@ + + converter + gunzip -cf $input | fastq_to_fasta $SKIPN $RENAMESEQ -o $output -v + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +**What it does** + +This tool converts data from Solexa format to FASTA format (scroll down for format description). + +-------- + +**Example** + +The following data in Solexa-FASTQ format:: + + @CSHL_4_FC042GAMMII_2_1_517_596 + GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT + +CSHL_4_FC042GAMMII_2_1_517_596 + 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 + +Will be converted to FASTA (with 'rename sequence names' = NO):: + + >CSHL_4_FC042GAMMII_2_1_517_596 + GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT + +Will be converted to FASTA (with 'rename sequence names' = YES):: + + >1 + GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT + + + + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_artifacts_filter.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_artifacts_filter.xml Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,80 @@ + + + zcat -f '$input' | fastx_artifacts_filter -v -o "$output" + + + + + + + + + + + + + + + + + + + + + + + +**What it does** + +This tool filters sequencing artifacts (reads with all but 3 identical bases). + +-------- + +**The following is an example of sequences which will be filtered out**:: + + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAACACAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + AAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC + AAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAA + AAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAA + AAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAA + AAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAA + AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAA + + + + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_barcode_splitter.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_barcode_splitter.xml Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,68 @@ + + + fastx_barcode_splitter_galaxy_wrapper.sh $BARCODE $input "$input.name" --mismatches $mismatches --partial $partial $EOL > $output + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +**What it does** + +This tool splits a solexa library (FASTQ file) or a regular FASTA file to several files, using barcodes as the split criteria. + +-------- + +**Barcode file Format** + +Barcode files are simple text files. +Each line should contain an identifier (descriptive name for the barcode), and the barcode itself (A/C/G/T), separated by a TAB character. +Example:: + + #This line is a comment (starts with a 'number' sign) + BC1 GATCT + BC2 ATCGT + BC3 GTGAT + BC4 TGTCT + +For each barcode, a new FASTQ file will be created (with the barcode's identifier as part of the file name). +Sequences matching the barcode will be stored in the appropriate file. + +One additional FASTQ file will be created (the 'unmatched' file), where sequences not matching any barcode will be stored. + +The output of this tool is an HTML file, displaying the split counts and the file locations. + +**Output Example** + +.. image:: ./static/fastx_icons/barcode_splitter_output_example.png + + + + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_clipper.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_clipper.xml Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,109 @@ + + adapter sequences + + zcat -f $input | fastx_clipper -s $maxmismatches -l $minlength -a $clip_source.clip_sequence -d $keepdelta -o $output -v $KEEP_N $DISCARD_OPTIONS + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + use this for hairpin barcoding. keep at 0 unless you know what you're doing. + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +**What it does** + +This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file. + +-------- + + +**Clipping Illustration:** + +.. image:: ./static/fastx_icons/fastx_clipper_illustration.png + + + + + + + + +**Clipping Example:** + +.. image:: ./static/fastx_icons/fastx_clipper_example.png + + + +**In the above example:** + +* Sequence no. 1 was discarded since it wasn't clipped (i.e. didn't contain the adapter sequence). (**Output** parameter). +* Sequence no. 5 was discarded --- it's length (after clipping) was shorter than 15 nt (**Minimum Sequence Length** parameter). + + + + + + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_collapser.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_collapser.xml Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,75 @@ + + sequences + zcat -f '$input' | fastx_collapser -v -o '$output' + + + + + + + + + + + + + + + + + +**What it does** + +This tool collapses identical sequences in a FASTA file into a single sequence. + +-------- + +**Example** + +Example Input File (Sequence "ATAT" appears multiple times):: + + >CSHL_2_FC0042AGLLOO_1_1_605_414 + TGCG + >CSHL_2_FC0042AGLLOO_1_1_537_759 + ATAT + >CSHL_2_FC0042AGLLOO_1_1_774_520 + TGGC + >CSHL_2_FC0042AGLLOO_1_1_742_502 + ATAT + >CSHL_2_FC0042AGLLOO_1_1_781_514 + TGAG + >CSHL_2_FC0042AGLLOO_1_1_757_487 + TTCA + >CSHL_2_FC0042AGLLOO_1_1_903_769 + ATAT + >CSHL_2_FC0042AGLLOO_1_1_724_499 + ATAT + +Example Output file:: + + >1-1 + TGCG + >2-4 + ATAT + >3-1 + TGGC + >4-1 + TGAG + >5-1 + TTCA + +.. class:: infomark + +Original Sequence Names / Lane descriptions (e.g. "CSHL_2_FC0042AGLLOO_1_1_742_502") are discarded. + +The output seqeunce name is composed of two numbers: the first is the sequence's number, the second is the multiplicity value. + +The following output:: + + >2-4 + ATAT + +means that the sequence "ATAT" is the second sequence in the file, and it appeared 4 times in the input FASTA file. + + + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_nucleotides_distribution.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_nucleotides_distribution.xml Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,66 @@ + + chart + fastx_nucleotide_distribution_graph.sh -t '$input.name' -i $input -o $output + + + + + + + + + + +**What it does** + +Creates a stacked-histogram graph for the nucleotide distribution in the Solexa library. + +.. class:: infomark + +**TIP:** Use the **FASTQ Statistics** tool to generate the report file needed for this tool. + +----- + +**Output Examples** + + + +The following chart clearly shows the barcode used at the 5'-end of the library: **GATCT** + +.. image:: ./static/fastx_icons/fastq_nucleotides_distribution_1.png + + + + + + + +In the following chart, one can almost 'read' the most abundant sequence by looking at the dominant values: **TGATA TCGTA TTGAT GACTG AA...** + +.. image:: ./static/fastx_icons/fastq_nucleotides_distribution_2.png + + + + + + + + +The following chart shows a growing number of unknown (N) nucleotides towards later cycles (which might indicate a sequencing problem): + +.. image:: ./static/fastx_icons/fastq_nucleotides_distribution_3.png + + + + + + + + +But most of the time, the chart will look rather random: + +.. image:: ./static/fastx_icons/fastq_nucleotides_distribution_4.png + + + + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_quality_statistics.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_quality_statistics.xml Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,100 @@ + + + zcat -f $input | fastx_quality_stats -o $output + + + + + + + + + + + + + + + + + + +**What it does** + +Creates quality statistics report for the given Solexa/FASTQ library. + +.. class:: infomark + +**TIP:** This statistics report can be used as input for **Quality Score** and **Nucleotides Distribution** tools. + +----- + +**The output file will contain the following fields:** + +* column = column number (1 to 36 for a 36-cycles read solexa file) +* count = number of bases found in this column. +* min = Lowest quality score value found in this column. +* max = Highest quality score value found in this column. +* sum = Sum of quality score values for this column. +* mean = Mean quality score value for this column. +* Q1 = 1st quartile quality score. +* med = Median quality score. +* Q3 = 3rd quartile quality score. +* IQR = Inter-Quartile range (Q3-Q1). +* lW = 'Left-Whisker' value (for boxplotting). +* rW = 'Right-Whisker' value (for boxplotting). +* A_Count = Count of 'A' nucleotides found in this column. +* C_Count = Count of 'C' nucleotides found in this column. +* G_Count = Count of 'G' nucleotides found in this column. +* T_Count = Count of 'T' nucleotides found in this column. +* N_Count = Count of 'N' nucleotides found in this column. + + + + + + +**Output Example**:: + + column count min max sum mean Q1 med Q3 IQR lW rW A_Count C_Count G_Count T_Count N_Count + 1 6362991 -4 40 250734117 39.41 40 40 40 0 40 40 1396976 1329101 678730 2958184 0 + 2 6362991 -5 40 250531036 39.37 40 40 40 0 40 40 1786786 1055766 1738025 1782414 0 + 3 6362991 -5 40 248722469 39.09 40 40 40 0 40 40 2296384 984875 1443989 1637743 0 + 4 6362991 -5 40 247654797 38.92 40 40 40 0 40 40 1683197 1410855 1722633 1546306 0 + 5 6362991 -4 40 248214827 39.01 40 40 40 0 40 40 2536861 1167423 1248968 1409739 0 + 6 6362991 -5 40 248499903 39.05 40 40 40 0 40 40 1598956 1236081 1568608 1959346 0 + 7 6362991 -4 40 247719760 38.93 40 40 40 0 40 40 1692667 1822140 1496741 1351443 0 + 8 6362991 -5 40 245745205 38.62 40 40 40 0 40 40 2230936 1343260 1529928 1258867 0 + 9 6362991 -5 40 245766735 38.62 40 40 40 0 40 40 1702064 1306257 1336511 2018159 0 + 10 6362991 -5 40 245089706 38.52 40 40 40 0 40 40 1519917 1446370 1450995 1945709 0 + 11 6362991 -5 40 242641359 38.13 40 40 40 0 40 40 1717434 1282975 1387804 1974778 0 + 12 6362991 -5 40 242026113 38.04 40 40 40 0 40 40 1662872 1202041 1519721 1978357 0 + 13 6362991 -5 40 238704245 37.51 40 40 40 0 40 40 1549965 1271411 1973291 1566681 1643 + 14 6362991 -5 40 235622401 37.03 40 40 40 0 40 40 2101301 1141451 1603990 1515774 475 + 15 6362991 -5 40 230766669 36.27 40 40 40 0 40 40 2344003 1058571 1440466 1519865 86 + 16 6362991 -5 40 224466237 35.28 38 40 40 2 35 40 2203515 1026017 1474060 1651582 7817 + 17 6362991 -5 40 219990002 34.57 34 40 40 6 25 40 1522515 1125455 2159183 1555765 73 + 18 6362991 -5 40 214104778 33.65 30 40 40 10 15 40 1479795 2068113 1558400 1249337 7346 + 19 6362991 -5 40 212934712 33.46 30 40 40 10 15 40 1432749 1231352 1769799 1920093 8998 + 20 6362991 -5 40 212787944 33.44 29 40 40 11 13 40 1311657 1411663 2126316 1513282 73 + 21 6362991 -5 40 211369187 33.22 28 40 40 12 10 40 1887985 1846300 1300326 1318380 10000 + 22 6362991 -5 40 213371720 33.53 30 40 40 10 15 40 542299 3446249 516615 1848190 9638 + 23 6362991 -5 40 221975899 34.89 36 40 40 4 30 40 347679 1233267 926621 3855355 69 + 24 6362991 -5 40 194378421 30.55 21 40 40 19 -5 40 433560 674358 3262764 1992242 67 + 25 6362991 -5 40 199773985 31.40 23 40 40 17 -2 40 944760 325595 1322800 3769641 195 + 26 6362991 -5 40 179404759 28.20 17 34 40 23 -5 40 3457922 156013 1494664 1254293 99 + 27 6362991 -5 40 163386668 25.68 13 28 40 27 -5 40 1392177 281250 3867895 821491 178 + 28 6362991 -5 40 156230534 24.55 12 25 40 28 -5 40 907189 981249 4174945 299437 171 + 29 6362991 -5 40 163236046 25.65 13 28 40 27 -5 40 1097171 3418678 1567013 280008 121 + 30 6362991 -5 40 151309826 23.78 12 23 40 28 -5 40 3514775 2036194 566277 245613 132 + 31 6362991 -5 40 141392520 22.22 10 21 40 30 -5 40 1569000 4571357 124732 97721 181 + 32 6362991 -5 40 143436943 22.54 10 21 40 30 -5 40 1453607 4519441 38176 351107 660 + 33 6362991 -5 40 114269843 17.96 6 14 30 24 -5 40 3311001 2161254 155505 734297 934 + 34 6362991 -5 40 140638447 22.10 10 20 40 30 -5 40 1501615 1637357 18113 3205237 669 + 35 6362991 -5 40 138910532 21.83 10 20 40 30 -5 40 1532519 3495057 23229 1311834 352 + 36 6362991 -5 40 117158566 18.41 7 15 30 23 -5 40 4074444 1402980 63287 822035 245 + + + + + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_reverse_complement.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_reverse_complement.xml Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,52 @@ + + sequences + zcat -f '$input' | fastx_reverse_complement -v -o $output + + + + + + + + + + + + + + + + + + + + + + + +**What it does** + +This tool reverse-complements each sequence in a library. +If the library is a FASTQ, the quality-scores are also reversed. + +-------- + +**Example** + +Input FASTQ file:: + + @CSHL_1_FC42AGWWWXX:8:1:3:740 + TGTCTGTAGCCTCNTCCTTGTAATTCAAAGNNGGTA + +CSHL_1_FC42AGWWWXX:8:1:3:740 + 33 33 33 34 33 33 33 33 33 33 33 33 27 5 27 33 33 33 33 33 33 27 21 27 33 32 31 29 26 24 5 5 15 17 27 26 + + +Output FASTQ file:: + + @CSHL_1_FC42AGWWWXX:8:1:3:740 + TACCNNCTTTGAATTACAAGGANGAGGCTACAGACA + +CSHL_1_FC42AGWWWXX:8:1:3:740 + 26 27 17 15 5 5 24 26 29 31 32 33 27 21 27 33 33 33 33 33 33 27 5 27 33 33 33 33 33 33 33 33 34 33 33 33 + + + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_trimmer.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_trimmer.xml Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,70 @@ + + sequences + zcat -f '$input' | fastx_trimmer -v -f $first -l $last -o $output + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +**What it does** + +This tool trims (cut bases from) sequences in a FASTA/Q file. + +-------- + +**Example** + +Input Fasta file (with 36 bases in each sequences):: + + >1-1 + TATGGTCAGAAACCATATGCAGAGCCTGTAGGCACC + >2-1 + CAGCGAGGCTTTAATGCCATTTGGCTGTAGGCACCA + + +Trimming with First=1 and Last=21, we get a FASTA file with 21 bases in each sequences (starting from the first base):: + + >1-1 + TATGGTCAGAAACCATATGCA + >2-1 + CAGCGAGGCTTTAATGCCATT + +Trimming with First=6 and Last=10, will generate a FASTA file with 5 bases (bases 6,7,8,9,10) in each sequences:: + + >1-1 + TCAGA + >2-1 + AGGCT + + + + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/Makefile.am --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/Makefile.am Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,23 @@ +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +EXTRA_DIST = fastq_quality_converter.xml \ + fastq_quality_filter.xml \ + fastx_quality_statistics.xml \ + fastq_to_fasta.xml \ + fastx_artifacts_filter.xml \ + fastx_clipper.xml \ + fastx_reverse_complement.xml \ + fastx_trimmer.xml \ + fastx_barcode_splitter.xml \ + fastx_nucleotides_distribution.xml \ + fastq_quality_boxplot.xml \ + fasta_clipping_histogram.xml \ + fastx_collapser.xml diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/Makefile.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/Makefile.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,330 @@ +# Makefile.in generated by automake 1.10.1 from Makefile.am. +# @configure_input@ + +# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, +# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This Makefile.in is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +@SET_MAKE@ + +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. +VPATH = @srcdir@ +pkgdatadir = $(datadir)/@PACKAGE@ +pkglibdir = $(libdir)/@PACKAGE@ +pkgincludedir = $(includedir)/@PACKAGE@ +am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd +install_sh_DATA = $(install_sh) -c -m 644 +install_sh_PROGRAM = $(install_sh) -c +install_sh_SCRIPT = $(install_sh) -c +INSTALL_HEADER = $(INSTALL_DATA) +transform = $(program_transform_name) +NORMAL_INSTALL = : +PRE_INSTALL = : +POST_INSTALL = : +NORMAL_UNINSTALL = : +PRE_UNINSTALL = : +POST_UNINSTALL = : +build_triplet = @build@ +host_triplet = @host@ +subdir = galaxy/tools/fastx_toolkit_with_gzip_and_output_label +DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in +ACLOCAL_M4 = $(top_srcdir)/aclocal.m4 +am__aclocal_m4_deps = $(top_srcdir)/configure.ac +am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \ + $(ACLOCAL_M4) +mkinstalldirs = $(install_sh) -d +CONFIG_HEADER = $(top_builddir)/config.h +CONFIG_CLEAN_FILES = +SOURCES = +DIST_SOURCES = +DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST) +ACLOCAL = @ACLOCAL@ +AMTAR = @AMTAR@ +AUTOCONF = @AUTOCONF@ +AUTOHEADER = @AUTOHEADER@ +AUTOMAKE = @AUTOMAKE@ +AWK = @AWK@ +CC = @CC@ +CCDEPMODE = @CCDEPMODE@ +CFLAGS = @CFLAGS@ +CPP = @CPP@ +CPPFLAGS = @CPPFLAGS@ +CXX = @CXX@ +CXXCPP = @CXXCPP@ +CXXDEPMODE = @CXXDEPMODE@ +CXXFLAGS = @CXXFLAGS@ +CYGPATH_W = @CYGPATH_W@ +DEFS = @DEFS@ +DEPDIR = @DEPDIR@ +ECHO_C = @ECHO_C@ +ECHO_N = @ECHO_N@ +ECHO_T = @ECHO_T@ +EGREP = @EGREP@ +EXEEXT = @EXEEXT@ +GREP = @GREP@ +INSTALL = @INSTALL@ +INSTALL_DATA = @INSTALL_DATA@ +INSTALL_PROGRAM = @INSTALL_PROGRAM@ +INSTALL_SCRIPT = @INSTALL_SCRIPT@ +INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@ +LDFLAGS = @LDFLAGS@ +LIBOBJS = @LIBOBJS@ +LIBS = @LIBS@ +LTLIBOBJS = @LTLIBOBJS@ +MAKEINFO = @MAKEINFO@ +MKDIR_P = @MKDIR_P@ +OBJEXT = @OBJEXT@ +PACKAGE = @PACKAGE@ +PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@ +PACKAGE_NAME = @PACKAGE_NAME@ +PACKAGE_STRING = @PACKAGE_STRING@ +PACKAGE_TARNAME = @PACKAGE_TARNAME@ +PACKAGE_VERSION = @PACKAGE_VERSION@ +PATH_SEPARATOR = @PATH_SEPARATOR@ +RANLIB = @RANLIB@ +SET_MAKE = @SET_MAKE@ +SHELL = @SHELL@ +STRIP = @STRIP@ +VERSION = @VERSION@ +abs_builddir = @abs_builddir@ +abs_srcdir = @abs_srcdir@ +abs_top_builddir = @abs_top_builddir@ +abs_top_srcdir = @abs_top_srcdir@ +ac_ct_CC = @ac_ct_CC@ +ac_ct_CXX = @ac_ct_CXX@ +am__include = @am__include@ +am__leading_dot = @am__leading_dot@ +am__quote = @am__quote@ +am__tar = @am__tar@ +am__untar = @am__untar@ +bindir = @bindir@ +build = @build@ +build_alias = @build_alias@ +build_cpu = @build_cpu@ +build_os = @build_os@ +build_vendor = @build_vendor@ +builddir = @builddir@ +canonical_host_type = @canonical_host_type@ +datadir = @datadir@ +datarootdir = @datarootdir@ +docdir = @docdir@ +dvidir = @dvidir@ +exec_prefix = @exec_prefix@ +host = @host@ +host_alias = @host_alias@ +host_cpu = @host_cpu@ +host_os = @host_os@ +host_vendor = @host_vendor@ +htmldir = @htmldir@ +includedir = @includedir@ +infodir = @infodir@ +install_sh = @install_sh@ +libdir = @libdir@ +libexecdir = @libexecdir@ +localedir = @localedir@ +localstatedir = @localstatedir@ +mandir = @mandir@ +mkdir_p = @mkdir_p@ +oldincludedir = @oldincludedir@ +pdfdir = @pdfdir@ +prefix = @prefix@ +program_transform_name = @program_transform_name@ +psdir = @psdir@ +sbindir = @sbindir@ +sharedstatedir = @sharedstatedir@ +srcdir = @srcdir@ +sysconfdir = @sysconfdir@ +target_alias = @target_alias@ +top_builddir = @top_builddir@ +top_srcdir = @top_srcdir@ +EXTRA_DIST = fastq_quality_converter.xml \ + fastq_quality_filter.xml \ + fastx_quality_statistics.xml \ + fastq_to_fasta.xml \ + fastx_artifacts_filter.xml \ + fastx_clipper.xml \ + fastx_reverse_complement.xml \ + fastx_trimmer.xml \ + fastx_barcode_splitter.xml \ + fastx_nucleotides_distribution.xml \ + fastq_quality_boxplot.xml \ + fasta_clipping_histogram.xml \ + fastx_collapser.xml + +all: all-am + +.SUFFIXES: +$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps) + @for dep in $?; do \ + case '$(am__configure_deps)' in \ + *$$dep*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh \ + && exit 0; \ + exit 1;; \ + esac; \ + done; \ + echo ' cd $(top_srcdir) && $(AUTOMAKE) --gnu galaxy/tools/fastx_toolkit_with_gzip_and_output_label/Makefile'; \ + cd $(top_srcdir) && \ + $(AUTOMAKE) --gnu galaxy/tools/fastx_toolkit_with_gzip_and_output_label/Makefile +.PRECIOUS: Makefile +Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status + @case '$?' in \ + *config.status*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \ + *) \ + echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \ + cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \ + esac; + +$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +$(top_srcdir)/configure: $(am__configure_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +$(ACLOCAL_M4): $(am__aclocal_m4_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +tags: TAGS +TAGS: + +ctags: CTAGS +CTAGS: + + +distdir: $(DISTFILES) + @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + list='$(DISTFILES)'; \ + dist_files=`for file in $$list; do echo $$file; done | \ + sed -e "s|^$$srcdirstrip/||;t" \ + -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \ + case $$dist_files in \ + */*) $(MKDIR_P) `echo "$$dist_files" | \ + sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \ + sort -u` ;; \ + esac; \ + for file in $$dist_files; do \ + if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \ + if test -d $$d/$$file; then \ + dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \ + if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \ + cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \ + fi; \ + cp -pR $$d/$$file $(distdir)$$dir || exit 1; \ + else \ + test -f $(distdir)/$$file \ + || cp -p $$d/$$file $(distdir)/$$file \ + || exit 1; \ + fi; \ + done +check-am: all-am +check: check-am +all-am: Makefile +installdirs: +install: install-am +install-exec: install-exec-am +install-data: install-data-am +uninstall: uninstall-am + +install-am: all-am + @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am + +installcheck: installcheck-am +install-strip: + $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \ + install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \ + `test -z '$(STRIP)' || \ + echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install +mostlyclean-generic: + +clean-generic: + +distclean-generic: + -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES) + +maintainer-clean-generic: + @echo "This command is intended for maintainers to use" + @echo "it deletes files that may require special tools to rebuild." +clean: clean-am + +clean-am: clean-generic mostlyclean-am + +distclean: distclean-am + -rm -f Makefile +distclean-am: clean-am distclean-generic + +dvi: dvi-am + +dvi-am: + +html: html-am + +info: info-am + +info-am: + +install-data-am: + +install-dvi: install-dvi-am + +install-exec-am: + +install-html: install-html-am + +install-info: install-info-am + +install-man: + +install-pdf: install-pdf-am + +install-ps: install-ps-am + +installcheck-am: + +maintainer-clean: maintainer-clean-am + -rm -f Makefile +maintainer-clean-am: distclean-am maintainer-clean-generic + +mostlyclean: mostlyclean-am + +mostlyclean-am: mostlyclean-generic + +pdf: pdf-am + +pdf-am: + +ps: ps-am + +ps-am: + +uninstall-am: + +.MAKE: install-am install-strip + +.PHONY: all all-am check check-am clean clean-generic distclean \ + distclean-generic distdir dvi dvi-am html html-am info info-am \ + install install-am install-data install-data-am install-dvi \ + install-dvi-am install-exec install-exec-am install-html \ + install-html-am install-info install-info-am install-man \ + install-pdf install-pdf-am install-ps install-ps-am \ + install-strip installcheck installcheck-am installdirs \ + maintainer-clean maintainer-clean-generic mostlyclean \ + mostlyclean-generic pdf pdf-am ps ps-am uninstall uninstall-am + +# Tell versions [3.59,3.63) of GNU make to not export all variables. +# Otherwise a system limit (for SysV at least) may be exceeded. +.NOEXPORT: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastq_quality_boxplot.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastq_quality_boxplot.xml Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,47 @@ + + chart + + fastq_quality_boxplot_graph.sh -t '$input.tag' -i $input -o $output + + + + + + + + + + +**What it does** + +Creates a boxplot graph for the quality scores in the library. + +.. class:: infomark + +**TIP:** Use the **FASTQ Statistics** tool to generate the report file needed for this tool. + +----- + +**Output Examples** + +* Black horizontal lines are medians +* Rectangular red boxes show the Inter-quartile Range (IQR) (top value is Q3, bottom value is Q1) +* Whiskers show outlier at max. 1.5*IQR + + +An excellent quality library (median quality is 40 for almost all 36 cycles): + +.. image:: ../static/fastx_icons/fastq_quality_boxplot_1.png + + +A relatively good quality library (median quality degrades towards later cycles): + +.. image:: ../static/fastx_icons/fastq_quality_boxplot_2.png + +A low quality library (median drops quickly): + +.. image:: ../static/fastx_icons/fastq_quality_boxplot_3.png + + + + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastq_quality_filter.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastq_quality_filter.xml Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,80 @@ + + + + zcat -f '$input' | fastq_quality_filter $GZIPOUT -q $quality -p $percent -v -o $output + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +**What it does** + +This tool filters reads based on quality scores. + +.. class:: infomark + +Using **percent = 100** requires all cycles of all reads to be at least the quality cut-off value. + +.. class:: infomark + +Using **percent = 50** requires the median quality of the cycles (in each read) to be at least the quality cut-off value. + +-------- + +Quality score distribution (of all cycles) is calculated for each read. If it is lower than the quality cut-off value - the read is discarded. + + +**Example**:: + + @CSHL_4_FC042AGOOII:1:2:214:584 + GACAATAAAC + +CSHL_4_FC042AGOOII:1:2:214:584 + 30 30 30 30 30 30 30 30 20 10 + +Using **percent = 50** and **cut-off = 30** - This read will not be discarded (the median quality is higher than 30). + +Using **percent = 90** and **cut-off = 30** - This read will be discarded (90% of the cycles do no have quality equal to / higher than 30). + +Using **percent = 100** and **cut-off = 20** - This read will be discarded (not all cycles have quality equal to / higher than 20). + + + + + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastq_to_fasta.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastq_to_fasta.xml Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,77 @@ + + converter + gunzip -cf $input | fastq_to_fasta $GZIPOUT $SKIPN $RENAMESEQ -o $output -v + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +**What it does** + +This tool converts data from Solexa format to FASTA format (scroll down for format description). + +-------- + +**Example** + +The following data in Solexa-FASTQ format:: + + @CSHL_4_FC042GAMMII_2_1_517_596 + GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT + +CSHL_4_FC042GAMMII_2_1_517_596 + 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 + +Will be converted to FASTA (with 'rename sequence names' = NO):: + + >CSHL_4_FC042GAMMII_2_1_517_596 + GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT + +Will be converted to FASTA (with 'rename sequence names' = YES):: + + >1 + GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT + + + + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastx_clipper.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastx_clipper.xml Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,116 @@ + + adapter sequences + + zcat -f $input | fastx_clipper $GZIPOUT -s $maxmismatches -l $minlength -a $clip_source.clip_sequence -d $keepdelta -o $output -v $KEEP_N $DISCARD_OPTIONS + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + use this for hairpin barcoding. keep at 0 unless you know what you're doing. + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +**What it does** + +This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file. + +-------- + + +**Clipping Illustration:** + +.. image:: ../static/fastx_icons/fastx_clipper_illustration.png + + + + + + + + +**Clipping Example:** + +.. image:: ../static/fastx_icons/fastx_clipper_example.png + + + +**In the above example:** + +* Sequence no. 1 was discarded since it wasn't clipped (i.e. didn't contain the adapter sequence). (**Output** parameter). +* Sequence no. 5 was discarded --- it's length (after clipping) was shorter than 15 nt (**Minimum Sequence Length** parameter). + + + + + + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastx_collapser.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastx_collapser.xml Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,83 @@ + + sequences + zcat -f '$input' | fastx_collapser -v -o '$output' + + + + + + + + + + + + + + + + + + + + +**What it does** + +This tool collapses identical sequences in a FASTA file into a single sequence. + +-------- + +**Example** + +Example Input File (Sequence "ATAT" appears multiple times):: + + >CSHL_2_FC0042AGLLOO_1_1_605_414 + TGCG + >CSHL_2_FC0042AGLLOO_1_1_537_759 + ATAT + >CSHL_2_FC0042AGLLOO_1_1_774_520 + TGGC + >CSHL_2_FC0042AGLLOO_1_1_742_502 + ATAT + >CSHL_2_FC0042AGLLOO_1_1_781_514 + TGAG + >CSHL_2_FC0042AGLLOO_1_1_757_487 + TTCA + >CSHL_2_FC0042AGLLOO_1_1_903_769 + ATAT + >CSHL_2_FC0042AGLLOO_1_1_724_499 + ATAT + +Example Output file:: + + >1-1 + TGCG + >2-4 + ATAT + >3-1 + TGGC + >4-1 + TGAG + >5-1 + TTCA + +.. class:: infomark + +Original Sequence Names / Lane descriptions (e.g. "CSHL_2_FC0042AGLLOO_1_1_742_502") are discarded. + +The output seqeunce name is composed of two numbers: the first is the sequence's number, the second is the multiplicity value. + +The following output:: + + >2-4 + ATAT + +means that the sequence "ATAT" is the second sequence in the file, and it appeared 4 times in the input FASTA file. + + + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastx_trimmer.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastx_trimmer.xml Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,77 @@ + + sequences + zcat -f '$input' | fastx_trimmer $GZIPOUT -v -f $first -l $last -o $output + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +**What it does** + +This tool trims (cut bases from) sequences in a FASTA/Q file. + +-------- + +**Example** + +Input Fasta file (with 36 bases in each sequences):: + + >1-1 + TATGGTCAGAAACCATATGCAGAGCCTGTAGGCACC + >2-1 + CAGCGAGGCTTTAATGCCATTTGGCTGTAGGCACCA + + +Trimming with First=1 and Last=21, we get a FASTA file with 21 bases in each sequences (starting from the first base):: + + >1-1 + TATGGTCAGAAACCATATGCA + >2-1 + CAGCGAGGCTTTAATGCCATT + +Trimming with First=6 and Last=10, will generate a FASTA file with 5 bases (bases 6,7,8,9,10) in each sequences:: + + >1-1 + TCAGA + >2-1 + AGGCT + + + + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/install_galaxy_files.sh --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/install_galaxy_files.sh Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,123 @@ +#!/bin/sh + +# +# Arguments check and suage information +# +SRC="." +DEST="$1" +if [ -z "$DEST" ]; then +cat< +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +# Install m4 macros in this directory +m4datadir = $(datadir)/aclocal + +# List your m4 macros here +m4macros = + +# The following is boilerplate +m4data_DATA = $(m4macros) +EXTRA_DIST = $(m4data_DATA) + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/m4/Makefile.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/m4/Makefile.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,357 @@ +# Makefile.in generated by automake 1.10.1 from Makefile.am. +# @configure_input@ + +# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, +# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This Makefile.in is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +@SET_MAKE@ + +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +VPATH = @srcdir@ +pkgdatadir = $(datadir)/@PACKAGE@ +pkglibdir = $(libdir)/@PACKAGE@ +pkgincludedir = $(includedir)/@PACKAGE@ +am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd +install_sh_DATA = $(install_sh) -c -m 644 +install_sh_PROGRAM = $(install_sh) -c +install_sh_SCRIPT = $(install_sh) -c +INSTALL_HEADER = $(INSTALL_DATA) +transform = $(program_transform_name) +NORMAL_INSTALL = : +PRE_INSTALL = : +POST_INSTALL = : +NORMAL_UNINSTALL = : +PRE_UNINSTALL = : +POST_UNINSTALL = : +build_triplet = @build@ +host_triplet = @host@ +subdir = m4 +DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in +ACLOCAL_M4 = $(top_srcdir)/aclocal.m4 +am__aclocal_m4_deps = $(top_srcdir)/configure.ac +am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \ + $(ACLOCAL_M4) +mkinstalldirs = $(install_sh) -d +CONFIG_HEADER = $(top_builddir)/config.h +CONFIG_CLEAN_FILES = +SOURCES = +DIST_SOURCES = +am__vpath_adj_setup = srcdirstrip=`echo "$(srcdir)" | sed 's|.|.|g'`; +am__vpath_adj = case $$p in \ + $(srcdir)/*) f=`echo "$$p" | sed "s|^$$srcdirstrip/||"`;; \ + *) f=$$p;; \ + esac; +am__strip_dir = `echo $$p | sed -e 's|^.*/||'`; +am__installdirs = "$(DESTDIR)$(m4datadir)" +m4dataDATA_INSTALL = $(INSTALL_DATA) +DATA = $(m4data_DATA) +DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST) +ACLOCAL = @ACLOCAL@ +AMTAR = @AMTAR@ +AUTOCONF = @AUTOCONF@ +AUTOHEADER = @AUTOHEADER@ +AUTOMAKE = @AUTOMAKE@ +AWK = @AWK@ +CC = @CC@ +CCDEPMODE = @CCDEPMODE@ +CFLAGS = @CFLAGS@ +CPP = @CPP@ +CPPFLAGS = @CPPFLAGS@ +CXX = @CXX@ +CXXCPP = @CXXCPP@ +CXXDEPMODE = @CXXDEPMODE@ +CXXFLAGS = @CXXFLAGS@ +CYGPATH_W = @CYGPATH_W@ +DEFS = @DEFS@ +DEPDIR = @DEPDIR@ +ECHO_C = @ECHO_C@ +ECHO_N = @ECHO_N@ +ECHO_T = @ECHO_T@ +EGREP = @EGREP@ +EXEEXT = @EXEEXT@ +GREP = @GREP@ +INSTALL = @INSTALL@ +INSTALL_DATA = @INSTALL_DATA@ +INSTALL_PROGRAM = @INSTALL_PROGRAM@ +INSTALL_SCRIPT = @INSTALL_SCRIPT@ +INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@ +LDFLAGS = @LDFLAGS@ +LIBOBJS = @LIBOBJS@ +LIBS = @LIBS@ +LTLIBOBJS = @LTLIBOBJS@ +MAKEINFO = @MAKEINFO@ +MKDIR_P = @MKDIR_P@ +OBJEXT = @OBJEXT@ +PACKAGE = @PACKAGE@ +PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@ +PACKAGE_NAME = @PACKAGE_NAME@ +PACKAGE_STRING = @PACKAGE_STRING@ +PACKAGE_TARNAME = @PACKAGE_TARNAME@ +PACKAGE_VERSION = @PACKAGE_VERSION@ +PATH_SEPARATOR = @PATH_SEPARATOR@ +RANLIB = @RANLIB@ +SET_MAKE = @SET_MAKE@ +SHELL = @SHELL@ +STRIP = @STRIP@ +VERSION = @VERSION@ +abs_builddir = @abs_builddir@ +abs_srcdir = @abs_srcdir@ +abs_top_builddir = @abs_top_builddir@ +abs_top_srcdir = @abs_top_srcdir@ +ac_ct_CC = @ac_ct_CC@ +ac_ct_CXX = @ac_ct_CXX@ +am__include = @am__include@ +am__leading_dot = @am__leading_dot@ +am__quote = @am__quote@ +am__tar = @am__tar@ +am__untar = @am__untar@ +bindir = @bindir@ +build = @build@ +build_alias = @build_alias@ +build_cpu = @build_cpu@ +build_os = @build_os@ +build_vendor = @build_vendor@ +builddir = @builddir@ +canonical_host_type = @canonical_host_type@ +datadir = @datadir@ +datarootdir = @datarootdir@ +docdir = @docdir@ +dvidir = @dvidir@ +exec_prefix = @exec_prefix@ +host = @host@ +host_alias = @host_alias@ +host_cpu = @host_cpu@ +host_os = @host_os@ +host_vendor = @host_vendor@ +htmldir = @htmldir@ +includedir = @includedir@ +infodir = @infodir@ +install_sh = @install_sh@ +libdir = @libdir@ +libexecdir = @libexecdir@ +localedir = @localedir@ +localstatedir = @localstatedir@ +mandir = @mandir@ +mkdir_p = @mkdir_p@ +oldincludedir = @oldincludedir@ +pdfdir = @pdfdir@ +prefix = @prefix@ +program_transform_name = @program_transform_name@ +psdir = @psdir@ +sbindir = @sbindir@ +sharedstatedir = @sharedstatedir@ +srcdir = @srcdir@ +sysconfdir = @sysconfdir@ +target_alias = @target_alias@ +top_builddir = @top_builddir@ +top_srcdir = @top_srcdir@ + +# Install m4 macros in this directory +m4datadir = $(datadir)/aclocal + +# List your m4 macros here +m4macros = + +# The following is boilerplate +m4data_DATA = $(m4macros) +EXTRA_DIST = $(m4data_DATA) +all: all-am + +.SUFFIXES: +$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps) + @for dep in $?; do \ + case '$(am__configure_deps)' in \ + *$$dep*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh \ + && exit 0; \ + exit 1;; \ + esac; \ + done; \ + echo ' cd $(top_srcdir) && $(AUTOMAKE) --gnu m4/Makefile'; \ + cd $(top_srcdir) && \ + $(AUTOMAKE) --gnu m4/Makefile +.PRECIOUS: Makefile +Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status + @case '$?' in \ + *config.status*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \ + *) \ + echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \ + cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \ + esac; + +$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +$(top_srcdir)/configure: $(am__configure_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +$(ACLOCAL_M4): $(am__aclocal_m4_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +install-m4dataDATA: $(m4data_DATA) + @$(NORMAL_INSTALL) + test -z "$(m4datadir)" || $(MKDIR_P) "$(DESTDIR)$(m4datadir)" + @list='$(m4data_DATA)'; for p in $$list; do \ + if test -f "$$p"; then d=; else d="$(srcdir)/"; fi; \ + f=$(am__strip_dir) \ + echo " $(m4dataDATA_INSTALL) '$$d$$p' '$(DESTDIR)$(m4datadir)/$$f'"; \ + $(m4dataDATA_INSTALL) "$$d$$p" "$(DESTDIR)$(m4datadir)/$$f"; \ + done + +uninstall-m4dataDATA: + @$(NORMAL_UNINSTALL) + @list='$(m4data_DATA)'; for p in $$list; do \ + f=$(am__strip_dir) \ + echo " rm -f '$(DESTDIR)$(m4datadir)/$$f'"; \ + rm -f "$(DESTDIR)$(m4datadir)/$$f"; \ + done +tags: TAGS +TAGS: + +ctags: CTAGS +CTAGS: + + +distdir: $(DISTFILES) + @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + list='$(DISTFILES)'; \ + dist_files=`for file in $$list; do echo $$file; done | \ + sed -e "s|^$$srcdirstrip/||;t" \ + -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \ + case $$dist_files in \ + */*) $(MKDIR_P) `echo "$$dist_files" | \ + sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \ + sort -u` ;; \ + esac; \ + for file in $$dist_files; do \ + if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \ + if test -d $$d/$$file; then \ + dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \ + if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \ + cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \ + fi; \ + cp -pR $$d/$$file $(distdir)$$dir || exit 1; \ + else \ + test -f $(distdir)/$$file \ + || cp -p $$d/$$file $(distdir)/$$file \ + || exit 1; \ + fi; \ + done +check-am: all-am +check: check-am +all-am: Makefile $(DATA) +installdirs: + for dir in "$(DESTDIR)$(m4datadir)"; do \ + test -z "$$dir" || $(MKDIR_P) "$$dir"; \ + done +install: install-am +install-exec: install-exec-am +install-data: install-data-am +uninstall: uninstall-am + +install-am: all-am + @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am + +installcheck: installcheck-am +install-strip: + $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \ + install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \ + `test -z '$(STRIP)' || \ + echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install +mostlyclean-generic: + +clean-generic: + +distclean-generic: + -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES) + +maintainer-clean-generic: + @echo "This command is intended for maintainers to use" + @echo "it deletes files that may require special tools to rebuild." +clean: clean-am + +clean-am: clean-generic mostlyclean-am + +distclean: distclean-am + -rm -f Makefile +distclean-am: clean-am distclean-generic + +dvi: dvi-am + +dvi-am: + +html: html-am + +info: info-am + +info-am: + +install-data-am: install-m4dataDATA + +install-dvi: install-dvi-am + +install-exec-am: + +install-html: install-html-am + +install-info: install-info-am + +install-man: + +install-pdf: install-pdf-am + +install-ps: install-ps-am + +installcheck-am: + +maintainer-clean: maintainer-clean-am + -rm -f Makefile +maintainer-clean-am: distclean-am maintainer-clean-generic + +mostlyclean: mostlyclean-am + +mostlyclean-am: mostlyclean-generic + +pdf: pdf-am + +pdf-am: + +ps: ps-am + +ps-am: + +uninstall-am: uninstall-m4dataDATA + +.MAKE: install-am install-strip + +.PHONY: all all-am check check-am clean clean-generic distclean \ + distclean-generic distdir dvi dvi-am html html-am info info-am \ + install install-am install-data install-data-am install-dvi \ + install-dvi-am install-exec install-exec-am install-html \ + install-html-am install-info install-info-am \ + install-m4dataDATA install-man install-pdf install-pdf-am \ + install-ps install-ps-am install-strip installcheck \ + installcheck-am installdirs maintainer-clean \ + maintainer-clean-generic mostlyclean mostlyclean-generic pdf \ + pdf-am ps ps-am uninstall uninstall-am uninstall-m4dataDATA + +# Tell versions [3.59,3.63) of GNU make to not export all variables. +# Otherwise a system limit (for SysV at least) may be exceeded. +.NOEXPORT: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/reconf --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/reconf Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,21 @@ +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +#!/bin/sh +rm -f config.cache +echo "- aclocal." +aclocal -I m4 +echo "- autoconf." +autoconf +echo "- autoheader." +autoheader +echo "- automake." +automake -a +exit diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/scripts/Makefile.am --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/scripts/Makefile.am Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,21 @@ +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +bin_SCRIPTS = fastx_barcode_splitter.pl \ + fastx_barcode_splitter_galaxy_wrapper.sh \ + fastx_nucleotide_distribution_graph.sh \ + fastq_quality_boxplot_graph.sh \ + fasta_clipping_histogram.pl + +EXTRA_DIST = fastx_barcode_splitter.pl \ + fastx_barcode_splitter_galaxy_wrapper.sh \ + fastx_nucleotide_distribution_graph.sh \ + fastq_quality_boxplot_graph.sh \ + fasta_clipping_histogram.pl diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/scripts/Makefile.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/scripts/Makefile.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,355 @@ +# Makefile.in generated by automake 1.10.1 from Makefile.am. +# @configure_input@ + +# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, +# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This Makefile.in is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +@SET_MAKE@ + +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +VPATH = @srcdir@ +pkgdatadir = $(datadir)/@PACKAGE@ +pkglibdir = $(libdir)/@PACKAGE@ +pkgincludedir = $(includedir)/@PACKAGE@ +am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd +install_sh_DATA = $(install_sh) -c -m 644 +install_sh_PROGRAM = $(install_sh) -c +install_sh_SCRIPT = $(install_sh) -c +INSTALL_HEADER = $(INSTALL_DATA) +transform = $(program_transform_name) +NORMAL_INSTALL = : +PRE_INSTALL = : +POST_INSTALL = : +NORMAL_UNINSTALL = : +PRE_UNINSTALL = : +POST_UNINSTALL = : +build_triplet = @build@ +host_triplet = @host@ +subdir = scripts +DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in +ACLOCAL_M4 = $(top_srcdir)/aclocal.m4 +am__aclocal_m4_deps = $(top_srcdir)/configure.ac +am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \ + $(ACLOCAL_M4) +mkinstalldirs = $(install_sh) -d +CONFIG_HEADER = $(top_builddir)/config.h +CONFIG_CLEAN_FILES = +am__installdirs = "$(DESTDIR)$(bindir)" +binSCRIPT_INSTALL = $(INSTALL_SCRIPT) +SCRIPTS = $(bin_SCRIPTS) +SOURCES = +DIST_SOURCES = +DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST) +ACLOCAL = @ACLOCAL@ +AMTAR = @AMTAR@ +AUTOCONF = @AUTOCONF@ +AUTOHEADER = @AUTOHEADER@ +AUTOMAKE = @AUTOMAKE@ +AWK = @AWK@ +CC = @CC@ +CCDEPMODE = @CCDEPMODE@ +CFLAGS = @CFLAGS@ +CPP = @CPP@ +CPPFLAGS = @CPPFLAGS@ +CXX = @CXX@ +CXXCPP = @CXXCPP@ +CXXDEPMODE = @CXXDEPMODE@ +CXXFLAGS = @CXXFLAGS@ +CYGPATH_W = @CYGPATH_W@ +DEFS = @DEFS@ +DEPDIR = @DEPDIR@ +ECHO_C = @ECHO_C@ +ECHO_N = @ECHO_N@ +ECHO_T = @ECHO_T@ +EGREP = @EGREP@ +EXEEXT = @EXEEXT@ +GREP = @GREP@ +INSTALL = @INSTALL@ +INSTALL_DATA = @INSTALL_DATA@ +INSTALL_PROGRAM = @INSTALL_PROGRAM@ +INSTALL_SCRIPT = @INSTALL_SCRIPT@ +INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@ +LDFLAGS = @LDFLAGS@ +LIBOBJS = @LIBOBJS@ +LIBS = @LIBS@ +LTLIBOBJS = @LTLIBOBJS@ +MAKEINFO = @MAKEINFO@ +MKDIR_P = @MKDIR_P@ +OBJEXT = @OBJEXT@ +PACKAGE = @PACKAGE@ +PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@ +PACKAGE_NAME = @PACKAGE_NAME@ +PACKAGE_STRING = @PACKAGE_STRING@ +PACKAGE_TARNAME = @PACKAGE_TARNAME@ +PACKAGE_VERSION = @PACKAGE_VERSION@ +PATH_SEPARATOR = @PATH_SEPARATOR@ +RANLIB = @RANLIB@ +SET_MAKE = @SET_MAKE@ +SHELL = @SHELL@ +STRIP = @STRIP@ +VERSION = @VERSION@ +abs_builddir = @abs_builddir@ +abs_srcdir = @abs_srcdir@ +abs_top_builddir = @abs_top_builddir@ +abs_top_srcdir = @abs_top_srcdir@ +ac_ct_CC = @ac_ct_CC@ +ac_ct_CXX = @ac_ct_CXX@ +am__include = @am__include@ +am__leading_dot = @am__leading_dot@ +am__quote = @am__quote@ +am__tar = @am__tar@ +am__untar = @am__untar@ +bindir = @bindir@ +build = @build@ +build_alias = @build_alias@ +build_cpu = @build_cpu@ +build_os = @build_os@ +build_vendor = @build_vendor@ +builddir = @builddir@ +canonical_host_type = @canonical_host_type@ +datadir = @datadir@ +datarootdir = @datarootdir@ +docdir = @docdir@ +dvidir = @dvidir@ +exec_prefix = @exec_prefix@ +host = @host@ +host_alias = @host_alias@ +host_cpu = @host_cpu@ +host_os = @host_os@ +host_vendor = @host_vendor@ +htmldir = @htmldir@ +includedir = @includedir@ +infodir = @infodir@ +install_sh = @install_sh@ +libdir = @libdir@ +libexecdir = @libexecdir@ +localedir = @localedir@ +localstatedir = @localstatedir@ +mandir = @mandir@ +mkdir_p = @mkdir_p@ +oldincludedir = @oldincludedir@ +pdfdir = @pdfdir@ +prefix = @prefix@ +program_transform_name = @program_transform_name@ +psdir = @psdir@ +sbindir = @sbindir@ +sharedstatedir = @sharedstatedir@ +srcdir = @srcdir@ +sysconfdir = @sysconfdir@ +target_alias = @target_alias@ +top_builddir = @top_builddir@ +top_srcdir = @top_srcdir@ +bin_SCRIPTS = fastx_barcode_splitter.pl \ + fastx_barcode_splitter_galaxy_wrapper.sh \ + fastx_nucleotide_distribution_graph.sh \ + fastq_quality_boxplot_graph.sh \ + fasta_clipping_histogram.pl + +EXTRA_DIST = fastx_barcode_splitter.pl \ + fastx_barcode_splitter_galaxy_wrapper.sh \ + fastx_nucleotide_distribution_graph.sh \ + fastq_quality_boxplot_graph.sh \ + fasta_clipping_histogram.pl + +all: all-am + +.SUFFIXES: +$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps) + @for dep in $?; do \ + case '$(am__configure_deps)' in \ + *$$dep*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh \ + && exit 0; \ + exit 1;; \ + esac; \ + done; \ + echo ' cd $(top_srcdir) && $(AUTOMAKE) --gnu scripts/Makefile'; \ + cd $(top_srcdir) && \ + $(AUTOMAKE) --gnu scripts/Makefile +.PRECIOUS: Makefile +Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status + @case '$?' in \ + *config.status*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \ + *) \ + echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \ + cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \ + esac; + +$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +$(top_srcdir)/configure: $(am__configure_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +$(ACLOCAL_M4): $(am__aclocal_m4_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +install-binSCRIPTS: $(bin_SCRIPTS) + @$(NORMAL_INSTALL) + test -z "$(bindir)" || $(MKDIR_P) "$(DESTDIR)$(bindir)" + @list='$(bin_SCRIPTS)'; for p in $$list; do \ + if test -f "$$p"; then d=; else d="$(srcdir)/"; fi; \ + if test -f $$d$$p; then \ + f=`echo "$$p" | sed 's|^.*/||;$(transform)'`; \ + echo " $(binSCRIPT_INSTALL) '$$d$$p' '$(DESTDIR)$(bindir)/$$f'"; \ + $(binSCRIPT_INSTALL) "$$d$$p" "$(DESTDIR)$(bindir)/$$f"; \ + else :; fi; \ + done + +uninstall-binSCRIPTS: + @$(NORMAL_UNINSTALL) + @list='$(bin_SCRIPTS)'; for p in $$list; do \ + f=`echo "$$p" | sed 's|^.*/||;$(transform)'`; \ + echo " rm -f '$(DESTDIR)$(bindir)/$$f'"; \ + rm -f "$(DESTDIR)$(bindir)/$$f"; \ + done +tags: TAGS +TAGS: + +ctags: CTAGS +CTAGS: + + +distdir: $(DISTFILES) + @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + list='$(DISTFILES)'; \ + dist_files=`for file in $$list; do echo $$file; done | \ + sed -e "s|^$$srcdirstrip/||;t" \ + -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \ + case $$dist_files in \ + */*) $(MKDIR_P) `echo "$$dist_files" | \ + sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \ + sort -u` ;; \ + esac; \ + for file in $$dist_files; do \ + if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \ + if test -d $$d/$$file; then \ + dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \ + if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \ + cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \ + fi; \ + cp -pR $$d/$$file $(distdir)$$dir || exit 1; \ + else \ + test -f $(distdir)/$$file \ + || cp -p $$d/$$file $(distdir)/$$file \ + || exit 1; \ + fi; \ + done +check-am: all-am +check: check-am +all-am: Makefile $(SCRIPTS) +installdirs: + for dir in "$(DESTDIR)$(bindir)"; do \ + test -z "$$dir" || $(MKDIR_P) "$$dir"; \ + done +install: install-am +install-exec: install-exec-am +install-data: install-data-am +uninstall: uninstall-am + +install-am: all-am + @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am + +installcheck: installcheck-am +install-strip: + $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \ + install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \ + `test -z '$(STRIP)' || \ + echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install +mostlyclean-generic: + +clean-generic: + +distclean-generic: + -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES) + +maintainer-clean-generic: + @echo "This command is intended for maintainers to use" + @echo "it deletes files that may require special tools to rebuild." +clean: clean-am + +clean-am: clean-generic mostlyclean-am + +distclean: distclean-am + -rm -f Makefile +distclean-am: clean-am distclean-generic + +dvi: dvi-am + +dvi-am: + +html: html-am + +info: info-am + +info-am: + +install-data-am: + +install-dvi: install-dvi-am + +install-exec-am: install-binSCRIPTS + +install-html: install-html-am + +install-info: install-info-am + +install-man: + +install-pdf: install-pdf-am + +install-ps: install-ps-am + +installcheck-am: + +maintainer-clean: maintainer-clean-am + -rm -f Makefile +maintainer-clean-am: distclean-am maintainer-clean-generic + +mostlyclean: mostlyclean-am + +mostlyclean-am: mostlyclean-generic + +pdf: pdf-am + +pdf-am: + +ps: ps-am + +ps-am: + +uninstall-am: uninstall-binSCRIPTS + +.MAKE: install-am install-strip + +.PHONY: all all-am check check-am clean clean-generic distclean \ + distclean-generic distdir dvi dvi-am html html-am info info-am \ + install install-am install-binSCRIPTS install-data \ + install-data-am install-dvi install-dvi-am install-exec \ + install-exec-am install-html install-html-am install-info \ + install-info-am install-man install-pdf install-pdf-am \ + install-ps install-ps-am install-strip installcheck \ + installcheck-am installdirs maintainer-clean \ + maintainer-clean-generic mostlyclean mostlyclean-generic pdf \ + pdf-am ps ps-am uninstall uninstall-am uninstall-binSCRIPTS + +# Tell versions [3.59,3.63) of GNU make to not export all variables. +# Otherwise a system limit (for SysV at least) may be exceeded. +.NOEXPORT: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/scripts/fasta_clipping_histogram.pl --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/scripts/fasta_clipping_histogram.pl Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,104 @@ +#!/usr/bin/perl + +# FASTX-toolkit - FASTA/FASTQ preprocessing tools. +# Copyright (C) 2009 A. Gordon (gordon@cshl.edu) +# +# This program is free software: you can redistribute it and/or modify +# it under the terms of the GNU Affero General Public License as +# published by the Free Software Foundation, either version 3 of the +# License, or (at your option) any later version. +# +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY; without even the implied warranty of +# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the +# GNU Affero General Public License for more details. +# +# You should have received a copy of the GNU Affero General Public License +# along with this program. If not, see . + +use strict; +use warnings; +use GD::Graph::bars; +use Data::Dumper; +use PerlIO::gzip; + +if (scalar @ARGV==0) { + print<$ARGV[1]") or die "Cannot create output file $ARGV[1]\n"; +binmode OUT; + +my %histogram ; + +while (my $name = ) { + my $sequence = ; + chomp $sequence; + + my $sequence_length = length($sequence); + + my $count; + + if ( index($name, "-")==-1 ) { + #Assume this file is not collapsed, just count each seqeunce as 1 + $count = 1 ; + } else { + #Assume file is collapsed (that is - sequence-ID has two numbers with a separating dash) + (undef, $count) = $name =~ /^\>(\d+)\-(\d+)$/ ; + + # If the match failed, treat this fasta as not collapsed; + $count = 1 if not defined $count ; + } + + $histogram{$sequence_length} += $count ; +} + +#Textual Output +if (0) { + print "Length\tCount\n"; + foreach my $length_key ( sort { $a <=> $b } keys %histogram ) { + print $length_key,"\t", $histogram{$length_key},"\n"; + } + exit 0; +} + +## Build the data as required by GD::Graph::bars. +## Data list has two items (each item is itself a list) +## 1. a list of x-axis labels (these are the keys from the histogram) +## 2. a list of values +my @data = ( + [ sort { $a <=> $b } keys %histogram ], + [ map { $histogram{$_} } sort { $a <=> $b } keys %histogram ] ) ; + +my $graph = new GD::Graph::bars (1000,800); + +$graph->set( + x_label => 'Length', + y_label => 'Amount', + title => 'Sequences lengths Distribution (after clipping)', + bar_spacing => 10, + transparent => 0, + t_margin => 10, + y_tick_number => 20, + y_long_ticks => 1, + ) or die $graph->error; + +$graph->plot(\@data) or die $graph->error; +print OUT $graph->gd->png; + +close IN; +close OUT; diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/scripts/fastq_quality_boxplot_graph.sh --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/scripts/fastq_quality_boxplot_graph.sh Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,94 @@ +#!/bin/sh + +# FASTX-toolkit - FASTA/FASTQ preprocessing tools. +# Copyright (C) 2009 A. Gordon (gordon@cshl.edu) +# +# This program is free software: you can redistribute it and/or modify +# it under the terms of the GNU Affero General Public License as +# published by the Free Software Foundation, either version 3 of the +# License, or (at your option) any later version. +# +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY; without even the implied warranty of +# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the +# GNU Affero General Public License for more details. +# +# You should have received a copy of the GNU Affero General Public License +# along with this program. If not, see . + +function usage() +{ + echo "Solexa-Quality BoxPlot plotter" + echo "Generates a solexa quality score box-plot graph " + echo + echo "Usage: $0 [-i INPUT.TXT] [-t TITLE] [-p] [-o OUTPUT]" + echo + echo " [-p] - Generate PostScript (.PS) file. Default is PNG image." + echo " [-i INPUT.TXT] - Input file. Should be the output of \"solexa_quality_statistics\" program." + echo " [-o OUTPUT] - Output file name. default is STDOUT." + echo " [-t TITLE] - Title (usually the solexa file name) - will be plotted on the graph." + echo + exit +} + +# +# Input Data columns: #pos cnt min max sum mean Q1 med Q3 IQR lW rW A_Count C_Count G_Count T_Count N_Count +# As produced by "solexa_quality_statistics" program + +TITLE="" # default title is empty +FILENAME="" +OUTPUTTERM="set term png size 2048,768" # default output terminal is "PNG" +OUTPUTFILE="/dev/stdout" # Default output file is simply "stdout" +while getopts ":t:i:o:ph" Option + do + case $Option in + # w ) CMD=$OPTARG; FILENAME="PIMSLogList.txt"; TARGET="logfiles"; ;; + t ) TITLE="for $OPTARG" ;; + i ) FILENAME=$OPTARG ;; + o ) OUTPUTFILE="$OPTARG" ;; + p ) OUTPUTTERM="set term postscript enhanced color \"Helvetica\" 8" ;; + h ) usage ;; + * ) echo "unrecognized argument. use '-h' for usage information."; exit -1 ;; + esac +done +shift $(($OPTIND - 1)) + + +if [ "$FILENAME" == "" ]; then + usage +fi + +if [ ! -r "$FILENAME" ]; then + echo "Error: can't open input file ($1)." >&2 + exit 1 +fi + +#Read number of cycles from the stats file (each line is a cycle, minus the header line) +#But for the graph, I want xrange to reach (num_cycles+1), so I don't subtract 1 now. +NUM_CYCLES=$(cat "$FILENAME" | wc -l) + +GNUPLOTCMD=" +$OUTPUTTERM +set boxwidth 0.8 +set size 1,1 +set key Left inside +set xlabel \"read position\" +set ylabel \"Quality Score (Solexa Scale: 40=Highest, -15=Lowest)\" +set title \"Quality Scores $TITLE\" +#set auto x +set bars 4.0 +set xrange [ 0: $NUM_CYCLES ] +set yrange [-15:45] +set y2range [-15:45] +set xtics 1 +set x2tics 1 +set ytics 2 +set y2tics 2 +set tics out +set grid ytics +set style fill empty +plot '$FILENAME' using 1:7:11:12:9 with candlesticks lt 1 lw 1 title 'Quartiles' whiskerbars, \ + '' using 1:8:8:8:8 with candlesticks lt -1 lw 2 title 'Medians' +" + +echo "$GNUPLOTCMD" | gnuplot > "$OUTPUTFILE" diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/scripts/fastx_barcode_splitter.pl --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/scripts/fastx_barcode_splitter.pl Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,472 @@ +#!/usr/bin/perl + +# FASTX-toolkit - FASTA/FASTQ preprocessing tools. +# Copyright (C) 2009 A. Gordon (gordon@cshl.edu) +# +# This program is free software: you can redistribute it and/or modify +# it under the terms of the GNU Affero General Public License as +# published by the Free Software Foundation, either version 3 of the +# License, or (at your option) any later version. +# +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY; without even the implied warranty of +# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the +# GNU Affero General Public License for more details. +# +# You should have received a copy of the GNU Affero General Public License +# along with this program. If not, see . + +use strict; +use warnings; +use IO::Handle; +use Data::Dumper; +use Getopt::Long; +use Carp; + +## +## This program splits a FASTQ/FASTA file into several smaller files, +## Based on barcode matching. +## +## run with "--help" for usage information +## +## Assaf Gordon , 11sep2008 + +# Forward declarations +sub load_barcode_file ($); +sub parse_command_line ; +sub match_sequences ; +sub mismatch_count($$) ; +sub print_results; +sub open_and_detect_input_format; +sub read_record; +sub write_record($); +sub usage(); + +# Global flags and arguments, +# Set by command line argumens +my $barcode_file ; +my $barcodes_at_eol = 0 ; +my $barcodes_at_bol = 0 ; +my $exact_match = 0 ; +my $allow_partial_overlap = 0; +my $allowed_mismatches = 1; +my $newfile_suffix = ''; +my $newfile_prefix ; +my $quiet = 0 ; +my $debug = 0 ; +my $fastq_format = 1; + +# Global variables +# Populated by 'create_output_files' +my %filenames; +my %files; +my %counts = ( 'unmatched' => 0 ); +my $barcodes_length; +my @barcodes; +my $input_file_io; + + +# The Four lines per record in FASTQ format. +# (when using FASTA format, only the first two are used) +my $seq_name; +my $seq_bases; +my $seq_name2; +my $seq_qualities; + + +# +# Start of Program +# +parse_command_line ; + +load_barcode_file ( $barcode_file ) ; + +open_and_detect_input_format; + +match_sequences ; + +print_results unless $quiet; + +# +# End of program +# + + + + + + + + +sub parse_command_line { + my $help; + + usage() if (scalar @ARGV==0); + + my $result = GetOptions ( "bcfile=s" => \$barcode_file, + "eol" => \$barcodes_at_eol, + "bol" => \$barcodes_at_bol, + "exact" => \$exact_match, + "prefix=s" => \$newfile_prefix, + "suffix=s" => \$newfile_suffix, + "quiet" => \$quiet, + "partial=i" => \$allow_partial_overlap, + "debug" => \$debug, + "mismatches=i" => \$allowed_mismatches, + "help" => \$help + ) ; + + usage() if ($help); + + die "Error: barcode file not specified (use '--bcfile [FILENAME]')\n" unless defined $barcode_file; + die "Error: prefix path/filename not specified (use '--prefix [PATH]')\n" unless defined $newfile_prefix; + + if ($barcodes_at_bol == $barcodes_at_eol) { + die "Error: can't specify both --eol & --bol\n" if $barcodes_at_eol; + die "Error: must specify either --eol or --bol\n" ; + } + + die "Error: invalid for value partial matches (valid values are 0 or greater)\n" if $allow_partial_overlap<0; + + $allowed_mismatches = 0 if $exact_match; + + die "Error: invalid value for mismatches (valid values are 0 or more)\n" if ($allowed_mismatches<0); + + die "Error: partial overlap value ($allow_partial_overlap) bigger than " . + "max. allowed mismatches ($allowed_mismatches)\n" if ($allow_partial_overlap > $allowed_mismatches); + + + exit unless $result; +} + + + +# +# Read the barcode file +# +sub load_barcode_file ($) { + my $filename = shift or croak "Missing barcode file name"; + + open BCFILE,"<$filename" or die "Error: failed to open barcode file ($filename)\n"; + while () { + next if m/^#/; + chomp; + my ($ident, $barcode) = split ; + + $barcode = uc($barcode); + + # Sanity checks on the barcodes + die "Error: bad data at barcode file ($filename) line $.\n" unless defined $barcode; + die "Error: bad barcode value ($barcode) at barcode file ($filename) line $.\n" + unless $barcode =~ m/^[AGCT]+$/; + + die "Error: bad identifier value ($ident) at barcode file ($filename) line $. (must be alphanumeric)\n" + unless $ident =~ m/^\w+$/; + + die "Error: badcode($ident, $barcode) is shorter or equal to maximum number of " . + "mismatches ($allowed_mismatches). This makes no sense. Specify fewer mismatches.\n" + if length($barcode)<=$allowed_mismatches; + + $barcodes_length = length($barcode) unless defined $barcodes_length; + die "Error: found barcodes in different lengths. this feature is not supported yet.\n" + unless $barcodes_length == length($barcode); + + push @barcodes, [$ident, $barcode]; + + if ($allow_partial_overlap>0) { + foreach my $i (1 .. $allow_partial_overlap) { + substr $barcode, ($barcodes_at_bol)?0:-1, 1, ''; + push @barcodes, [$ident, $barcode]; + } + } + } + close BCFILE; + + if ($debug) { + print STDERR "barcode\tsequence\n"; + foreach my $barcoderef (@barcodes) { + my ($ident, $seq) = @{$barcoderef}; + print STDERR $ident,"\t", $seq ,"\n"; + } + } +} + +# Create one output file for each barcode. +# (Also create a file for the dummy 'unmatched' barcode) +sub create_output_files { + my %barcodes = map { $_->[0] => 1 } @barcodes; #generate a uniq list of barcode identifiers; + $barcodes{'unmatched'} = 1 ; + + foreach my $ident (keys %barcodes) { + my $new_filename = $newfile_prefix . $ident . $newfile_suffix; + $filenames{$ident} = $new_filename; + open my $file, ">$new_filename" or die "Error: failed to create output file ($new_filename)\n"; + $files{$ident} = $file ; + } +} + +sub match_sequences { + + my %barcodes = map { $_->[0] => 1 } @barcodes; #generate a uniq list of barcode identifiers; + $barcodes{'unmatched'} = 1 ; + + #reset counters + foreach my $ident ( keys %barcodes ) { + $counts{$ident} = 0; + } + + create_output_files; + + # Read file FASTQ file + # split accotding to barcodes + while ( read_record ) { + chomp $seq_bases; + + print STDERR "sequence $seq_bases: \n" if $debug; + + my $best_barcode_mismatches_count = $barcodes_length; + my $best_barcode_ident = undef; + + #Try all barcodes, find the one with the lowest mismatch count + foreach my $barcoderef (@barcodes) { + my ($ident, $barcode) = @{$barcoderef}; + + # Get DNA fragment (in the length of the barcodes) + # The barcode will be tested only against this fragment + # (no point in testing the barcode against the whole sequence) + my $sequence_fragment; + if ($barcodes_at_bol) { + $sequence_fragment = substr $seq_bases, 0, $barcodes_length; + } else { + $sequence_fragment = substr $seq_bases, - $barcodes_length; + } + + my $mm = mismatch_count($sequence_fragment, $barcode) ; + + # if this is a partial match, add the non-overlap as a mismatch + # (partial barcodes are shorter than the length of the original barcodes) + $mm += ($barcodes_length - length($barcode)); + + if ( $mm < $best_barcode_mismatches_count ) { + $best_barcode_mismatches_count = $mm ; + $best_barcode_ident = $ident ; + } + } + + $best_barcode_ident = 'unmatched' + if ( (!defined $best_barcode_ident) || $best_barcode_mismatches_count>$allowed_mismatches) ; + + print STDERR "sequence $seq_bases matched barcode: $best_barcode_ident\n" if $debug; + + $counts{$best_barcode_ident}++; + + #get the file associated with the matched barcode. + #(note: there's also a file associated with 'unmatched' barcode) + my $file = $files{$best_barcode_ident}; + + write_record($file); + } +} + +#Quickly calculate hamming distance between two strings +# +#NOTE: Strings must be same length. +# returns number of different characters. +#see http://www.perlmonks.org/?node_id=500235 +sub mismatch_count($$) { length( $_[ 0 ] ) - ( ( $_[ 0 ] ^ $_[ 1 ] ) =~ tr[\0][\0] ) } + + + +sub print_results +{ + print "Barcode\tCount\tLocation\n"; + my $total = 0 ; + foreach my $ident (sort keys %counts) { + print $ident, "\t", $counts{$ident},"\t",$filenames{$ident},"\n"; + $total += $counts{$ident}; + } + print "total\t",$total,"\n"; +} + + +sub read_record +{ + $seq_name = $input_file_io->getline(); + + return undef unless defined $seq_name; # End of file? + + $seq_bases = $input_file_io->getline(); + die "Error: bad input file, expecting line with sequences\n" unless defined $seq_bases; + + # If using FASTQ format, read two more lines + if ($fastq_format) { + $seq_name2 = $input_file_io->getline(); + die "Error: bad input file, expecting line with sequence name2\n" unless defined $seq_name2; + + $seq_qualities = $input_file_io->getline(); + die "Error: bad input file, expecting line with quality scores\n" unless defined $seq_qualities; + } + return 1; +} + +sub write_record($) +{ + my $file = shift; + + croak "Bad file handle" unless defined $file; + + print $file $seq_name; + print $file $seq_bases,"\n"; + + #if using FASTQ format, write two more lines + if ($fastq_format) { + print $file $seq_name2; + print $file $seq_qualities; + } +} + +sub open_and_detect_input_format +{ + $input_file_io = new IO::Handle; + die "Failed to open STDIN " unless $input_file_io->fdopen(fileno(STDIN),"r"); + + # Get the first characeter, and push it back + my $first_char = $input_file_io->getc(); + $input_file_io->ungetc(ord $first_char); + + if ($first_char eq '>') { + # FASTA format + $fastq_format = 0 ; + print STDERR "Detected FASTA format\n" if $debug; + } elsif ($first_char eq '@') { + # FASTQ format + $fastq_format = 1; + print STDERR "Detected FASTQ format\n" if $debug; + } else { + die "Error: unknown file format. First character = '$first_char' (expecting > or \@)\n"; + } +} + +sub usage() +{ +print<. + +# +#This is a shell script wrapper for 'fastx_barcode_splitter.pl' +# +# 1. Output files are saved at a predefined location +# (Which was made publicly accessible using apache) +# +# 2. 'fastx_barcode_splitter.pl' outputs a textual table. +# This script turns it into pretty HTML with working URL +# (so lazy users can just click on the URLs and get thier files) + +BASEPATH="/media/sdb1/galaxy/barcode_splits/" +PUBLICURL="http://tango.cshl.edu/barcode_splits/" + +BARCODE_FILE="$1" +FASTQ_FILE="$2" +LIBNAME="$3" +shift 3 +# The rest of the parameters are passed to the split program + +if [ "$LIBNAME" == "" ]; then + echo "Usage: $0 [BARCODE FILE] [FASTQ FILE] [LIBRARY_NAME]" >&2 + exit 1 +fi + +#Sanitize library name, make sure we can create a file with this name +LIBNAME=${LIBNAME//\.gz/} +LIBNAME=${LIBNAME//\.txt/} +LIBNAME=${LIBNAME//[^[:alnum:]]/_} + +if [ ! -r "$FASTQ_FILE" ]; then + echo "Error: Input file ($FASTQ_FILE) not found!" >&2 + exit 1 +fi +if [ ! -r "$BARCODE_FILE" ]; then + echo "Error: barcode file ($BARCODE_FILE) not found!" >&2 + exit 1 +fi + +PREFIX="$BASEPATH"`date "+%Y-%m-%d_%H%M__"`"${LIBNAME}__" +SUFFIX=".txt" + +RESULTS=`zcat -f "$FASTQ_FILE" | fastx_barcode_splitter.pl --bcfile "$BARCODE_FILE" --prefix "$PREFIX" --suffix "$SUFFIX" "$@"` +if [ $? != 0 ]; then + echo "error" +fi + +# +# Convert the textual tab-separated table into simple HTML table, +# with the local path replaces with a valid URL +echo "" +echo "$RESULTS" | sed "s|$BASEPATH|$PUBLICURL|" | sed ' +i
+s|\t||g +s|http.*|&<\/a>| +a<\/td><\/tr> +' +echo "

Copy these files to your local computer, as they will be soon deleted." +echo "

" diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/scripts/fastx_nucleotide_distribution_graph.sh --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/scripts/fastx_nucleotide_distribution_graph.sh Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,90 @@ +#!/bin/sh + +# FASTX-toolkit - FASTA/FASTQ preprocessing tools. +# Copyright (C) 2009 A. Gordon (gordon@cshl.edu) +# +# This program is free software: you can redistribute it and/or modify +# it under the terms of the GNU Affero General Public License as +# published by the Free Software Foundation, either version 3 of the +# License, or (at your option) any later version. +# +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY; without even the implied warranty of +# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the +# GNU Affero General Public License for more details. +# +# You should have received a copy of the GNU Affero General Public License +# along with this program. If not, see . + +usage() +{ + echo "FASTA/Q Nucleotide Distribution Plotter" + echo + echo "Usage: $0 [-i INPUT.TXT] [-t TITLE] [-p] [-o OUTPUT]" + echo + echo " [-p] - Generate PostScript (.PS) file. Default is PNG image." + echo " [-i INPUT.TXT] - Input file. Should be the output of \"fastx_quality_statistics\" program." + echo " [-o OUTPUT] - Output file name. default is STDOUT." + echo " [-t TITLE] - Title - will be plotted on the graph." + echo + exit +} + +# +# Input Data columns: #pos cnt min max sum mean Q1 med Q3 IQR lW rW A_Count C_Count G_Count T_Count N_Count +# As produced by "fastq_quality_statistics" program + +TITLE="" # default title is empty +FILENAME="" +OUTPUTTERM="set term png size 1048,768" # default output terminal is "PNG" +OUTPUTFILE="/dev/stdout" # Default output file is simply "stdout" +while getopts ":t:i:o:ph" Option + do + case $Option in + t ) TITLE="for $OPTARG" ;; + i ) FILENAME=$OPTARG ;; + o ) OUTPUTFILE="$OPTARG" ;; + p ) OUTPUTTERM="set term postscript enhanced color \"Helvetica\" 8" ;; + h ) usage ;; + * ) echo "unrecognized argument. use '-h' for usage information."; exit -1 ;; + esac +done +shift $(($OPTIND - 1)) + + +if [ -z "$FILENAME" ]; then + usage +fi + +if [ ! -r "$FILENAME" ]; then + echo "Error: can't open input file ($1)." >&2 + exit 1 +fi + +GNUPLOTCMD=" +$OUTPUTTERM +set boxwidth 0.75 absolute +set size 1,1 +set style fill solid 1.00 border -1 +set xlabel \"read position\" +set title \"Nucleotides distribution $TITLE\" +set ylabel \"% of total (per read position)\" +#set grid noxtics nomxtics ytics nomytics noztics nomztics \ +# nox2tics nomx2tics noy2tics nomy2tics nocbtics nomcbtics +#set grid layerdefault linetype 0 linewidth 1.000, linetype 0 linewidth 1.000 +set key outside right top vertical Left reverse enhanced autotitles columnhead nobox +set key invert samplen 4 spacing 1 width 0 height 0 +set style histogram rowstacked +set style data histograms +set noytics +set xtics 1 +set yrange [ 0.00000 : 100.000 ] noreverse nowriteback + +plot '$FILENAME' using (100.*column(13)/column(18)):xtic(1) title \"A\" lt rgb \"#5050ff\", \ + '' using (100.*column(14)/column(18)) title \"C\" lt rgb \"#e00000\", \ + '' using (100.*column(15)/column(18)) title \"G\" lt rgb \"#00c000\", \ + '' using (100.*column(16)/column(18)) title \"T\" lt rgb \"#e6e600\", \ + '' using (100.*column(17)/column(18)) title \"N\" lt rgb \"pink\" +" + +echo "$GNUPLOTCMD" | gnuplot > "$OUTPUTFILE" diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/Makefile.am --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/Makefile.am Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,23 @@ +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +SUBDIRS = libfastx \ + fastx_clipper \ + fastx_trimmer \ + fastx_quality_stats \ + fastq_quality_converter \ + fastq_to_fasta \ + fastq_quality_filter \ + fastx_artifacts_filter \ + fastx_reverse_complement \ + fastx_collapser \ + seqalign_test + + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/Makefile.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/Makefile.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,486 @@ +# Makefile.in generated by automake 1.10.1 from Makefile.am. +# @configure_input@ + +# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, +# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This Makefile.in is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +@SET_MAKE@ + +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. +VPATH = @srcdir@ +pkgdatadir = $(datadir)/@PACKAGE@ +pkglibdir = $(libdir)/@PACKAGE@ +pkgincludedir = $(includedir)/@PACKAGE@ +am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd +install_sh_DATA = $(install_sh) -c -m 644 +install_sh_PROGRAM = $(install_sh) -c +install_sh_SCRIPT = $(install_sh) -c +INSTALL_HEADER = $(INSTALL_DATA) +transform = $(program_transform_name) +NORMAL_INSTALL = : +PRE_INSTALL = : +POST_INSTALL = : +NORMAL_UNINSTALL = : +PRE_UNINSTALL = : +POST_UNINSTALL = : +build_triplet = @build@ +host_triplet = @host@ +subdir = src +DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in +ACLOCAL_M4 = $(top_srcdir)/aclocal.m4 +am__aclocal_m4_deps = $(top_srcdir)/configure.ac +am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \ + $(ACLOCAL_M4) +mkinstalldirs = $(install_sh) -d +CONFIG_HEADER = $(top_builddir)/config.h +CONFIG_CLEAN_FILES = +SOURCES = +DIST_SOURCES = +RECURSIVE_TARGETS = all-recursive check-recursive dvi-recursive \ + html-recursive info-recursive install-data-recursive \ + install-dvi-recursive install-exec-recursive \ + install-html-recursive install-info-recursive \ + install-pdf-recursive install-ps-recursive install-recursive \ + installcheck-recursive installdirs-recursive pdf-recursive \ + ps-recursive uninstall-recursive +RECURSIVE_CLEAN_TARGETS = mostlyclean-recursive clean-recursive \ + distclean-recursive maintainer-clean-recursive +ETAGS = etags +CTAGS = ctags +DIST_SUBDIRS = $(SUBDIRS) +DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST) +ACLOCAL = @ACLOCAL@ +AMTAR = @AMTAR@ +AUTOCONF = @AUTOCONF@ +AUTOHEADER = @AUTOHEADER@ +AUTOMAKE = @AUTOMAKE@ +AWK = @AWK@ +CC = @CC@ +CCDEPMODE = @CCDEPMODE@ +CFLAGS = @CFLAGS@ +CPP = @CPP@ +CPPFLAGS = @CPPFLAGS@ +CXX = @CXX@ +CXXCPP = @CXXCPP@ +CXXDEPMODE = @CXXDEPMODE@ +CXXFLAGS = @CXXFLAGS@ +CYGPATH_W = @CYGPATH_W@ +DEFS = @DEFS@ +DEPDIR = @DEPDIR@ +ECHO_C = @ECHO_C@ +ECHO_N = @ECHO_N@ +ECHO_T = @ECHO_T@ +EGREP = @EGREP@ +EXEEXT = @EXEEXT@ +GREP = @GREP@ +INSTALL = @INSTALL@ +INSTALL_DATA = @INSTALL_DATA@ +INSTALL_PROGRAM = @INSTALL_PROGRAM@ +INSTALL_SCRIPT = @INSTALL_SCRIPT@ +INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@ +LDFLAGS = @LDFLAGS@ +LIBOBJS = @LIBOBJS@ +LIBS = @LIBS@ +LTLIBOBJS = @LTLIBOBJS@ +MAKEINFO = @MAKEINFO@ +MKDIR_P = @MKDIR_P@ +OBJEXT = @OBJEXT@ +PACKAGE = @PACKAGE@ +PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@ +PACKAGE_NAME = @PACKAGE_NAME@ +PACKAGE_STRING = @PACKAGE_STRING@ +PACKAGE_TARNAME = @PACKAGE_TARNAME@ +PACKAGE_VERSION = @PACKAGE_VERSION@ +PATH_SEPARATOR = @PATH_SEPARATOR@ +RANLIB = @RANLIB@ +SET_MAKE = @SET_MAKE@ +SHELL = @SHELL@ +STRIP = @STRIP@ +VERSION = @VERSION@ +abs_builddir = @abs_builddir@ +abs_srcdir = @abs_srcdir@ +abs_top_builddir = @abs_top_builddir@ +abs_top_srcdir = @abs_top_srcdir@ +ac_ct_CC = @ac_ct_CC@ +ac_ct_CXX = @ac_ct_CXX@ +am__include = @am__include@ +am__leading_dot = @am__leading_dot@ +am__quote = @am__quote@ +am__tar = @am__tar@ +am__untar = @am__untar@ +bindir = @bindir@ +build = @build@ +build_alias = @build_alias@ +build_cpu = @build_cpu@ +build_os = @build_os@ +build_vendor = @build_vendor@ +builddir = @builddir@ +canonical_host_type = @canonical_host_type@ +datadir = @datadir@ +datarootdir = @datarootdir@ +docdir = @docdir@ +dvidir = @dvidir@ +exec_prefix = @exec_prefix@ +host = @host@ +host_alias = @host_alias@ +host_cpu = @host_cpu@ +host_os = @host_os@ +host_vendor = @host_vendor@ +htmldir = @htmldir@ +includedir = @includedir@ +infodir = @infodir@ +install_sh = @install_sh@ +libdir = @libdir@ +libexecdir = @libexecdir@ +localedir = @localedir@ +localstatedir = @localstatedir@ +mandir = @mandir@ +mkdir_p = @mkdir_p@ +oldincludedir = @oldincludedir@ +pdfdir = @pdfdir@ +prefix = @prefix@ +program_transform_name = @program_transform_name@ +psdir = @psdir@ +sbindir = @sbindir@ +sharedstatedir = @sharedstatedir@ +srcdir = @srcdir@ +sysconfdir = @sysconfdir@ +target_alias = @target_alias@ +top_builddir = @top_builddir@ +top_srcdir = @top_srcdir@ +SUBDIRS = libfastx \ + fastx_clipper \ + fastx_trimmer \ + fastx_quality_stats \ + fastq_quality_converter \ + fastq_to_fasta \ + fastq_quality_filter \ + fastx_artifacts_filter \ + fastx_reverse_complement \ + fastx_collapser \ + seqalign_test + +all: all-recursive + +.SUFFIXES: +$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps) + @for dep in $?; do \ + case '$(am__configure_deps)' in \ + *$$dep*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh \ + && exit 0; \ + exit 1;; \ + esac; \ + done; \ + echo ' cd $(top_srcdir) && $(AUTOMAKE) --gnu src/Makefile'; \ + cd $(top_srcdir) && \ + $(AUTOMAKE) --gnu src/Makefile +.PRECIOUS: Makefile +Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status + @case '$?' in \ + *config.status*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \ + *) \ + echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \ + cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \ + esac; + +$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +$(top_srcdir)/configure: $(am__configure_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +$(ACLOCAL_M4): $(am__aclocal_m4_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +# This directory's subdirectories are mostly independent; you can cd +# into them and run `make' without going through this Makefile. +# To change the values of `make' variables: instead of editing Makefiles, +# (1) if the variable is set in `config.status', edit `config.status' +# (which will cause the Makefiles to be regenerated when you run `make'); +# (2) otherwise, pass the desired values on the `make' command line. +$(RECURSIVE_TARGETS): + @failcom='exit 1'; \ + for f in x $$MAKEFLAGS; do \ + case $$f in \ + *=* | --[!k]*);; \ + *k*) failcom='fail=yes';; \ + esac; \ + done; \ + dot_seen=no; \ + target=`echo $@ | sed s/-recursive//`; \ + list='$(SUBDIRS)'; for subdir in $$list; do \ + echo "Making $$target in $$subdir"; \ + if test "$$subdir" = "."; then \ + dot_seen=yes; \ + local_target="$$target-am"; \ + else \ + local_target="$$target"; \ + fi; \ + (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) $$local_target) \ + || eval $$failcom; \ + done; \ + if test "$$dot_seen" = "no"; then \ + $(MAKE) $(AM_MAKEFLAGS) "$$target-am" || exit 1; \ + fi; test -z "$$fail" + +$(RECURSIVE_CLEAN_TARGETS): + @failcom='exit 1'; \ + for f in x $$MAKEFLAGS; do \ + case $$f in \ + *=* | --[!k]*);; \ + *k*) failcom='fail=yes';; \ + esac; \ + done; \ + dot_seen=no; \ + case "$@" in \ + distclean-* | maintainer-clean-*) list='$(DIST_SUBDIRS)' ;; \ + *) list='$(SUBDIRS)' ;; \ + esac; \ + rev=''; for subdir in $$list; do \ + if test "$$subdir" = "."; then :; else \ + rev="$$subdir $$rev"; \ + fi; \ + done; \ + rev="$$rev ."; \ + target=`echo $@ | sed s/-recursive//`; \ + for subdir in $$rev; do \ + echo "Making $$target in $$subdir"; \ + if test "$$subdir" = "."; then \ + local_target="$$target-am"; \ + else \ + local_target="$$target"; \ + fi; \ + (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) $$local_target) \ + || eval $$failcom; \ + done && test -z "$$fail" +tags-recursive: + list='$(SUBDIRS)'; for subdir in $$list; do \ + test "$$subdir" = . || (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) tags); \ + done +ctags-recursive: + list='$(SUBDIRS)'; for subdir in $$list; do \ + test "$$subdir" = . || (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) ctags); \ + done + +ID: $(HEADERS) $(SOURCES) $(LISP) $(TAGS_FILES) + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonemtpy = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + mkid -fID $$unique +tags: TAGS + +TAGS: tags-recursive $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + here=`pwd`; \ + if ($(ETAGS) --etags-include --version) >/dev/null 2>&1; then \ + include_option=--etags-include; \ + empty_fix=.; \ + else \ + include_option=--include; \ + empty_fix=; \ + fi; \ + list='$(SUBDIRS)'; for subdir in $$list; do \ + if test "$$subdir" = .; then :; else \ + test ! -f $$subdir/TAGS || \ + tags="$$tags $$include_option=$$here/$$subdir/TAGS"; \ + fi; \ + done; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + if test -z "$(ETAGS_ARGS)$$tags$$unique"; then :; else \ + test -n "$$unique" || unique=$$empty_fix; \ + $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \ + $$tags $$unique; \ + fi +ctags: CTAGS +CTAGS: ctags-recursive $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + test -z "$(CTAGS_ARGS)$$tags$$unique" \ + || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \ + $$tags $$unique + +GTAGS: + here=`$(am__cd) $(top_builddir) && pwd` \ + && cd $(top_srcdir) \ + && gtags -i $(GTAGS_ARGS) $$here + +distclean-tags: + -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags + +distdir: $(DISTFILES) + @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + list='$(DISTFILES)'; \ + dist_files=`for file in $$list; do echo $$file; done | \ + sed -e "s|^$$srcdirstrip/||;t" \ + -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \ + case $$dist_files in \ + */*) $(MKDIR_P) `echo "$$dist_files" | \ + sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \ + sort -u` ;; \ + esac; \ + for file in $$dist_files; do \ + if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \ + if test -d $$d/$$file; then \ + dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \ + if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \ + cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \ + fi; \ + cp -pR $$d/$$file $(distdir)$$dir || exit 1; \ + else \ + test -f $(distdir)/$$file \ + || cp -p $$d/$$file $(distdir)/$$file \ + || exit 1; \ + fi; \ + done + list='$(DIST_SUBDIRS)'; for subdir in $$list; do \ + if test "$$subdir" = .; then :; else \ + test -d "$(distdir)/$$subdir" \ + || $(MKDIR_P) "$(distdir)/$$subdir" \ + || exit 1; \ + distdir=`$(am__cd) $(distdir) && pwd`; \ + top_distdir=`$(am__cd) $(top_distdir) && pwd`; \ + (cd $$subdir && \ + $(MAKE) $(AM_MAKEFLAGS) \ + top_distdir="$$top_distdir" \ + distdir="$$distdir/$$subdir" \ + am__remove_distdir=: \ + am__skip_length_check=: \ + distdir) \ + || exit 1; \ + fi; \ + done +check-am: all-am +check: check-recursive +all-am: Makefile +installdirs: installdirs-recursive +installdirs-am: +install: install-recursive +install-exec: install-exec-recursive +install-data: install-data-recursive +uninstall: uninstall-recursive + +install-am: all-am + @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am + +installcheck: installcheck-recursive +install-strip: + $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \ + install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \ + `test -z '$(STRIP)' || \ + echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install +mostlyclean-generic: + +clean-generic: + +distclean-generic: + -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES) + +maintainer-clean-generic: + @echo "This command is intended for maintainers to use" + @echo "it deletes files that may require special tools to rebuild." +clean: clean-recursive + +clean-am: clean-generic mostlyclean-am + +distclean: distclean-recursive + -rm -f Makefile +distclean-am: clean-am distclean-generic distclean-tags + +dvi: dvi-recursive + +dvi-am: + +html: html-recursive + +info: info-recursive + +info-am: + +install-data-am: + +install-dvi: install-dvi-recursive + +install-exec-am: + +install-html: install-html-recursive + +install-info: install-info-recursive + +install-man: + +install-pdf: install-pdf-recursive + +install-ps: install-ps-recursive + +installcheck-am: + +maintainer-clean: maintainer-clean-recursive + -rm -f Makefile +maintainer-clean-am: distclean-am maintainer-clean-generic + +mostlyclean: mostlyclean-recursive + +mostlyclean-am: mostlyclean-generic + +pdf: pdf-recursive + +pdf-am: + +ps: ps-recursive + +ps-am: + +uninstall-am: + +.MAKE: $(RECURSIVE_CLEAN_TARGETS) $(RECURSIVE_TARGETS) install-am \ + install-strip + +.PHONY: $(RECURSIVE_CLEAN_TARGETS) $(RECURSIVE_TARGETS) CTAGS GTAGS \ + all all-am check check-am clean clean-generic ctags \ + ctags-recursive distclean distclean-generic distclean-tags \ + distdir dvi dvi-am html html-am info info-am install \ + install-am install-data install-data-am install-dvi \ + install-dvi-am install-exec install-exec-am install-html \ + install-html-am install-info install-info-am install-man \ + install-pdf install-pdf-am install-ps install-ps-am \ + install-strip installcheck installcheck-am installdirs \ + installdirs-am maintainer-clean maintainer-clean-generic \ + mostlyclean mostlyclean-generic pdf pdf-am ps ps-am tags \ + tags-recursive uninstall uninstall-am + +# Tell versions [3.59,3.63) of GNU make to not export all variables. +# Otherwise a system limit (for SysV at least) may be exceeded. +.NOEXPORT: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastq_quality_converter/Makefile.am --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastq_quality_converter/Makefile.am Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,21 @@ +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + + +bin_PROGRAMS = fastq_quality_converter + +AM_CPPFLAGS = \ + $(CC_WARNINGS) \ + -I../libfastx + +fastq_quality_converter_SOURCES = fastq_quality_converter.c + +fastq_quality_converter_LDADD = ../libfastx/libfastx.a + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastq_quality_converter/Makefile.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastq_quality_converter/Makefile.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,440 @@ +# Makefile.in generated by automake 1.10.1 from Makefile.am. +# @configure_input@ + +# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, +# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This Makefile.in is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +@SET_MAKE@ + +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +VPATH = @srcdir@ +pkgdatadir = $(datadir)/@PACKAGE@ +pkglibdir = $(libdir)/@PACKAGE@ +pkgincludedir = $(includedir)/@PACKAGE@ +am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd +install_sh_DATA = $(install_sh) -c -m 644 +install_sh_PROGRAM = $(install_sh) -c +install_sh_SCRIPT = $(install_sh) -c +INSTALL_HEADER = $(INSTALL_DATA) +transform = $(program_transform_name) +NORMAL_INSTALL = : +PRE_INSTALL = : +POST_INSTALL = : +NORMAL_UNINSTALL = : +PRE_UNINSTALL = : +POST_UNINSTALL = : +build_triplet = @build@ +host_triplet = @host@ +bin_PROGRAMS = fastq_quality_converter$(EXEEXT) +subdir = src/fastq_quality_converter +DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in +ACLOCAL_M4 = $(top_srcdir)/aclocal.m4 +am__aclocal_m4_deps = $(top_srcdir)/configure.ac +am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \ + $(ACLOCAL_M4) +mkinstalldirs = $(install_sh) -d +CONFIG_HEADER = $(top_builddir)/config.h +CONFIG_CLEAN_FILES = +am__installdirs = "$(DESTDIR)$(bindir)" +binPROGRAMS_INSTALL = $(INSTALL_PROGRAM) +PROGRAMS = $(bin_PROGRAMS) +am_fastq_quality_converter_OBJECTS = \ + fastq_quality_converter.$(OBJEXT) +fastq_quality_converter_OBJECTS = \ + $(am_fastq_quality_converter_OBJECTS) +fastq_quality_converter_DEPENDENCIES = ../libfastx/libfastx.a +DEFAULT_INCLUDES = -I.@am__isrc@ -I$(top_builddir) +depcomp = $(SHELL) $(top_srcdir)/config/depcomp +am__depfiles_maybe = depfiles +COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \ + $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS) +CCLD = $(CC) +LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@ +SOURCES = $(fastq_quality_converter_SOURCES) +DIST_SOURCES = $(fastq_quality_converter_SOURCES) +ETAGS = etags +CTAGS = ctags +DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST) +ACLOCAL = @ACLOCAL@ +AMTAR = @AMTAR@ +AUTOCONF = @AUTOCONF@ +AUTOHEADER = @AUTOHEADER@ +AUTOMAKE = @AUTOMAKE@ +AWK = @AWK@ +CC = @CC@ +CCDEPMODE = @CCDEPMODE@ +CFLAGS = @CFLAGS@ +CPP = @CPP@ +CPPFLAGS = @CPPFLAGS@ +CXX = @CXX@ +CXXCPP = @CXXCPP@ +CXXDEPMODE = @CXXDEPMODE@ +CXXFLAGS = @CXXFLAGS@ +CYGPATH_W = @CYGPATH_W@ +DEFS = @DEFS@ +DEPDIR = @DEPDIR@ +ECHO_C = @ECHO_C@ +ECHO_N = @ECHO_N@ +ECHO_T = @ECHO_T@ +EGREP = @EGREP@ +EXEEXT = @EXEEXT@ +GREP = @GREP@ +INSTALL = @INSTALL@ +INSTALL_DATA = @INSTALL_DATA@ +INSTALL_PROGRAM = @INSTALL_PROGRAM@ +INSTALL_SCRIPT = @INSTALL_SCRIPT@ +INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@ +LDFLAGS = @LDFLAGS@ +LIBOBJS = @LIBOBJS@ +LIBS = @LIBS@ +LTLIBOBJS = @LTLIBOBJS@ +MAKEINFO = @MAKEINFO@ +MKDIR_P = @MKDIR_P@ +OBJEXT = @OBJEXT@ +PACKAGE = @PACKAGE@ +PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@ +PACKAGE_NAME = @PACKAGE_NAME@ +PACKAGE_STRING = @PACKAGE_STRING@ +PACKAGE_TARNAME = @PACKAGE_TARNAME@ +PACKAGE_VERSION = @PACKAGE_VERSION@ +PATH_SEPARATOR = @PATH_SEPARATOR@ +RANLIB = @RANLIB@ +SET_MAKE = @SET_MAKE@ +SHELL = @SHELL@ +STRIP = @STRIP@ +VERSION = @VERSION@ +abs_builddir = @abs_builddir@ +abs_srcdir = @abs_srcdir@ +abs_top_builddir = @abs_top_builddir@ +abs_top_srcdir = @abs_top_srcdir@ +ac_ct_CC = @ac_ct_CC@ +ac_ct_CXX = @ac_ct_CXX@ +am__include = @am__include@ +am__leading_dot = @am__leading_dot@ +am__quote = @am__quote@ +am__tar = @am__tar@ +am__untar = @am__untar@ +bindir = @bindir@ +build = @build@ +build_alias = @build_alias@ +build_cpu = @build_cpu@ +build_os = @build_os@ +build_vendor = @build_vendor@ +builddir = @builddir@ +canonical_host_type = @canonical_host_type@ +datadir = @datadir@ +datarootdir = @datarootdir@ +docdir = @docdir@ +dvidir = @dvidir@ +exec_prefix = @exec_prefix@ +host = @host@ +host_alias = @host_alias@ +host_cpu = @host_cpu@ +host_os = @host_os@ +host_vendor = @host_vendor@ +htmldir = @htmldir@ +includedir = @includedir@ +infodir = @infodir@ +install_sh = @install_sh@ +libdir = @libdir@ +libexecdir = @libexecdir@ +localedir = @localedir@ +localstatedir = @localstatedir@ +mandir = @mandir@ +mkdir_p = @mkdir_p@ +oldincludedir = @oldincludedir@ +pdfdir = @pdfdir@ +prefix = @prefix@ +program_transform_name = @program_transform_name@ +psdir = @psdir@ +sbindir = @sbindir@ +sharedstatedir = @sharedstatedir@ +srcdir = @srcdir@ +sysconfdir = @sysconfdir@ +target_alias = @target_alias@ +top_builddir = @top_builddir@ +top_srcdir = @top_srcdir@ +AM_CPPFLAGS = \ + $(CC_WARNINGS) \ + -I../libfastx + +fastq_quality_converter_SOURCES = fastq_quality_converter.c +fastq_quality_converter_LDADD = ../libfastx/libfastx.a +all: all-am + +.SUFFIXES: +.SUFFIXES: .c .o .obj +$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps) + @for dep in $?; do \ + case '$(am__configure_deps)' in \ + *$$dep*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh \ + && exit 0; \ + exit 1;; \ + esac; \ + done; \ + echo ' cd $(top_srcdir) && $(AUTOMAKE) --gnu src/fastq_quality_converter/Makefile'; \ + cd $(top_srcdir) && \ + $(AUTOMAKE) --gnu src/fastq_quality_converter/Makefile +.PRECIOUS: Makefile +Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status + @case '$?' in \ + *config.status*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \ + *) \ + echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \ + cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \ + esac; + +$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +$(top_srcdir)/configure: $(am__configure_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +$(ACLOCAL_M4): $(am__aclocal_m4_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +install-binPROGRAMS: $(bin_PROGRAMS) + @$(NORMAL_INSTALL) + test -z "$(bindir)" || $(MKDIR_P) "$(DESTDIR)$(bindir)" + @list='$(bin_PROGRAMS)'; for p in $$list; do \ + p1=`echo $$p|sed 's/$(EXEEXT)$$//'`; \ + if test -f $$p \ + ; then \ + f=`echo "$$p1" | sed 's,^.*/,,;$(transform);s/$$/$(EXEEXT)/'`; \ + echo " $(INSTALL_PROGRAM_ENV) $(binPROGRAMS_INSTALL) '$$p' '$(DESTDIR)$(bindir)/$$f'"; \ + $(INSTALL_PROGRAM_ENV) $(binPROGRAMS_INSTALL) "$$p" "$(DESTDIR)$(bindir)/$$f" || exit 1; \ + else :; fi; \ + done + +uninstall-binPROGRAMS: + @$(NORMAL_UNINSTALL) + @list='$(bin_PROGRAMS)'; for p in $$list; do \ + f=`echo "$$p" | sed 's,^.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/'`; \ + echo " rm -f '$(DESTDIR)$(bindir)/$$f'"; \ + rm -f "$(DESTDIR)$(bindir)/$$f"; \ + done + +clean-binPROGRAMS: + -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS) +fastq_quality_converter$(EXEEXT): $(fastq_quality_converter_OBJECTS) $(fastq_quality_converter_DEPENDENCIES) + @rm -f fastq_quality_converter$(EXEEXT) + $(LINK) $(fastq_quality_converter_OBJECTS) $(fastq_quality_converter_LDADD) $(LIBS) + +mostlyclean-compile: + -rm -f *.$(OBJEXT) + +distclean-compile: + -rm -f *.tab.c + +@AMDEP_TRUE@@am__include@ @am__quote@./$(DEPDIR)/fastq_quality_converter.Po@am__quote@ + +.c.o: +@am__fastdepCC_TRUE@ $(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $< +@am__fastdepCC_TRUE@ mv -f $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po +@AMDEP_TRUE@@am__fastdepCC_FALSE@ source='$<' object='$@' libtool=no @AMDEPBACKSLASH@ +@AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@ +@am__fastdepCC_FALSE@ $(COMPILE) -c $< + +.c.obj: +@am__fastdepCC_TRUE@ $(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'` +@am__fastdepCC_TRUE@ mv -f $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po +@AMDEP_TRUE@@am__fastdepCC_FALSE@ source='$<' object='$@' libtool=no @AMDEPBACKSLASH@ +@AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@ +@am__fastdepCC_FALSE@ $(COMPILE) -c `$(CYGPATH_W) '$<'` + +ID: $(HEADERS) $(SOURCES) $(LISP) $(TAGS_FILES) + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonemtpy = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + mkid -fID $$unique +tags: TAGS + +TAGS: $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + here=`pwd`; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + if test -z "$(ETAGS_ARGS)$$tags$$unique"; then :; else \ + test -n "$$unique" || unique=$$empty_fix; \ + $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \ + $$tags $$unique; \ + fi +ctags: CTAGS +CTAGS: $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + test -z "$(CTAGS_ARGS)$$tags$$unique" \ + || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \ + $$tags $$unique + +GTAGS: + here=`$(am__cd) $(top_builddir) && pwd` \ + && cd $(top_srcdir) \ + && gtags -i $(GTAGS_ARGS) $$here + +distclean-tags: + -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags + +distdir: $(DISTFILES) + @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + list='$(DISTFILES)'; \ + dist_files=`for file in $$list; do echo $$file; done | \ + sed -e "s|^$$srcdirstrip/||;t" \ + -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \ + case $$dist_files in \ + */*) $(MKDIR_P) `echo "$$dist_files" | \ + sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \ + sort -u` ;; \ + esac; \ + for file in $$dist_files; do \ + if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \ + if test -d $$d/$$file; then \ + dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \ + if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \ + cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \ + fi; \ + cp -pR $$d/$$file $(distdir)$$dir || exit 1; \ + else \ + test -f $(distdir)/$$file \ + || cp -p $$d/$$file $(distdir)/$$file \ + || exit 1; \ + fi; \ + done +check-am: all-am +check: check-am +all-am: Makefile $(PROGRAMS) +installdirs: + for dir in "$(DESTDIR)$(bindir)"; do \ + test -z "$$dir" || $(MKDIR_P) "$$dir"; \ + done +install: install-am +install-exec: install-exec-am +install-data: install-data-am +uninstall: uninstall-am + +install-am: all-am + @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am + +installcheck: installcheck-am +install-strip: + $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \ + install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \ + `test -z '$(STRIP)' || \ + echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install +mostlyclean-generic: + +clean-generic: + +distclean-generic: + -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES) + +maintainer-clean-generic: + @echo "This command is intended for maintainers to use" + @echo "it deletes files that may require special tools to rebuild." +clean: clean-am + +clean-am: clean-binPROGRAMS clean-generic mostlyclean-am + +distclean: distclean-am + -rm -rf ./$(DEPDIR) + -rm -f Makefile +distclean-am: clean-am distclean-compile distclean-generic \ + distclean-tags + +dvi: dvi-am + +dvi-am: + +html: html-am + +info: info-am + +info-am: + +install-data-am: + +install-dvi: install-dvi-am + +install-exec-am: install-binPROGRAMS + +install-html: install-html-am + +install-info: install-info-am + +install-man: + +install-pdf: install-pdf-am + +install-ps: install-ps-am + +installcheck-am: + +maintainer-clean: maintainer-clean-am + -rm -rf ./$(DEPDIR) + -rm -f Makefile +maintainer-clean-am: distclean-am maintainer-clean-generic + +mostlyclean: mostlyclean-am + +mostlyclean-am: mostlyclean-compile mostlyclean-generic + +pdf: pdf-am + +pdf-am: + +ps: ps-am + +ps-am: + +uninstall-am: uninstall-binPROGRAMS + +.MAKE: install-am install-strip + +.PHONY: CTAGS GTAGS all all-am check check-am clean clean-binPROGRAMS \ + clean-generic ctags distclean distclean-compile \ + distclean-generic distclean-tags distdir dvi dvi-am html \ + html-am info info-am install install-am install-binPROGRAMS \ + install-data install-data-am install-dvi install-dvi-am \ + install-exec install-exec-am install-html install-html-am \ + install-info install-info-am install-man install-pdf \ + install-pdf-am install-ps install-ps-am install-strip \ + installcheck installcheck-am installdirs maintainer-clean \ + maintainer-clean-generic mostlyclean mostlyclean-compile \ + mostlyclean-generic pdf pdf-am ps ps-am tags uninstall \ + uninstall-am uninstall-binPROGRAMS + +# Tell versions [3.59,3.63) of GNU make to not export all variables. +# Otherwise a system limit (for SysV at least) may be exceeded. +.NOEXPORT: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastq_quality_converter/fastq_quality_converter.c --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastq_quality_converter/fastq_quality_converter.c Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,83 @@ +/* + FASTX-toolkit - FASTA/FASTQ preprocessing tools. + Copyright (C) 2009 A. Gordon (gordon@cshl.edu) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU Affero General Public License as + published by the Free Software Foundation, either version 3 of the + License, or (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU Affero General Public License for more details. + + You should have received a copy of the GNU Affero General Public License + along with this program. If not, see . +*/ +#include +#include +#include +#include +#include +#include +#include + +#include + +#include "fastx.h" +#include "fastx_args.h" + +const char* usage= +"usage: fastq_quality_converter [-h] [-a] [-n] [-z] [-i INFILE] [-f OUTFILE]\n" \ +"\n" \ +"version " VERSION "\n" \ +" [-h] = This helpful help screen.\n" \ +" [-a] = Output ASCII quality scores (default).\n" \ +" [-n] = Output numeric quality scores.\n" \ +" [-z] = Compress output with GZIP.\n" \ +" [-i INFILE] = FASTA/Q input file. default is STDIN.\n" \ +" [-o OUTFILE] = FASTA output file. default is STDOUT.\n" \ +"\n"; + +FASTX fastx; +int flag_output_ascii = 1; + +int parse_program_args(int __attribute__((unused)) optind, int optc, char __attribute__((unused)) *optarg) +{ + switch(optc) { + case 'a': //this is the default, nothing to change + break; + + case 'n': + flag_output_ascii = 0 ; + break; + default: + errx(1, __FILE__ ":%d: Unknown argument (%c)", __LINE__, optc ) ; + } + return 1; +} + + +int main(int argc, char* argv[]) +{ + fastx_parse_cmdline(argc, argv, "an", parse_program_args); + + fastx_init_reader(&fastx, get_input_filename(), + FASTQ_ONLY, ALLOW_N, REQUIRE_UPPERCASE); + + fastx_init_writer(&fastx, get_output_filename(), + flag_output_ascii ? OUTPUT_FASTQ_ASCII_QUAL : OUTPUT_FASTQ_NUMERIC_QUAL, + compress_output_flag()); + + while ( fastx_read_next_record(&fastx) ) { + fastx_write_record(&fastx); + } + + //Print verbose report + if ( verbose_flag() ) { + fprintf(get_report_file(), "Input: %zu reads.\n", num_input_reads(&fastx) ) ; + fprintf(get_report_file(), "Output: %zu reads.\n", num_output_reads(&fastx) ) ; + } + return 0; +} diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastq_quality_filter/Makefile.am --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastq_quality_filter/Makefile.am Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,21 @@ +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + + +bin_PROGRAMS = fastq_quality_filter + +AM_CPPFLAGS = \ + $(CC_WARNINGS) \ + -I../libfastx + +fastq_quality_filter_SOURCES = fastq_quality_filter.c + +fastq_quality_filter_LDADD = ../libfastx/libfastx.a + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastq_quality_filter/Makefile.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastq_quality_filter/Makefile.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,438 @@ +# Makefile.in generated by automake 1.10.1 from Makefile.am. +# @configure_input@ + +# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, +# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This Makefile.in is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +@SET_MAKE@ + +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +VPATH = @srcdir@ +pkgdatadir = $(datadir)/@PACKAGE@ +pkglibdir = $(libdir)/@PACKAGE@ +pkgincludedir = $(includedir)/@PACKAGE@ +am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd +install_sh_DATA = $(install_sh) -c -m 644 +install_sh_PROGRAM = $(install_sh) -c +install_sh_SCRIPT = $(install_sh) -c +INSTALL_HEADER = $(INSTALL_DATA) +transform = $(program_transform_name) +NORMAL_INSTALL = : +PRE_INSTALL = : +POST_INSTALL = : +NORMAL_UNINSTALL = : +PRE_UNINSTALL = : +POST_UNINSTALL = : +build_triplet = @build@ +host_triplet = @host@ +bin_PROGRAMS = fastq_quality_filter$(EXEEXT) +subdir = src/fastq_quality_filter +DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in +ACLOCAL_M4 = $(top_srcdir)/aclocal.m4 +am__aclocal_m4_deps = $(top_srcdir)/configure.ac +am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \ + $(ACLOCAL_M4) +mkinstalldirs = $(install_sh) -d +CONFIG_HEADER = $(top_builddir)/config.h +CONFIG_CLEAN_FILES = +am__installdirs = "$(DESTDIR)$(bindir)" +binPROGRAMS_INSTALL = $(INSTALL_PROGRAM) +PROGRAMS = $(bin_PROGRAMS) +am_fastq_quality_filter_OBJECTS = fastq_quality_filter.$(OBJEXT) +fastq_quality_filter_OBJECTS = $(am_fastq_quality_filter_OBJECTS) +fastq_quality_filter_DEPENDENCIES = ../libfastx/libfastx.a +DEFAULT_INCLUDES = -I.@am__isrc@ -I$(top_builddir) +depcomp = $(SHELL) $(top_srcdir)/config/depcomp +am__depfiles_maybe = depfiles +COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \ + $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS) +CCLD = $(CC) +LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@ +SOURCES = $(fastq_quality_filter_SOURCES) +DIST_SOURCES = $(fastq_quality_filter_SOURCES) +ETAGS = etags +CTAGS = ctags +DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST) +ACLOCAL = @ACLOCAL@ +AMTAR = @AMTAR@ +AUTOCONF = @AUTOCONF@ +AUTOHEADER = @AUTOHEADER@ +AUTOMAKE = @AUTOMAKE@ +AWK = @AWK@ +CC = @CC@ +CCDEPMODE = @CCDEPMODE@ +CFLAGS = @CFLAGS@ +CPP = @CPP@ +CPPFLAGS = @CPPFLAGS@ +CXX = @CXX@ +CXXCPP = @CXXCPP@ +CXXDEPMODE = @CXXDEPMODE@ +CXXFLAGS = @CXXFLAGS@ +CYGPATH_W = @CYGPATH_W@ +DEFS = @DEFS@ +DEPDIR = @DEPDIR@ +ECHO_C = @ECHO_C@ +ECHO_N = @ECHO_N@ +ECHO_T = @ECHO_T@ +EGREP = @EGREP@ +EXEEXT = @EXEEXT@ +GREP = @GREP@ +INSTALL = @INSTALL@ +INSTALL_DATA = @INSTALL_DATA@ +INSTALL_PROGRAM = @INSTALL_PROGRAM@ +INSTALL_SCRIPT = @INSTALL_SCRIPT@ +INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@ +LDFLAGS = @LDFLAGS@ +LIBOBJS = @LIBOBJS@ +LIBS = @LIBS@ +LTLIBOBJS = @LTLIBOBJS@ +MAKEINFO = @MAKEINFO@ +MKDIR_P = @MKDIR_P@ +OBJEXT = @OBJEXT@ +PACKAGE = @PACKAGE@ +PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@ +PACKAGE_NAME = @PACKAGE_NAME@ +PACKAGE_STRING = @PACKAGE_STRING@ +PACKAGE_TARNAME = @PACKAGE_TARNAME@ +PACKAGE_VERSION = @PACKAGE_VERSION@ +PATH_SEPARATOR = @PATH_SEPARATOR@ +RANLIB = @RANLIB@ +SET_MAKE = @SET_MAKE@ +SHELL = @SHELL@ +STRIP = @STRIP@ +VERSION = @VERSION@ +abs_builddir = @abs_builddir@ +abs_srcdir = @abs_srcdir@ +abs_top_builddir = @abs_top_builddir@ +abs_top_srcdir = @abs_top_srcdir@ +ac_ct_CC = @ac_ct_CC@ +ac_ct_CXX = @ac_ct_CXX@ +am__include = @am__include@ +am__leading_dot = @am__leading_dot@ +am__quote = @am__quote@ +am__tar = @am__tar@ +am__untar = @am__untar@ +bindir = @bindir@ +build = @build@ +build_alias = @build_alias@ +build_cpu = @build_cpu@ +build_os = @build_os@ +build_vendor = @build_vendor@ +builddir = @builddir@ +canonical_host_type = @canonical_host_type@ +datadir = @datadir@ +datarootdir = @datarootdir@ +docdir = @docdir@ +dvidir = @dvidir@ +exec_prefix = @exec_prefix@ +host = @host@ +host_alias = @host_alias@ +host_cpu = @host_cpu@ +host_os = @host_os@ +host_vendor = @host_vendor@ +htmldir = @htmldir@ +includedir = @includedir@ +infodir = @infodir@ +install_sh = @install_sh@ +libdir = @libdir@ +libexecdir = @libexecdir@ +localedir = @localedir@ +localstatedir = @localstatedir@ +mandir = @mandir@ +mkdir_p = @mkdir_p@ +oldincludedir = @oldincludedir@ +pdfdir = @pdfdir@ +prefix = @prefix@ +program_transform_name = @program_transform_name@ +psdir = @psdir@ +sbindir = @sbindir@ +sharedstatedir = @sharedstatedir@ +srcdir = @srcdir@ +sysconfdir = @sysconfdir@ +target_alias = @target_alias@ +top_builddir = @top_builddir@ +top_srcdir = @top_srcdir@ +AM_CPPFLAGS = \ + $(CC_WARNINGS) \ + -I../libfastx + +fastq_quality_filter_SOURCES = fastq_quality_filter.c +fastq_quality_filter_LDADD = ../libfastx/libfastx.a +all: all-am + +.SUFFIXES: +.SUFFIXES: .c .o .obj +$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps) + @for dep in $?; do \ + case '$(am__configure_deps)' in \ + *$$dep*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh \ + && exit 0; \ + exit 1;; \ + esac; \ + done; \ + echo ' cd $(top_srcdir) && $(AUTOMAKE) --gnu src/fastq_quality_filter/Makefile'; \ + cd $(top_srcdir) && \ + $(AUTOMAKE) --gnu src/fastq_quality_filter/Makefile +.PRECIOUS: Makefile +Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status + @case '$?' in \ + *config.status*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \ + *) \ + echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \ + cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \ + esac; + +$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +$(top_srcdir)/configure: $(am__configure_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +$(ACLOCAL_M4): $(am__aclocal_m4_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +install-binPROGRAMS: $(bin_PROGRAMS) + @$(NORMAL_INSTALL) + test -z "$(bindir)" || $(MKDIR_P) "$(DESTDIR)$(bindir)" + @list='$(bin_PROGRAMS)'; for p in $$list; do \ + p1=`echo $$p|sed 's/$(EXEEXT)$$//'`; \ + if test -f $$p \ + ; then \ + f=`echo "$$p1" | sed 's,^.*/,,;$(transform);s/$$/$(EXEEXT)/'`; \ + echo " $(INSTALL_PROGRAM_ENV) $(binPROGRAMS_INSTALL) '$$p' '$(DESTDIR)$(bindir)/$$f'"; \ + $(INSTALL_PROGRAM_ENV) $(binPROGRAMS_INSTALL) "$$p" "$(DESTDIR)$(bindir)/$$f" || exit 1; \ + else :; fi; \ + done + +uninstall-binPROGRAMS: + @$(NORMAL_UNINSTALL) + @list='$(bin_PROGRAMS)'; for p in $$list; do \ + f=`echo "$$p" | sed 's,^.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/'`; \ + echo " rm -f '$(DESTDIR)$(bindir)/$$f'"; \ + rm -f "$(DESTDIR)$(bindir)/$$f"; \ + done + +clean-binPROGRAMS: + -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS) +fastq_quality_filter$(EXEEXT): $(fastq_quality_filter_OBJECTS) $(fastq_quality_filter_DEPENDENCIES) + @rm -f fastq_quality_filter$(EXEEXT) + $(LINK) $(fastq_quality_filter_OBJECTS) $(fastq_quality_filter_LDADD) $(LIBS) + +mostlyclean-compile: + -rm -f *.$(OBJEXT) + +distclean-compile: + -rm -f *.tab.c + +@AMDEP_TRUE@@am__include@ @am__quote@./$(DEPDIR)/fastq_quality_filter.Po@am__quote@ + +.c.o: +@am__fastdepCC_TRUE@ $(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $< +@am__fastdepCC_TRUE@ mv -f $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po +@AMDEP_TRUE@@am__fastdepCC_FALSE@ source='$<' object='$@' libtool=no @AMDEPBACKSLASH@ +@AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@ +@am__fastdepCC_FALSE@ $(COMPILE) -c $< + +.c.obj: +@am__fastdepCC_TRUE@ $(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'` +@am__fastdepCC_TRUE@ mv -f $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po +@AMDEP_TRUE@@am__fastdepCC_FALSE@ source='$<' object='$@' libtool=no @AMDEPBACKSLASH@ +@AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@ +@am__fastdepCC_FALSE@ $(COMPILE) -c `$(CYGPATH_W) '$<'` + +ID: $(HEADERS) $(SOURCES) $(LISP) $(TAGS_FILES) + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonemtpy = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + mkid -fID $$unique +tags: TAGS + +TAGS: $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + here=`pwd`; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + if test -z "$(ETAGS_ARGS)$$tags$$unique"; then :; else \ + test -n "$$unique" || unique=$$empty_fix; \ + $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \ + $$tags $$unique; \ + fi +ctags: CTAGS +CTAGS: $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + test -z "$(CTAGS_ARGS)$$tags$$unique" \ + || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \ + $$tags $$unique + +GTAGS: + here=`$(am__cd) $(top_builddir) && pwd` \ + && cd $(top_srcdir) \ + && gtags -i $(GTAGS_ARGS) $$here + +distclean-tags: + -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags + +distdir: $(DISTFILES) + @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + list='$(DISTFILES)'; \ + dist_files=`for file in $$list; do echo $$file; done | \ + sed -e "s|^$$srcdirstrip/||;t" \ + -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \ + case $$dist_files in \ + */*) $(MKDIR_P) `echo "$$dist_files" | \ + sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \ + sort -u` ;; \ + esac; \ + for file in $$dist_files; do \ + if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \ + if test -d $$d/$$file; then \ + dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \ + if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \ + cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \ + fi; \ + cp -pR $$d/$$file $(distdir)$$dir || exit 1; \ + else \ + test -f $(distdir)/$$file \ + || cp -p $$d/$$file $(distdir)/$$file \ + || exit 1; \ + fi; \ + done +check-am: all-am +check: check-am +all-am: Makefile $(PROGRAMS) +installdirs: + for dir in "$(DESTDIR)$(bindir)"; do \ + test -z "$$dir" || $(MKDIR_P) "$$dir"; \ + done +install: install-am +install-exec: install-exec-am +install-data: install-data-am +uninstall: uninstall-am + +install-am: all-am + @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am + +installcheck: installcheck-am +install-strip: + $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \ + install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \ + `test -z '$(STRIP)' || \ + echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install +mostlyclean-generic: + +clean-generic: + +distclean-generic: + -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES) + +maintainer-clean-generic: + @echo "This command is intended for maintainers to use" + @echo "it deletes files that may require special tools to rebuild." +clean: clean-am + +clean-am: clean-binPROGRAMS clean-generic mostlyclean-am + +distclean: distclean-am + -rm -rf ./$(DEPDIR) + -rm -f Makefile +distclean-am: clean-am distclean-compile distclean-generic \ + distclean-tags + +dvi: dvi-am + +dvi-am: + +html: html-am + +info: info-am + +info-am: + +install-data-am: + +install-dvi: install-dvi-am + +install-exec-am: install-binPROGRAMS + +install-html: install-html-am + +install-info: install-info-am + +install-man: + +install-pdf: install-pdf-am + +install-ps: install-ps-am + +installcheck-am: + +maintainer-clean: maintainer-clean-am + -rm -rf ./$(DEPDIR) + -rm -f Makefile +maintainer-clean-am: distclean-am maintainer-clean-generic + +mostlyclean: mostlyclean-am + +mostlyclean-am: mostlyclean-compile mostlyclean-generic + +pdf: pdf-am + +pdf-am: + +ps: ps-am + +ps-am: + +uninstall-am: uninstall-binPROGRAMS + +.MAKE: install-am install-strip + +.PHONY: CTAGS GTAGS all all-am check check-am clean clean-binPROGRAMS \ + clean-generic ctags distclean distclean-compile \ + distclean-generic distclean-tags distdir dvi dvi-am html \ + html-am info info-am install install-am install-binPROGRAMS \ + install-data install-data-am install-dvi install-dvi-am \ + install-exec install-exec-am install-html install-html-am \ + install-info install-info-am install-man install-pdf \ + install-pdf-am install-ps install-ps-am install-strip \ + installcheck installcheck-am installdirs maintainer-clean \ + maintainer-clean-generic mostlyclean mostlyclean-compile \ + mostlyclean-generic pdf pdf-am ps ps-am tags uninstall \ + uninstall-am uninstall-binPROGRAMS + +# Tell versions [3.59,3.63) of GNU make to not export all variables. +# Otherwise a system limit (for SysV at least) may be exceeded. +.NOEXPORT: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastq_quality_filter/fastq_quality_filter.c --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastq_quality_filter/fastq_quality_filter.c Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,177 @@ +/* + FASTX-toolkit - FASTA/FASTQ preprocessing tools. + Copyright (C) 2009 A. Gordon (gordon@cshl.edu) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU Affero General Public License as + published by the Free Software Foundation, either version 3 of the + License, or (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU Affero General Public License for more details. + + You should have received a copy of the GNU Affero General Public License + along with this program. If not, see . +*/ +#include +#include +#include +#include +#include +#include +#include + +#include + +#include "fastx.h" +#include "fastx_args.h" + +#define MAX_ADAPTER_LEN 100 + +const char* usage= +"usage: fastq_quality_filter [-h] [-v] [-q N] [-p N] [-z] [-i INFILE] [-o OUTFILE]\n" \ +"\n" \ +"version " VERSION "\n" \ +" [-h] = This helpful help screen.\n" \ +" [-q N] = Minimum quality score to keep.\n" \ +" [-p N] = Minimum percent of bases that must have [-q] quality.\n" \ +" [-z] = Compress output with GZIP.\n" \ +" [-i INFILE] = FASTA/Q input file. default is STDIN.\n" \ +" [-o OUTFILE] = FASTA/Q output file. default is STDOUT.\n" \ +" [-v] = Verbose - report number of sequences.\n" \ +" If [-o] is specified, report will be printed to STDOUT.\n" \ +" If [-o] is not specified (and output goes to STDOUT),\n" \ +" report will be printed to STDERR.\n" \ +"\n"; + +#define DO_NOT_TRIM_LAST_BASE (0) + +int min_quality=0; +int min_percent=0; + +FASTX fastx; + +int parse_program_args(int __attribute__((unused)) optind, int optc, char* optarg) +{ + switch(optc) { + case 'q': + if (optarg==NULL) + errx(1, "[-q] parameter requires an argument value"); + min_quality = strtoul(optarg,NULL,10); + break; + + case 'p': + if (optarg==NULL) + errx(1, "[-l] parameter requires an argument value"); + min_percent = strtoul(optarg,NULL,10); + if (min_percent<=0 || min_percent>100) + errx(1,"Invalid percent value (-p %s)", optarg); + break; + default: + errx(1, __FILE__ ":%d: Unknown argument (%c)", __LINE__, optc ) ; + } + return 1; +} + +int get_index_of_nth_element(int *array, int array_size, int n) +{ + int pos; + + //Find the first nono-empty index + pos = 0 ; + while ( pos < array_size && array[pos]==0 ) + pos++; + + #if 0 + fprintf(stderr,"n=%d\n", n); + for (i=0; i< array_size; i++) { + if (array[i] != 0) + fprintf(stderr, "[%d]=%d ", i + MIN_QUALITY_VALUE, array[i]) ; + } + fprintf(stderr,"\n"); + #endif + + if (pos == array_size) + errx(1,"bug: got empty array at %s:%d", __FILE__, __LINE__); + + while (n > 0) { + if (array[pos] > n) + break; + n -= array[pos]; + pos++; + while (array[pos]==0 && pos < array_size) + pos++; + } + return pos; +} + +int get_percentile_quality(const FASTX *fastx, int percentile) +{ + size_t i; + int count=0; + int quality_values[QUALITY_VALUES_RANGE]; + + memset(quality_values, 0, sizeof(quality_values)); + + for (i=0; i< strlen(fastx->nucleotides); i++) { + count++; + quality_values[ fastx->quality[i] - MIN_QUALITY_VALUE ] ++ ; + } + + i = get_index_of_nth_element(quality_values, QUALITY_VALUES_RANGE, (count * (100-percentile) / 100)); + + //printf(" n = %d, i = %d, i+MIN_QUAL_VALUE=%d\n", + // (count*(100-percentile)/100), i, i+MIN_QUALITY_VALUE) ; + + return i + MIN_QUALITY_VALUE ; +} + +int main(int argc, char* argv[]) +{ + fastx_parse_cmdline(argc, argv, "q:p:", parse_program_args); + + fastx_init_reader(&fastx, get_input_filename(), + FASTQ_ONLY, ALLOW_N, REQUIRE_UPPERCASE); + + fastx_init_writer(&fastx, get_output_filename(), OUTPUT_SAME_AS_INPUT, compress_output_flag()); + + while ( fastx_read_next_record(&fastx) ) { + #if 0 + fprintf(stderr, "%s\n", fastx.nucleotides ) ; + for (i=0; i= min_quality) { + fastx_write_record(&fastx); + } else { + // fprintf(stderr, "%s\n", fastx.nucleotides ) ; + // fprintf(stderr, "value = %d\n", value ) ; + } + } + + // + //Print verbose report + if ( verbose_flag() ) { + fprintf(get_report_file(), "Quality cut-off: %d\n", min_quality); + fprintf(get_report_file(), "Minimum percentage: %d\n", min_percent); + + fprintf(get_report_file(), "Input: %zu reads.\n", num_input_reads(&fastx) ) ; + fprintf(get_report_file(), "Output: %zu reads.\n", num_output_reads(&fastx) ) ; + + size_t discarded = num_input_reads(&fastx) - num_output_reads(&fastx) ; + fprintf(get_report_file(), "discarded %zu (%zu%%) low-quality reads.\n", + discarded, (discarded*100)/( num_input_reads(&fastx) ) ) ; + } + + return 0; +} diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastq_to_fasta/Makefile.am --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastq_to_fasta/Makefile.am Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,21 @@ +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + + +bin_PROGRAMS = fastq_to_fasta + +AM_CPPFLAGS = \ + $(CC_WARNINGS) \ + -I../libfastx + +fastq_to_fasta_SOURCES = fastq_to_fasta.c + +fastq_to_fasta_LDADD = ../libfastx/libfastx.a + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastq_to_fasta/Makefile.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastq_to_fasta/Makefile.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,438 @@ +# Makefile.in generated by automake 1.10.1 from Makefile.am. +# @configure_input@ + +# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, +# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This Makefile.in is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +@SET_MAKE@ + +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +VPATH = @srcdir@ +pkgdatadir = $(datadir)/@PACKAGE@ +pkglibdir = $(libdir)/@PACKAGE@ +pkgincludedir = $(includedir)/@PACKAGE@ +am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd +install_sh_DATA = $(install_sh) -c -m 644 +install_sh_PROGRAM = $(install_sh) -c +install_sh_SCRIPT = $(install_sh) -c +INSTALL_HEADER = $(INSTALL_DATA) +transform = $(program_transform_name) +NORMAL_INSTALL = : +PRE_INSTALL = : +POST_INSTALL = : +NORMAL_UNINSTALL = : +PRE_UNINSTALL = : +POST_UNINSTALL = : +build_triplet = @build@ +host_triplet = @host@ +bin_PROGRAMS = fastq_to_fasta$(EXEEXT) +subdir = src/fastq_to_fasta +DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in +ACLOCAL_M4 = $(top_srcdir)/aclocal.m4 +am__aclocal_m4_deps = $(top_srcdir)/configure.ac +am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \ + $(ACLOCAL_M4) +mkinstalldirs = $(install_sh) -d +CONFIG_HEADER = $(top_builddir)/config.h +CONFIG_CLEAN_FILES = +am__installdirs = "$(DESTDIR)$(bindir)" +binPROGRAMS_INSTALL = $(INSTALL_PROGRAM) +PROGRAMS = $(bin_PROGRAMS) +am_fastq_to_fasta_OBJECTS = fastq_to_fasta.$(OBJEXT) +fastq_to_fasta_OBJECTS = $(am_fastq_to_fasta_OBJECTS) +fastq_to_fasta_DEPENDENCIES = ../libfastx/libfastx.a +DEFAULT_INCLUDES = -I.@am__isrc@ -I$(top_builddir) +depcomp = $(SHELL) $(top_srcdir)/config/depcomp +am__depfiles_maybe = depfiles +COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \ + $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS) +CCLD = $(CC) +LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@ +SOURCES = $(fastq_to_fasta_SOURCES) +DIST_SOURCES = $(fastq_to_fasta_SOURCES) +ETAGS = etags +CTAGS = ctags +DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST) +ACLOCAL = @ACLOCAL@ +AMTAR = @AMTAR@ +AUTOCONF = @AUTOCONF@ +AUTOHEADER = @AUTOHEADER@ +AUTOMAKE = @AUTOMAKE@ +AWK = @AWK@ +CC = @CC@ +CCDEPMODE = @CCDEPMODE@ +CFLAGS = @CFLAGS@ +CPP = @CPP@ +CPPFLAGS = @CPPFLAGS@ +CXX = @CXX@ +CXXCPP = @CXXCPP@ +CXXDEPMODE = @CXXDEPMODE@ +CXXFLAGS = @CXXFLAGS@ +CYGPATH_W = @CYGPATH_W@ +DEFS = @DEFS@ +DEPDIR = @DEPDIR@ +ECHO_C = @ECHO_C@ +ECHO_N = @ECHO_N@ +ECHO_T = @ECHO_T@ +EGREP = @EGREP@ +EXEEXT = @EXEEXT@ +GREP = @GREP@ +INSTALL = @INSTALL@ +INSTALL_DATA = @INSTALL_DATA@ +INSTALL_PROGRAM = @INSTALL_PROGRAM@ +INSTALL_SCRIPT = @INSTALL_SCRIPT@ +INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@ +LDFLAGS = @LDFLAGS@ +LIBOBJS = @LIBOBJS@ +LIBS = @LIBS@ +LTLIBOBJS = @LTLIBOBJS@ +MAKEINFO = @MAKEINFO@ +MKDIR_P = @MKDIR_P@ +OBJEXT = @OBJEXT@ +PACKAGE = @PACKAGE@ +PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@ +PACKAGE_NAME = @PACKAGE_NAME@ +PACKAGE_STRING = @PACKAGE_STRING@ +PACKAGE_TARNAME = @PACKAGE_TARNAME@ +PACKAGE_VERSION = @PACKAGE_VERSION@ +PATH_SEPARATOR = @PATH_SEPARATOR@ +RANLIB = @RANLIB@ +SET_MAKE = @SET_MAKE@ +SHELL = @SHELL@ +STRIP = @STRIP@ +VERSION = @VERSION@ +abs_builddir = @abs_builddir@ +abs_srcdir = @abs_srcdir@ +abs_top_builddir = @abs_top_builddir@ +abs_top_srcdir = @abs_top_srcdir@ +ac_ct_CC = @ac_ct_CC@ +ac_ct_CXX = @ac_ct_CXX@ +am__include = @am__include@ +am__leading_dot = @am__leading_dot@ +am__quote = @am__quote@ +am__tar = @am__tar@ +am__untar = @am__untar@ +bindir = @bindir@ +build = @build@ +build_alias = @build_alias@ +build_cpu = @build_cpu@ +build_os = @build_os@ +build_vendor = @build_vendor@ +builddir = @builddir@ +canonical_host_type = @canonical_host_type@ +datadir = @datadir@ +datarootdir = @datarootdir@ +docdir = @docdir@ +dvidir = @dvidir@ +exec_prefix = @exec_prefix@ +host = @host@ +host_alias = @host_alias@ +host_cpu = @host_cpu@ +host_os = @host_os@ +host_vendor = @host_vendor@ +htmldir = @htmldir@ +includedir = @includedir@ +infodir = @infodir@ +install_sh = @install_sh@ +libdir = @libdir@ +libexecdir = @libexecdir@ +localedir = @localedir@ +localstatedir = @localstatedir@ +mandir = @mandir@ +mkdir_p = @mkdir_p@ +oldincludedir = @oldincludedir@ +pdfdir = @pdfdir@ +prefix = @prefix@ +program_transform_name = @program_transform_name@ +psdir = @psdir@ +sbindir = @sbindir@ +sharedstatedir = @sharedstatedir@ +srcdir = @srcdir@ +sysconfdir = @sysconfdir@ +target_alias = @target_alias@ +top_builddir = @top_builddir@ +top_srcdir = @top_srcdir@ +AM_CPPFLAGS = \ + $(CC_WARNINGS) \ + -I../libfastx + +fastq_to_fasta_SOURCES = fastq_to_fasta.c +fastq_to_fasta_LDADD = ../libfastx/libfastx.a +all: all-am + +.SUFFIXES: +.SUFFIXES: .c .o .obj +$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps) + @for dep in $?; do \ + case '$(am__configure_deps)' in \ + *$$dep*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh \ + && exit 0; \ + exit 1;; \ + esac; \ + done; \ + echo ' cd $(top_srcdir) && $(AUTOMAKE) --gnu src/fastq_to_fasta/Makefile'; \ + cd $(top_srcdir) && \ + $(AUTOMAKE) --gnu src/fastq_to_fasta/Makefile +.PRECIOUS: Makefile +Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status + @case '$?' in \ + *config.status*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \ + *) \ + echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \ + cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \ + esac; + +$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +$(top_srcdir)/configure: $(am__configure_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +$(ACLOCAL_M4): $(am__aclocal_m4_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +install-binPROGRAMS: $(bin_PROGRAMS) + @$(NORMAL_INSTALL) + test -z "$(bindir)" || $(MKDIR_P) "$(DESTDIR)$(bindir)" + @list='$(bin_PROGRAMS)'; for p in $$list; do \ + p1=`echo $$p|sed 's/$(EXEEXT)$$//'`; \ + if test -f $$p \ + ; then \ + f=`echo "$$p1" | sed 's,^.*/,,;$(transform);s/$$/$(EXEEXT)/'`; \ + echo " $(INSTALL_PROGRAM_ENV) $(binPROGRAMS_INSTALL) '$$p' '$(DESTDIR)$(bindir)/$$f'"; \ + $(INSTALL_PROGRAM_ENV) $(binPROGRAMS_INSTALL) "$$p" "$(DESTDIR)$(bindir)/$$f" || exit 1; \ + else :; fi; \ + done + +uninstall-binPROGRAMS: + @$(NORMAL_UNINSTALL) + @list='$(bin_PROGRAMS)'; for p in $$list; do \ + f=`echo "$$p" | sed 's,^.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/'`; \ + echo " rm -f '$(DESTDIR)$(bindir)/$$f'"; \ + rm -f "$(DESTDIR)$(bindir)/$$f"; \ + done + +clean-binPROGRAMS: + -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS) +fastq_to_fasta$(EXEEXT): $(fastq_to_fasta_OBJECTS) $(fastq_to_fasta_DEPENDENCIES) + @rm -f fastq_to_fasta$(EXEEXT) + $(LINK) $(fastq_to_fasta_OBJECTS) $(fastq_to_fasta_LDADD) $(LIBS) + +mostlyclean-compile: + -rm -f *.$(OBJEXT) + +distclean-compile: + -rm -f *.tab.c + +@AMDEP_TRUE@@am__include@ @am__quote@./$(DEPDIR)/fastq_to_fasta.Po@am__quote@ + +.c.o: +@am__fastdepCC_TRUE@ $(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $< +@am__fastdepCC_TRUE@ mv -f $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po +@AMDEP_TRUE@@am__fastdepCC_FALSE@ source='$<' object='$@' libtool=no @AMDEPBACKSLASH@ +@AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@ +@am__fastdepCC_FALSE@ $(COMPILE) -c $< + +.c.obj: +@am__fastdepCC_TRUE@ $(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'` +@am__fastdepCC_TRUE@ mv -f $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po +@AMDEP_TRUE@@am__fastdepCC_FALSE@ source='$<' object='$@' libtool=no @AMDEPBACKSLASH@ +@AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@ +@am__fastdepCC_FALSE@ $(COMPILE) -c `$(CYGPATH_W) '$<'` + +ID: $(HEADERS) $(SOURCES) $(LISP) $(TAGS_FILES) + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonemtpy = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + mkid -fID $$unique +tags: TAGS + +TAGS: $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + here=`pwd`; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + if test -z "$(ETAGS_ARGS)$$tags$$unique"; then :; else \ + test -n "$$unique" || unique=$$empty_fix; \ + $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \ + $$tags $$unique; \ + fi +ctags: CTAGS +CTAGS: $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + test -z "$(CTAGS_ARGS)$$tags$$unique" \ + || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \ + $$tags $$unique + +GTAGS: + here=`$(am__cd) $(top_builddir) && pwd` \ + && cd $(top_srcdir) \ + && gtags -i $(GTAGS_ARGS) $$here + +distclean-tags: + -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags + +distdir: $(DISTFILES) + @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + list='$(DISTFILES)'; \ + dist_files=`for file in $$list; do echo $$file; done | \ + sed -e "s|^$$srcdirstrip/||;t" \ + -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \ + case $$dist_files in \ + */*) $(MKDIR_P) `echo "$$dist_files" | \ + sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \ + sort -u` ;; \ + esac; \ + for file in $$dist_files; do \ + if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \ + if test -d $$d/$$file; then \ + dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \ + if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \ + cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \ + fi; \ + cp -pR $$d/$$file $(distdir)$$dir || exit 1; \ + else \ + test -f $(distdir)/$$file \ + || cp -p $$d/$$file $(distdir)/$$file \ + || exit 1; \ + fi; \ + done +check-am: all-am +check: check-am +all-am: Makefile $(PROGRAMS) +installdirs: + for dir in "$(DESTDIR)$(bindir)"; do \ + test -z "$$dir" || $(MKDIR_P) "$$dir"; \ + done +install: install-am +install-exec: install-exec-am +install-data: install-data-am +uninstall: uninstall-am + +install-am: all-am + @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am + +installcheck: installcheck-am +install-strip: + $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \ + install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \ + `test -z '$(STRIP)' || \ + echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install +mostlyclean-generic: + +clean-generic: + +distclean-generic: + -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES) + +maintainer-clean-generic: + @echo "This command is intended for maintainers to use" + @echo "it deletes files that may require special tools to rebuild." +clean: clean-am + +clean-am: clean-binPROGRAMS clean-generic mostlyclean-am + +distclean: distclean-am + -rm -rf ./$(DEPDIR) + -rm -f Makefile +distclean-am: clean-am distclean-compile distclean-generic \ + distclean-tags + +dvi: dvi-am + +dvi-am: + +html: html-am + +info: info-am + +info-am: + +install-data-am: + +install-dvi: install-dvi-am + +install-exec-am: install-binPROGRAMS + +install-html: install-html-am + +install-info: install-info-am + +install-man: + +install-pdf: install-pdf-am + +install-ps: install-ps-am + +installcheck-am: + +maintainer-clean: maintainer-clean-am + -rm -rf ./$(DEPDIR) + -rm -f Makefile +maintainer-clean-am: distclean-am maintainer-clean-generic + +mostlyclean: mostlyclean-am + +mostlyclean-am: mostlyclean-compile mostlyclean-generic + +pdf: pdf-am + +pdf-am: + +ps: ps-am + +ps-am: + +uninstall-am: uninstall-binPROGRAMS + +.MAKE: install-am install-strip + +.PHONY: CTAGS GTAGS all all-am check check-am clean clean-binPROGRAMS \ + clean-generic ctags distclean distclean-compile \ + distclean-generic distclean-tags distdir dvi dvi-am html \ + html-am info info-am install install-am install-binPROGRAMS \ + install-data install-data-am install-dvi install-dvi-am \ + install-exec install-exec-am install-html install-html-am \ + install-info install-info-am install-man install-pdf \ + install-pdf-am install-ps install-ps-am install-strip \ + installcheck installcheck-am installdirs maintainer-clean \ + maintainer-clean-generic mostlyclean mostlyclean-compile \ + mostlyclean-generic pdf pdf-am ps ps-am tags uninstall \ + uninstall-am uninstall-binPROGRAMS + +# Tell versions [3.59,3.63) of GNU make to not export all variables. +# Otherwise a system limit (for SysV at least) may be exceeded. +.NOEXPORT: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastq_to_fasta/fastq_to_fasta.c --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastq_to_fasta/fastq_to_fasta.c Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,102 @@ +/* + FASTX-toolkit - FASTA/FASTQ preprocessing tools. + Copyright (C) 2009 A. Gordon (gordon@cshl.edu) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU Affero General Public License as + published by the Free Software Foundation, either version 3 of the + License, or (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU Affero General Public License for more details. + + You should have received a copy of the GNU Affero General Public License + along with this program. If not, see . +*/ +#include +#include +#include +#include +#include +#include +#include + +#include + +#include "fastx.h" +#include "fastx_args.h" + +const char* usage= +"usage: fastq_to_fasta [-h] [-r] [-n] [-v] [-z] [-i INFILE] [-o OUTFILE]\n" \ +"\n" \ +"version " VERSION "\n" \ +" [-h] = This helpful help screen.\n" \ +" [-r] = Rename sequence identifiers to numbers.\n" \ +" [-n] = keep sequences with unknown (N) nucleotides.\n" \ +" Default is to discard such sequences.\n" \ +" [-v] = Verbose - report number of sequences.\n" \ +" If [-o] is specified, report will be printed to STDOUT.\n" \ +" If [-o] is not specified (and output goes to STDOUT),\n" \ +" report will be printed to STDERR.\n" \ +" [-z] = Compress output with GZIP.\n" \ +" [-i INFILE] = FASTA/Q input file. default is STDIN.\n" \ +" [-o OUTFILE] = FASTA output file. default is STDOUT.\n" \ +"\n"; + +FASTX fastx; +int flag_rename_seqid = 0; +int flag_discard_N = 1 ; + +int parse_program_args(int __attribute__((unused)) optind, int optc, char __attribute__((unused)) *optarg) +{ + switch(optc) { + case 'n': + flag_discard_N = 0 ; + break; + + case 'r': + flag_rename_seqid = 1; + break; + default: + errx(1, __FILE__ ":%d: Unknown argument (%c)", __LINE__, optc ) ; + } + return 1; +} + + +int main(int argc, char* argv[]) +{ + fastx_parse_cmdline(argc, argv, "rn", parse_program_args); + + fastx_init_reader(&fastx, get_input_filename(), + FASTQ_ONLY, ALLOW_N, REQUIRE_UPPERCASE); + + fastx_init_writer(&fastx, get_output_filename(), OUTPUT_FASTA, compress_output_flag()); + + while ( fastx_read_next_record(&fastx) ) { + //See if the input sequence contained 'N' nucleotides + if ( flag_discard_N && (strchr(fastx.nucleotides,'N') != NULL)) + continue; + + if ( flag_rename_seqid ) + snprintf(fastx.name, sizeof(fastx.name), "%zu", num_output_reads(&fastx)+1) ; + + fastx_write_record(&fastx); + } + + //Print verbose report + if ( verbose_flag() ) { + fprintf(get_report_file(), "Input: %zu reads.\n", num_input_reads(&fastx) ) ; + fprintf(get_report_file(), "Output: %zu reads.\n", num_output_reads(&fastx) ) ; + + if ( flag_discard_N ) { + size_t discarded = num_input_reads(&fastx) - num_output_reads(&fastx) ; + fprintf(get_report_file(), "discarded %zu (%zu%%) low-quality reads.\n", + discarded, (discarded*100)/( num_input_reads(&fastx) ) ) ; + } + } + + return 0; +} diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_artifacts_filter/Makefile.am --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastx_artifacts_filter/Makefile.am Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,21 @@ +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + + +bin_PROGRAMS = fastx_artifacts_filter + +AM_CPPFLAGS = \ + $(CC_WARNINGS) \ + -I../libfastx + +fastx_artifacts_filter_SOURCES = fastx_artifacts_filter.c + +fastx_artifacts_filter_LDADD = ../libfastx/libfastx.a + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_artifacts_filter/Makefile.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastx_artifacts_filter/Makefile.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,438 @@ +# Makefile.in generated by automake 1.10.1 from Makefile.am. +# @configure_input@ + +# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, +# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This Makefile.in is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +@SET_MAKE@ + +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +VPATH = @srcdir@ +pkgdatadir = $(datadir)/@PACKAGE@ +pkglibdir = $(libdir)/@PACKAGE@ +pkgincludedir = $(includedir)/@PACKAGE@ +am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd +install_sh_DATA = $(install_sh) -c -m 644 +install_sh_PROGRAM = $(install_sh) -c +install_sh_SCRIPT = $(install_sh) -c +INSTALL_HEADER = $(INSTALL_DATA) +transform = $(program_transform_name) +NORMAL_INSTALL = : +PRE_INSTALL = : +POST_INSTALL = : +NORMAL_UNINSTALL = : +PRE_UNINSTALL = : +POST_UNINSTALL = : +build_triplet = @build@ +host_triplet = @host@ +bin_PROGRAMS = fastx_artifacts_filter$(EXEEXT) +subdir = src/fastx_artifacts_filter +DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in +ACLOCAL_M4 = $(top_srcdir)/aclocal.m4 +am__aclocal_m4_deps = $(top_srcdir)/configure.ac +am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \ + $(ACLOCAL_M4) +mkinstalldirs = $(install_sh) -d +CONFIG_HEADER = $(top_builddir)/config.h +CONFIG_CLEAN_FILES = +am__installdirs = "$(DESTDIR)$(bindir)" +binPROGRAMS_INSTALL = $(INSTALL_PROGRAM) +PROGRAMS = $(bin_PROGRAMS) +am_fastx_artifacts_filter_OBJECTS = fastx_artifacts_filter.$(OBJEXT) +fastx_artifacts_filter_OBJECTS = $(am_fastx_artifacts_filter_OBJECTS) +fastx_artifacts_filter_DEPENDENCIES = ../libfastx/libfastx.a +DEFAULT_INCLUDES = -I.@am__isrc@ -I$(top_builddir) +depcomp = $(SHELL) $(top_srcdir)/config/depcomp +am__depfiles_maybe = depfiles +COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \ + $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS) +CCLD = $(CC) +LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@ +SOURCES = $(fastx_artifacts_filter_SOURCES) +DIST_SOURCES = $(fastx_artifacts_filter_SOURCES) +ETAGS = etags +CTAGS = ctags +DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST) +ACLOCAL = @ACLOCAL@ +AMTAR = @AMTAR@ +AUTOCONF = @AUTOCONF@ +AUTOHEADER = @AUTOHEADER@ +AUTOMAKE = @AUTOMAKE@ +AWK = @AWK@ +CC = @CC@ +CCDEPMODE = @CCDEPMODE@ +CFLAGS = @CFLAGS@ +CPP = @CPP@ +CPPFLAGS = @CPPFLAGS@ +CXX = @CXX@ +CXXCPP = @CXXCPP@ +CXXDEPMODE = @CXXDEPMODE@ +CXXFLAGS = @CXXFLAGS@ +CYGPATH_W = @CYGPATH_W@ +DEFS = @DEFS@ +DEPDIR = @DEPDIR@ +ECHO_C = @ECHO_C@ +ECHO_N = @ECHO_N@ +ECHO_T = @ECHO_T@ +EGREP = @EGREP@ +EXEEXT = @EXEEXT@ +GREP = @GREP@ +INSTALL = @INSTALL@ +INSTALL_DATA = @INSTALL_DATA@ +INSTALL_PROGRAM = @INSTALL_PROGRAM@ +INSTALL_SCRIPT = @INSTALL_SCRIPT@ +INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@ +LDFLAGS = @LDFLAGS@ +LIBOBJS = @LIBOBJS@ +LIBS = @LIBS@ +LTLIBOBJS = @LTLIBOBJS@ +MAKEINFO = @MAKEINFO@ +MKDIR_P = @MKDIR_P@ +OBJEXT = @OBJEXT@ +PACKAGE = @PACKAGE@ +PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@ +PACKAGE_NAME = @PACKAGE_NAME@ +PACKAGE_STRING = @PACKAGE_STRING@ +PACKAGE_TARNAME = @PACKAGE_TARNAME@ +PACKAGE_VERSION = @PACKAGE_VERSION@ +PATH_SEPARATOR = @PATH_SEPARATOR@ +RANLIB = @RANLIB@ +SET_MAKE = @SET_MAKE@ +SHELL = @SHELL@ +STRIP = @STRIP@ +VERSION = @VERSION@ +abs_builddir = @abs_builddir@ +abs_srcdir = @abs_srcdir@ +abs_top_builddir = @abs_top_builddir@ +abs_top_srcdir = @abs_top_srcdir@ +ac_ct_CC = @ac_ct_CC@ +ac_ct_CXX = @ac_ct_CXX@ +am__include = @am__include@ +am__leading_dot = @am__leading_dot@ +am__quote = @am__quote@ +am__tar = @am__tar@ +am__untar = @am__untar@ +bindir = @bindir@ +build = @build@ +build_alias = @build_alias@ +build_cpu = @build_cpu@ +build_os = @build_os@ +build_vendor = @build_vendor@ +builddir = @builddir@ +canonical_host_type = @canonical_host_type@ +datadir = @datadir@ +datarootdir = @datarootdir@ +docdir = @docdir@ +dvidir = @dvidir@ +exec_prefix = @exec_prefix@ +host = @host@ +host_alias = @host_alias@ +host_cpu = @host_cpu@ +host_os = @host_os@ +host_vendor = @host_vendor@ +htmldir = @htmldir@ +includedir = @includedir@ +infodir = @infodir@ +install_sh = @install_sh@ +libdir = @libdir@ +libexecdir = @libexecdir@ +localedir = @localedir@ +localstatedir = @localstatedir@ +mandir = @mandir@ +mkdir_p = @mkdir_p@ +oldincludedir = @oldincludedir@ +pdfdir = @pdfdir@ +prefix = @prefix@ +program_transform_name = @program_transform_name@ +psdir = @psdir@ +sbindir = @sbindir@ +sharedstatedir = @sharedstatedir@ +srcdir = @srcdir@ +sysconfdir = @sysconfdir@ +target_alias = @target_alias@ +top_builddir = @top_builddir@ +top_srcdir = @top_srcdir@ +AM_CPPFLAGS = \ + $(CC_WARNINGS) \ + -I../libfastx + +fastx_artifacts_filter_SOURCES = fastx_artifacts_filter.c +fastx_artifacts_filter_LDADD = ../libfastx/libfastx.a +all: all-am + +.SUFFIXES: +.SUFFIXES: .c .o .obj +$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps) + @for dep in $?; do \ + case '$(am__configure_deps)' in \ + *$$dep*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh \ + && exit 0; \ + exit 1;; \ + esac; \ + done; \ + echo ' cd $(top_srcdir) && $(AUTOMAKE) --gnu src/fastx_artifacts_filter/Makefile'; \ + cd $(top_srcdir) && \ + $(AUTOMAKE) --gnu src/fastx_artifacts_filter/Makefile +.PRECIOUS: Makefile +Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status + @case '$?' in \ + *config.status*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \ + *) \ + echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \ + cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \ + esac; + +$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +$(top_srcdir)/configure: $(am__configure_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +$(ACLOCAL_M4): $(am__aclocal_m4_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +install-binPROGRAMS: $(bin_PROGRAMS) + @$(NORMAL_INSTALL) + test -z "$(bindir)" || $(MKDIR_P) "$(DESTDIR)$(bindir)" + @list='$(bin_PROGRAMS)'; for p in $$list; do \ + p1=`echo $$p|sed 's/$(EXEEXT)$$//'`; \ + if test -f $$p \ + ; then \ + f=`echo "$$p1" | sed 's,^.*/,,;$(transform);s/$$/$(EXEEXT)/'`; \ + echo " $(INSTALL_PROGRAM_ENV) $(binPROGRAMS_INSTALL) '$$p' '$(DESTDIR)$(bindir)/$$f'"; \ + $(INSTALL_PROGRAM_ENV) $(binPROGRAMS_INSTALL) "$$p" "$(DESTDIR)$(bindir)/$$f" || exit 1; \ + else :; fi; \ + done + +uninstall-binPROGRAMS: + @$(NORMAL_UNINSTALL) + @list='$(bin_PROGRAMS)'; for p in $$list; do \ + f=`echo "$$p" | sed 's,^.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/'`; \ + echo " rm -f '$(DESTDIR)$(bindir)/$$f'"; \ + rm -f "$(DESTDIR)$(bindir)/$$f"; \ + done + +clean-binPROGRAMS: + -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS) +fastx_artifacts_filter$(EXEEXT): $(fastx_artifacts_filter_OBJECTS) $(fastx_artifacts_filter_DEPENDENCIES) + @rm -f fastx_artifacts_filter$(EXEEXT) + $(LINK) $(fastx_artifacts_filter_OBJECTS) $(fastx_artifacts_filter_LDADD) $(LIBS) + +mostlyclean-compile: + -rm -f *.$(OBJEXT) + +distclean-compile: + -rm -f *.tab.c + +@AMDEP_TRUE@@am__include@ @am__quote@./$(DEPDIR)/fastx_artifacts_filter.Po@am__quote@ + +.c.o: +@am__fastdepCC_TRUE@ $(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $< +@am__fastdepCC_TRUE@ mv -f $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po +@AMDEP_TRUE@@am__fastdepCC_FALSE@ source='$<' object='$@' libtool=no @AMDEPBACKSLASH@ +@AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@ +@am__fastdepCC_FALSE@ $(COMPILE) -c $< + +.c.obj: +@am__fastdepCC_TRUE@ $(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'` +@am__fastdepCC_TRUE@ mv -f $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po +@AMDEP_TRUE@@am__fastdepCC_FALSE@ source='$<' object='$@' libtool=no @AMDEPBACKSLASH@ +@AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@ +@am__fastdepCC_FALSE@ $(COMPILE) -c `$(CYGPATH_W) '$<'` + +ID: $(HEADERS) $(SOURCES) $(LISP) $(TAGS_FILES) + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonemtpy = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + mkid -fID $$unique +tags: TAGS + +TAGS: $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + here=`pwd`; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + if test -z "$(ETAGS_ARGS)$$tags$$unique"; then :; else \ + test -n "$$unique" || unique=$$empty_fix; \ + $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \ + $$tags $$unique; \ + fi +ctags: CTAGS +CTAGS: $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + test -z "$(CTAGS_ARGS)$$tags$$unique" \ + || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \ + $$tags $$unique + +GTAGS: + here=`$(am__cd) $(top_builddir) && pwd` \ + && cd $(top_srcdir) \ + && gtags -i $(GTAGS_ARGS) $$here + +distclean-tags: + -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags + +distdir: $(DISTFILES) + @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + list='$(DISTFILES)'; \ + dist_files=`for file in $$list; do echo $$file; done | \ + sed -e "s|^$$srcdirstrip/||;t" \ + -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \ + case $$dist_files in \ + */*) $(MKDIR_P) `echo "$$dist_files" | \ + sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \ + sort -u` ;; \ + esac; \ + for file in $$dist_files; do \ + if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \ + if test -d $$d/$$file; then \ + dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \ + if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \ + cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \ + fi; \ + cp -pR $$d/$$file $(distdir)$$dir || exit 1; \ + else \ + test -f $(distdir)/$$file \ + || cp -p $$d/$$file $(distdir)/$$file \ + || exit 1; \ + fi; \ + done +check-am: all-am +check: check-am +all-am: Makefile $(PROGRAMS) +installdirs: + for dir in "$(DESTDIR)$(bindir)"; do \ + test -z "$$dir" || $(MKDIR_P) "$$dir"; \ + done +install: install-am +install-exec: install-exec-am +install-data: install-data-am +uninstall: uninstall-am + +install-am: all-am + @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am + +installcheck: installcheck-am +install-strip: + $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \ + install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \ + `test -z '$(STRIP)' || \ + echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install +mostlyclean-generic: + +clean-generic: + +distclean-generic: + -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES) + +maintainer-clean-generic: + @echo "This command is intended for maintainers to use" + @echo "it deletes files that may require special tools to rebuild." +clean: clean-am + +clean-am: clean-binPROGRAMS clean-generic mostlyclean-am + +distclean: distclean-am + -rm -rf ./$(DEPDIR) + -rm -f Makefile +distclean-am: clean-am distclean-compile distclean-generic \ + distclean-tags + +dvi: dvi-am + +dvi-am: + +html: html-am + +info: info-am + +info-am: + +install-data-am: + +install-dvi: install-dvi-am + +install-exec-am: install-binPROGRAMS + +install-html: install-html-am + +install-info: install-info-am + +install-man: + +install-pdf: install-pdf-am + +install-ps: install-ps-am + +installcheck-am: + +maintainer-clean: maintainer-clean-am + -rm -rf ./$(DEPDIR) + -rm -f Makefile +maintainer-clean-am: distclean-am maintainer-clean-generic + +mostlyclean: mostlyclean-am + +mostlyclean-am: mostlyclean-compile mostlyclean-generic + +pdf: pdf-am + +pdf-am: + +ps: ps-am + +ps-am: + +uninstall-am: uninstall-binPROGRAMS + +.MAKE: install-am install-strip + +.PHONY: CTAGS GTAGS all all-am check check-am clean clean-binPROGRAMS \ + clean-generic ctags distclean distclean-compile \ + distclean-generic distclean-tags distdir dvi dvi-am html \ + html-am info info-am install install-am install-binPROGRAMS \ + install-data install-data-am install-dvi install-dvi-am \ + install-exec install-exec-am install-html install-html-am \ + install-info install-info-am install-man install-pdf \ + install-pdf-am install-ps install-ps-am install-strip \ + installcheck installcheck-am installdirs maintainer-clean \ + maintainer-clean-generic mostlyclean mostlyclean-compile \ + mostlyclean-generic pdf pdf-am ps ps-am tags uninstall \ + uninstall-am uninstall-binPROGRAMS + +# Tell versions [3.59,3.63) of GNU make to not export all variables. +# Otherwise a system limit (for SysV at least) may be exceeded. +.NOEXPORT: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_artifacts_filter/fastx_artifacts_filter.c --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastx_artifacts_filter/fastx_artifacts_filter.c Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,143 @@ +/* + FASTX-toolkit - FASTA/FASTQ preprocessing tools. + Copyright (C) 2009 A. Gordon (gordon@cshl.edu) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU Affero General Public License as + published by the Free Software Foundation, either version 3 of the + License, or (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU Affero General Public License for more details. + + You should have received a copy of the GNU Affero General Public License + along with this program. If not, see . +*/ +#include +#include +#include +#include +#include +#include +#include + +#include + +#include "fastx.h" +#include "fastx_args.h" + +#define MAX_ADAPTER_LEN 100 + +const char* usage= +"usage: fastx_artifacts_filter [-h] [-v] [-z] [-i INFILE] [-o OUTFILE]\n" \ +"\n" \ +"version " VERSION "\n" \ +" [-h] = This helpful help screen.\n" \ +" [-i INFILE] = FASTA/Q input file. default is STDIN.\n" \ +" [-o OUTFILE] = FASTA/Q output file. default is STDOUT.\n" \ +" [-z] = Compress output with GZIP.\n" \ +" [-v] = Verbose - report number of processed reads.\n" \ +" If [-o] is specified, report will be printed to STDOUT.\n" \ +" If [-o] is not specified (and output goes to STDOUT),\n" \ +" report will be printed to STDERR.\n" \ +"\n"; + +#define DO_NOT_TRIM_LAST_BASE (0) + +FASTX fastx; + +int parse_commandline(int argc, char* argv[]) +{ + return fastx_parse_cmdline(argc, argv, "", NULL); +} + +int artifact_sequence(const FASTX *fastx) +{ + int n_count=0; + int a_count=0; + int c_count=0; + int t_count=0; + int g_count=0; + int total_count=0; + + int max_allowed_different_bases = 3 ; + + int i=0; + + while (1) { + if (fastx->nucleotides[i]==0) + break; + + total_count++; + switch(fastx->nucleotides[i]) + { + case 'A': + a_count++; + break; + case 'C': + c_count++; + break; + case 'G': + g_count++; + break; + case 'T': + t_count++; + break; + case 'N': + n_count++; + break; + default: + errx(1, __FILE__":%d: invalid nucleotide value (%c) at position %d", + __LINE__, fastx->nucleotides[i], i ) ; + } + i++; + } + + //Rules for artifacts + + if ( a_count>=(total_count-max_allowed_different_bases) + || + c_count>=(total_count-max_allowed_different_bases) + || + g_count>=(total_count-max_allowed_different_bases) + || + t_count>=(total_count-max_allowed_different_bases) + ) + return 1; + + + return 0; +} + +int main(int argc, char* argv[]) +{ + parse_commandline(argc, argv); + + fastx_init_reader(&fastx, get_input_filename(), + FASTA_OR_FASTQ, ALLOW_N, REQUIRE_UPPERCASE); + + fastx_init_writer(&fastx, get_output_filename(), + OUTPUT_SAME_AS_INPUT, compress_output_flag()); + + while ( fastx_read_next_record(&fastx) ) { + + if ( artifact_sequence(&fastx) ) { + } else { + fastx_write_record(&fastx); + } + } + + //Print verbose report + if ( verbose_flag() ) { + fprintf(get_report_file(), "Input: %zu reads.\n", num_input_reads(&fastx) ) ; + fprintf(get_report_file(), "Output: %zu reads.\n", num_output_reads(&fastx) ) ; + + size_t discarded = num_input_reads(&fastx) - num_output_reads(&fastx) ; + fprintf(get_report_file(), "discarded %zu (%zu%%) artifact reads.\n", + discarded, (discarded*100)/( num_input_reads(&fastx) ) ) ; + } + + return 0; +} diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_clipper/Makefile.am --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastx_clipper/Makefile.am Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,21 @@ +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + + +bin_PROGRAMS = fastx_clipper + +AM_CPPFLAGS = \ + $(CC_WARNINGS) \ + -I../libfastx + +fastx_clipper_SOURCES = fastx_clipper.cpp + +fastx_clipper_LDADD = ../libfastx/libfastx.a + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_clipper/Makefile.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastx_clipper/Makefile.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,439 @@ +# Makefile.in generated by automake 1.10.1 from Makefile.am. +# @configure_input@ + +# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, +# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This Makefile.in is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +@SET_MAKE@ + +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +VPATH = @srcdir@ +pkgdatadir = $(datadir)/@PACKAGE@ +pkglibdir = $(libdir)/@PACKAGE@ +pkgincludedir = $(includedir)/@PACKAGE@ +am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd +install_sh_DATA = $(install_sh) -c -m 644 +install_sh_PROGRAM = $(install_sh) -c +install_sh_SCRIPT = $(install_sh) -c +INSTALL_HEADER = $(INSTALL_DATA) +transform = $(program_transform_name) +NORMAL_INSTALL = : +PRE_INSTALL = : +POST_INSTALL = : +NORMAL_UNINSTALL = : +PRE_UNINSTALL = : +POST_UNINSTALL = : +build_triplet = @build@ +host_triplet = @host@ +bin_PROGRAMS = fastx_clipper$(EXEEXT) +subdir = src/fastx_clipper +DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in +ACLOCAL_M4 = $(top_srcdir)/aclocal.m4 +am__aclocal_m4_deps = $(top_srcdir)/configure.ac +am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \ + $(ACLOCAL_M4) +mkinstalldirs = $(install_sh) -d +CONFIG_HEADER = $(top_builddir)/config.h +CONFIG_CLEAN_FILES = +am__installdirs = "$(DESTDIR)$(bindir)" +binPROGRAMS_INSTALL = $(INSTALL_PROGRAM) +PROGRAMS = $(bin_PROGRAMS) +am_fastx_clipper_OBJECTS = fastx_clipper.$(OBJEXT) +fastx_clipper_OBJECTS = $(am_fastx_clipper_OBJECTS) +fastx_clipper_DEPENDENCIES = ../libfastx/libfastx.a +DEFAULT_INCLUDES = -I.@am__isrc@ -I$(top_builddir) +depcomp = $(SHELL) $(top_srcdir)/config/depcomp +am__depfiles_maybe = depfiles +CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \ + $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) +CXXLD = $(CXX) +CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \ + -o $@ +SOURCES = $(fastx_clipper_SOURCES) +DIST_SOURCES = $(fastx_clipper_SOURCES) +ETAGS = etags +CTAGS = ctags +DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST) +ACLOCAL = @ACLOCAL@ +AMTAR = @AMTAR@ +AUTOCONF = @AUTOCONF@ +AUTOHEADER = @AUTOHEADER@ +AUTOMAKE = @AUTOMAKE@ +AWK = @AWK@ +CC = @CC@ +CCDEPMODE = @CCDEPMODE@ +CFLAGS = @CFLAGS@ +CPP = @CPP@ +CPPFLAGS = @CPPFLAGS@ +CXX = @CXX@ +CXXCPP = @CXXCPP@ +CXXDEPMODE = @CXXDEPMODE@ +CXXFLAGS = @CXXFLAGS@ +CYGPATH_W = @CYGPATH_W@ +DEFS = @DEFS@ +DEPDIR = @DEPDIR@ +ECHO_C = @ECHO_C@ +ECHO_N = @ECHO_N@ +ECHO_T = @ECHO_T@ +EGREP = @EGREP@ +EXEEXT = @EXEEXT@ +GREP = @GREP@ +INSTALL = @INSTALL@ +INSTALL_DATA = @INSTALL_DATA@ +INSTALL_PROGRAM = @INSTALL_PROGRAM@ +INSTALL_SCRIPT = @INSTALL_SCRIPT@ +INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@ +LDFLAGS = @LDFLAGS@ +LIBOBJS = @LIBOBJS@ +LIBS = @LIBS@ +LTLIBOBJS = @LTLIBOBJS@ +MAKEINFO = @MAKEINFO@ +MKDIR_P = @MKDIR_P@ +OBJEXT = @OBJEXT@ +PACKAGE = @PACKAGE@ +PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@ +PACKAGE_NAME = @PACKAGE_NAME@ +PACKAGE_STRING = @PACKAGE_STRING@ +PACKAGE_TARNAME = @PACKAGE_TARNAME@ +PACKAGE_VERSION = @PACKAGE_VERSION@ +PATH_SEPARATOR = @PATH_SEPARATOR@ +RANLIB = @RANLIB@ +SET_MAKE = @SET_MAKE@ +SHELL = @SHELL@ +STRIP = @STRIP@ +VERSION = @VERSION@ +abs_builddir = @abs_builddir@ +abs_srcdir = @abs_srcdir@ +abs_top_builddir = @abs_top_builddir@ +abs_top_srcdir = @abs_top_srcdir@ +ac_ct_CC = @ac_ct_CC@ +ac_ct_CXX = @ac_ct_CXX@ +am__include = @am__include@ +am__leading_dot = @am__leading_dot@ +am__quote = @am__quote@ +am__tar = @am__tar@ +am__untar = @am__untar@ +bindir = @bindir@ +build = @build@ +build_alias = @build_alias@ +build_cpu = @build_cpu@ +build_os = @build_os@ +build_vendor = @build_vendor@ +builddir = @builddir@ +canonical_host_type = @canonical_host_type@ +datadir = @datadir@ +datarootdir = @datarootdir@ +docdir = @docdir@ +dvidir = @dvidir@ +exec_prefix = @exec_prefix@ +host = @host@ +host_alias = @host_alias@ +host_cpu = @host_cpu@ +host_os = @host_os@ +host_vendor = @host_vendor@ +htmldir = @htmldir@ +includedir = @includedir@ +infodir = @infodir@ +install_sh = @install_sh@ +libdir = @libdir@ +libexecdir = @libexecdir@ +localedir = @localedir@ +localstatedir = @localstatedir@ +mandir = @mandir@ +mkdir_p = @mkdir_p@ +oldincludedir = @oldincludedir@ +pdfdir = @pdfdir@ +prefix = @prefix@ +program_transform_name = @program_transform_name@ +psdir = @psdir@ +sbindir = @sbindir@ +sharedstatedir = @sharedstatedir@ +srcdir = @srcdir@ +sysconfdir = @sysconfdir@ +target_alias = @target_alias@ +top_builddir = @top_builddir@ +top_srcdir = @top_srcdir@ +AM_CPPFLAGS = \ + $(CC_WARNINGS) \ + -I../libfastx + +fastx_clipper_SOURCES = fastx_clipper.cpp +fastx_clipper_LDADD = ../libfastx/libfastx.a +all: all-am + +.SUFFIXES: +.SUFFIXES: .cpp .o .obj +$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps) + @for dep in $?; do \ + case '$(am__configure_deps)' in \ + *$$dep*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh \ + && exit 0; \ + exit 1;; \ + esac; \ + done; \ + echo ' cd $(top_srcdir) && $(AUTOMAKE) --gnu src/fastx_clipper/Makefile'; \ + cd $(top_srcdir) && \ + $(AUTOMAKE) --gnu src/fastx_clipper/Makefile +.PRECIOUS: Makefile +Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status + @case '$?' in \ + *config.status*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \ + *) \ + echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \ + cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \ + esac; + +$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +$(top_srcdir)/configure: $(am__configure_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +$(ACLOCAL_M4): $(am__aclocal_m4_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +install-binPROGRAMS: $(bin_PROGRAMS) + @$(NORMAL_INSTALL) + test -z "$(bindir)" || $(MKDIR_P) "$(DESTDIR)$(bindir)" + @list='$(bin_PROGRAMS)'; for p in $$list; do \ + p1=`echo $$p|sed 's/$(EXEEXT)$$//'`; \ + if test -f $$p \ + ; then \ + f=`echo "$$p1" | sed 's,^.*/,,;$(transform);s/$$/$(EXEEXT)/'`; \ + echo " $(INSTALL_PROGRAM_ENV) $(binPROGRAMS_INSTALL) '$$p' '$(DESTDIR)$(bindir)/$$f'"; \ + $(INSTALL_PROGRAM_ENV) $(binPROGRAMS_INSTALL) "$$p" "$(DESTDIR)$(bindir)/$$f" || exit 1; \ + else :; fi; \ + done + +uninstall-binPROGRAMS: + @$(NORMAL_UNINSTALL) + @list='$(bin_PROGRAMS)'; for p in $$list; do \ + f=`echo "$$p" | sed 's,^.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/'`; \ + echo " rm -f '$(DESTDIR)$(bindir)/$$f'"; \ + rm -f "$(DESTDIR)$(bindir)/$$f"; \ + done + +clean-binPROGRAMS: + -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS) +fastx_clipper$(EXEEXT): $(fastx_clipper_OBJECTS) $(fastx_clipper_DEPENDENCIES) + @rm -f fastx_clipper$(EXEEXT) + $(CXXLINK) $(fastx_clipper_OBJECTS) $(fastx_clipper_LDADD) $(LIBS) + +mostlyclean-compile: + -rm -f *.$(OBJEXT) + +distclean-compile: + -rm -f *.tab.c + +@AMDEP_TRUE@@am__include@ @am__quote@./$(DEPDIR)/fastx_clipper.Po@am__quote@ + +.cpp.o: +@am__fastdepCXX_TRUE@ $(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $< +@am__fastdepCXX_TRUE@ mv -f $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po +@AMDEP_TRUE@@am__fastdepCXX_FALSE@ source='$<' object='$@' libtool=no @AMDEPBACKSLASH@ +@AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@ +@am__fastdepCXX_FALSE@ $(CXXCOMPILE) -c -o $@ $< + +.cpp.obj: +@am__fastdepCXX_TRUE@ $(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'` +@am__fastdepCXX_TRUE@ mv -f $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po +@AMDEP_TRUE@@am__fastdepCXX_FALSE@ source='$<' object='$@' libtool=no @AMDEPBACKSLASH@ +@AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@ +@am__fastdepCXX_FALSE@ $(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'` + +ID: $(HEADERS) $(SOURCES) $(LISP) $(TAGS_FILES) + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonemtpy = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + mkid -fID $$unique +tags: TAGS + +TAGS: $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + here=`pwd`; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + if test -z "$(ETAGS_ARGS)$$tags$$unique"; then :; else \ + test -n "$$unique" || unique=$$empty_fix; \ + $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \ + $$tags $$unique; \ + fi +ctags: CTAGS +CTAGS: $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + test -z "$(CTAGS_ARGS)$$tags$$unique" \ + || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \ + $$tags $$unique + +GTAGS: + here=`$(am__cd) $(top_builddir) && pwd` \ + && cd $(top_srcdir) \ + && gtags -i $(GTAGS_ARGS) $$here + +distclean-tags: + -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags + +distdir: $(DISTFILES) + @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + list='$(DISTFILES)'; \ + dist_files=`for file in $$list; do echo $$file; done | \ + sed -e "s|^$$srcdirstrip/||;t" \ + -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \ + case $$dist_files in \ + */*) $(MKDIR_P) `echo "$$dist_files" | \ + sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \ + sort -u` ;; \ + esac; \ + for file in $$dist_files; do \ + if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \ + if test -d $$d/$$file; then \ + dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \ + if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \ + cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \ + fi; \ + cp -pR $$d/$$file $(distdir)$$dir || exit 1; \ + else \ + test -f $(distdir)/$$file \ + || cp -p $$d/$$file $(distdir)/$$file \ + || exit 1; \ + fi; \ + done +check-am: all-am +check: check-am +all-am: Makefile $(PROGRAMS) +installdirs: + for dir in "$(DESTDIR)$(bindir)"; do \ + test -z "$$dir" || $(MKDIR_P) "$$dir"; \ + done +install: install-am +install-exec: install-exec-am +install-data: install-data-am +uninstall: uninstall-am + +install-am: all-am + @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am + +installcheck: installcheck-am +install-strip: + $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \ + install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \ + `test -z '$(STRIP)' || \ + echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install +mostlyclean-generic: + +clean-generic: + +distclean-generic: + -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES) + +maintainer-clean-generic: + @echo "This command is intended for maintainers to use" + @echo "it deletes files that may require special tools to rebuild." +clean: clean-am + +clean-am: clean-binPROGRAMS clean-generic mostlyclean-am + +distclean: distclean-am + -rm -rf ./$(DEPDIR) + -rm -f Makefile +distclean-am: clean-am distclean-compile distclean-generic \ + distclean-tags + +dvi: dvi-am + +dvi-am: + +html: html-am + +info: info-am + +info-am: + +install-data-am: + +install-dvi: install-dvi-am + +install-exec-am: install-binPROGRAMS + +install-html: install-html-am + +install-info: install-info-am + +install-man: + +install-pdf: install-pdf-am + +install-ps: install-ps-am + +installcheck-am: + +maintainer-clean: maintainer-clean-am + -rm -rf ./$(DEPDIR) + -rm -f Makefile +maintainer-clean-am: distclean-am maintainer-clean-generic + +mostlyclean: mostlyclean-am + +mostlyclean-am: mostlyclean-compile mostlyclean-generic + +pdf: pdf-am + +pdf-am: + +ps: ps-am + +ps-am: + +uninstall-am: uninstall-binPROGRAMS + +.MAKE: install-am install-strip + +.PHONY: CTAGS GTAGS all all-am check check-am clean clean-binPROGRAMS \ + clean-generic ctags distclean distclean-compile \ + distclean-generic distclean-tags distdir dvi dvi-am html \ + html-am info info-am install install-am install-binPROGRAMS \ + install-data install-data-am install-dvi install-dvi-am \ + install-exec install-exec-am install-html install-html-am \ + install-info install-info-am install-man install-pdf \ + install-pdf-am install-ps install-ps-am install-strip \ + installcheck installcheck-am installdirs maintainer-clean \ + maintainer-clean-generic mostlyclean mostlyclean-compile \ + mostlyclean-generic pdf pdf-am ps ps-am tags uninstall \ + uninstall-am uninstall-binPROGRAMS + +# Tell versions [3.59,3.63) of GNU make to not export all variables. +# Otherwise a system limit (for SysV at least) may be exceeded. +.NOEXPORT: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_clipper/fastx_clipper.cpp --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastx_clipper/fastx_clipper.cpp Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,333 @@ +/* + FASTX-toolkit - FASTA/FASTQ preprocessing tools. + Copyright (C) 2009 A. Gordon (gordon@cshl.edu) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU Affero General Public License as + published by the Free Software Foundation, either version 3 of the + License, or (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU Affero General Public License for more details. + + You should have received a copy of the GNU Affero General Public License + along with this program. If not, see . +*/ +#include +#include +#include +#include +#include +#include +#include +#include + +#include "sequence_alignment.h" + +#include +#include + +#include + +#include "fastx.h" +#include "fastx_args.h" + + +#define MAX_ADAPTER_LEN 100 + +const char* usage= +"usage: fastx_clipper [-h] [-a ADAPTER] [-D] [-l N] [-n] [-d N] [-c] [-C] [-o] [-v] [-z] [-i INFILE] [-o OUTFILE]\n" \ +"\n" \ +"version " VERSION "\n" \ +" [-h] = This helpful help screen.\n" \ +" [-a ADAPTER] = ADAPTER string. default is CCTTAAGG (dummy adapter).\n" \ +" [-l N] = discard sequences shorter than N nucleotides. default is 5.\n" \ +" [-d N] = Keep the adapter and N bases after it.\n" \ +" (using '-d 0' is the same as not using '-d' at all. which is the default).\n" \ +" [-c] = Discard non-clipped sequences (i.e. - keep only sequences which contained the adapter).\n" \ +" [-C] = Discard clipped sequences (i.e. - keep only sequences which did not contained the adapter).\n" \ +" [-k] = Report Adapter-Only sequences.\n" \ +" [-n] = keep sequences with unknown (N) nucleotides. default is to discard such sequences.\n" \ +" [-v] = Verbose - report number of sequences.\n" \ +" If [-o] is specified, report will be printed to STDOUT.\n" \ +" If [-o] is not specified (and output goes to STDOUT),\n" \ +" report will be printed to STDERR.\n" \ +" [-z] = Compress output with GZIP.\n" \ +" [-D] = DEBUG output.\n" \ +" [-i INFILE] = FASTA/Q input file. default is STDIN.\n" \ +" [-o OUTFILE] = FASTA/Q output file. default is STDOUT.\n" \ +"\n"; + +//Default adapter - Dummy sequence +char adapter[MAX_ADAPTER_LEN]="CCTTAAGG"; +unsigned int min_length=5; +int discard_unknown_bases=1; +int keep_delta=0; +int discard_non_clipped=0; +int discard_clipped=0; +int show_adapter_only=0; +int debug = 0 ; + + +//Statistics for verbose report +unsigned int count_input=0 ; +unsigned int count_discarded_too_short=0; // see [-l N] option +unsigned int count_discarded_adapter_at_index_zero=0; //empty sequences (after clipping) +unsigned int count_discarded_no_adapter_found=0; // see [-c] option +unsigned int count_discarded_adapter_found=0; // see [-C] option +unsigned int count_discarded_N=0; // see [-n] + +FASTX fastx; +HalfLocalSequenceAlignment align; + +int parse_program_args(int __attribute__((unused)) optind, int optc, char* optarg) +{ + switch(optc) { + case 'k': + show_adapter_only=1; + break; + + case 'D': + debug++; + break ; + + case 'c': + discard_non_clipped = 1; + break; + + case 'C': + discard_clipped = 1 ; + break ; + case 'd': + if (optarg==NULL) + errx(1, "[-d] parameter requires an argument value"); + keep_delta = strtoul(optarg,NULL,10); + if (keep_delta<0) + errx(1,"Invalid number bases to keep (-d %s)", optarg); + break; + case 'a': + strncpy(adapter,optarg,sizeof(adapter)-1); + //TODO: + //if (!valid_sequence_string(adapter)) + // errx(1,"Invalid adapter string (-a %s)", adapter); + break ; + + case 'l': + if (optarg==NULL) + errx(1,"[-l] parameter requires an argument value"); + + min_length = strtoul(optarg, NULL, 10); + break; + + case 'n': + discard_unknown_bases = 0 ; + break; + + default: + errx(1,"Unknown argument (%c)", optc ) ; + + } + return 1; +} + +int parse_commandline(int argc, char* argv[]) +{ + + fastx_parse_cmdline(argc, argv, "kDCcd:a:s:l:n", parse_program_args); + + if (keep_delta>0) + keep_delta += strlen(adapter); + return 1; +} + +int adapter_cutoff_index ( const SequenceAlignmentResults& alignment_results ) __attribute__ ((const)); +int adapter_cutoff_index ( const SequenceAlignmentResults& alignment_results ) +{ + #if 0 + int mismatches = alignment_results.mismatches ; + + //The adapter(=target) is expected to align from the first base. + //If the start is not zero (=not aligned from first base), + //count each skipped base as a mismatch + mismatches += alignment_results.target_start ; + + //The adapter is expected to align up to the end + //of the adapter(=target), or the end of the query. + //If it doesn't, count the un-aligned bases as mismatches + int missing_from_query_end = (alignment_results.query_size - alignment_results.query_end-1); + int missing_from_target_end = (alignment_results.target_size - alignment_results.target_end-1); + + int missing_from_end = std::min(missing_from_query_end, missing_from_target_end); + + mismatches += missing_from_end ; + + + + std::cout << "Missing from start = " << alignment_results.target_start + << " Missing from end = " << missing_from_end + << " mismatches = " << mismatches + << std::endl; + + if (mismatches > max_mismatches) + return -1; + + return alignment_results.query_start; + #endif + + int alignment_size = alignment_results.neutral_matches + + alignment_results.matches + + alignment_results.mismatches + + alignment_results.gaps ; + + //No alignment at all? + if (alignment_size==0) + return -1; + + //Any good alignment at the end of the query + //(even only a single nucleotide) + //Example: + // The adapter starts with CTGTAG, The Query ends with CT - it's a match. + if ( alignment_results.query_end == alignment_results.query_size-1 + && + alignment_results.mismatches == 0 ) { + //printf("--1\n"); + return alignment_results.query_start ; + } + + if ( alignment_size > 5 + && + alignment_results.target_start == 0 + && + (alignment_results.matches * 100 / alignment_size ) >= 75 ) { + //printf("--2\n"); + return alignment_results.query_start ; + } + + if ( alignment_size > 11 + && + (alignment_results.matches * 100 / alignment_size ) >= 80 ) { + //printf("--2\n"); + return alignment_results.query_start ; + } + + // + //Be very lenient regarding alignments at the end of the query sequence + if ( alignment_results.query_end >= alignment_results.query_size-2 + && + alignment_size <= 5 && alignment_results.matches >= 3) { + //printf("--3\n"); + return alignment_results.query_start ; + } + + return -1; +} + + +int main(int argc, char* argv[]) +{ + int i; + int reads_count; + + parse_commandline(argc, argv); + + fastx_init_reader(&fastx, get_input_filename(), + FASTA_OR_FASTQ, ALLOW_N, REQUIRE_UPPERCASE); + + fastx_init_writer(&fastx, get_output_filename(), OUTPUT_SAME_AS_INPUT, compress_output_flag()); + + while ( fastx_read_next_record(&fastx) ) { + + reads_count = get_reads_count(&fastx); + + #if 0 + std::string query = std::string(fastx.nucleotides) + std::string( strlen(adapter), 'N' ); + std::string target= std::string( strlen(fastx.nucleotides), 'N' ) + std::string(adapter); + #else + std::string query = std::string(fastx.nucleotides) ; + std::string target= std::string(adapter); + #endif + + + align.align( query, target ) ; + + if (debug>1) + align.print_matrix(); + if (debug>0) + align.results().print(); + + count_input+= reads_count; + + //Find the best match with the adapter + i = adapter_cutoff_index ( align.results() ) ; + + if (i!=-1 && i>0) { + i += keep_delta; + //Just trim the string after this position + fastx.nucleotides[i] = 0 ; + } + + if (i==0) { // empty sequence ? (in which the adapter was found at index 0) + count_discarded_adapter_at_index_zero += reads_count; + + if (show_adapter_only) + fastx_write_record(&fastx); + continue; + } + + if (strlen(fastx.nucleotides) < min_length) { // too-short sequence ? + count_discarded_too_short += reads_count; + continue; + } + + if ( (i==-1) && discard_non_clipped ) { // adapter not found (i.e. sequence was not clipped) ? + count_discarded_no_adapter_found += reads_count; + continue ; + } + + if ( (i>0) && discard_clipped ) { // adapter found, and user requested to keep only non-clipped sequences + count_discarded_adapter_found += reads_count; + continue; + } + + if ( (discard_unknown_bases && strchr(fastx.nucleotides,'N')!=NULL ) ) { // contains unknown bases (after clipping) ? + count_discarded_N += reads_count; + continue; + } + + if (!show_adapter_only) { + //none of the above condition matched, so print this sequence. + fastx_write_record(&fastx); + } + } + + // + //Print verbose report + if ( verbose_flag() ) { + fprintf(get_report_file(), "Clipping Adapter: %s\n", adapter ); + fprintf(get_report_file(), "Min. Length: %d\n", min_length) ; + + if (discard_clipped) + fprintf(get_report_file(), "Clipped reads - discarded.\n" ) ; + if (discard_non_clipped) + fprintf(get_report_file(), "Non-Clipped reads - discarded.\n" ) ; + + + fprintf(get_report_file(), "Input: %u reads.\n", count_input ) ; + fprintf(get_report_file(), "Output: %u reads.\n", + count_input - count_discarded_too_short - count_discarded_no_adapter_found - count_discarded_adapter_found - + count_discarded_N - count_discarded_adapter_at_index_zero ) ; + + fprintf(get_report_file(), "discarded %u too-short reads.\n", count_discarded_too_short ) ; + fprintf(get_report_file(), "discarded %u adapter-only reads.\n", count_discarded_adapter_at_index_zero ); + if (discard_non_clipped) + fprintf(get_report_file(), "discarded %u non-clipped reads.\n", count_discarded_no_adapter_found ); + if (discard_clipped) + fprintf(get_report_file(), "discarded %u clipped reads.\n", count_discarded_adapter_found ); + if (discard_unknown_bases) + fprintf(get_report_file(), "discarded %u N reads.\n", count_discarded_N ); + } + + return 0; +} diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_collapser/Makefile.am --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastx_collapser/Makefile.am Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,22 @@ +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + + +bin_PROGRAMS = fastx_collapser + +AM_CPPFLAGS = \ + $(CC_WARNINGS) \ + -I../libfastx + +fastx_collapser_SOURCES = fastx_collapser.cpp \ + std_hash.h + +fastx_collapser_LDADD = ../libfastx/libfastx.a + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_collapser/Makefile.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastx_collapser/Makefile.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,445 @@ +# Makefile.in generated by automake 1.10.1 from Makefile.am. +# @configure_input@ + +# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, +# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This Makefile.in is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +@SET_MAKE@ + +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +VPATH = @srcdir@ +pkgdatadir = $(datadir)/@PACKAGE@ +pkglibdir = $(libdir)/@PACKAGE@ +pkgincludedir = $(includedir)/@PACKAGE@ +am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd +install_sh_DATA = $(install_sh) -c -m 644 +install_sh_PROGRAM = $(install_sh) -c +install_sh_SCRIPT = $(install_sh) -c +INSTALL_HEADER = $(INSTALL_DATA) +transform = $(program_transform_name) +NORMAL_INSTALL = : +PRE_INSTALL = : +POST_INSTALL = : +NORMAL_UNINSTALL = : +PRE_UNINSTALL = : +POST_UNINSTALL = : +build_triplet = @build@ +host_triplet = @host@ +bin_PROGRAMS = fastx_collapser$(EXEEXT) +subdir = src/fastx_collapser +DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in +ACLOCAL_M4 = $(top_srcdir)/aclocal.m4 +am__aclocal_m4_deps = $(top_srcdir)/configure.ac +am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \ + $(ACLOCAL_M4) +mkinstalldirs = $(install_sh) -d +CONFIG_HEADER = $(top_builddir)/config.h +CONFIG_CLEAN_FILES = +am__installdirs = "$(DESTDIR)$(bindir)" +binPROGRAMS_INSTALL = $(INSTALL_PROGRAM) +PROGRAMS = $(bin_PROGRAMS) +am_fastx_collapser_OBJECTS = fastx_collapser.$(OBJEXT) +fastx_collapser_OBJECTS = $(am_fastx_collapser_OBJECTS) +fastx_collapser_DEPENDENCIES = ../libfastx/libfastx.a +DEFAULT_INCLUDES = -I.@am__isrc@ -I$(top_builddir) +depcomp = $(SHELL) $(top_srcdir)/config/depcomp +am__depfiles_maybe = depfiles +CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \ + $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) +CXXLD = $(CXX) +CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \ + -o $@ +COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \ + $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS) +CCLD = $(CC) +LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@ +SOURCES = $(fastx_collapser_SOURCES) +DIST_SOURCES = $(fastx_collapser_SOURCES) +ETAGS = etags +CTAGS = ctags +DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST) +ACLOCAL = @ACLOCAL@ +AMTAR = @AMTAR@ +AUTOCONF = @AUTOCONF@ +AUTOHEADER = @AUTOHEADER@ +AUTOMAKE = @AUTOMAKE@ +AWK = @AWK@ +CC = @CC@ +CCDEPMODE = @CCDEPMODE@ +CFLAGS = @CFLAGS@ +CPP = @CPP@ +CPPFLAGS = @CPPFLAGS@ +CXX = @CXX@ +CXXCPP = @CXXCPP@ +CXXDEPMODE = @CXXDEPMODE@ +CXXFLAGS = @CXXFLAGS@ +CYGPATH_W = @CYGPATH_W@ +DEFS = @DEFS@ +DEPDIR = @DEPDIR@ +ECHO_C = @ECHO_C@ +ECHO_N = @ECHO_N@ +ECHO_T = @ECHO_T@ +EGREP = @EGREP@ +EXEEXT = @EXEEXT@ +GREP = @GREP@ +INSTALL = @INSTALL@ +INSTALL_DATA = @INSTALL_DATA@ +INSTALL_PROGRAM = @INSTALL_PROGRAM@ +INSTALL_SCRIPT = @INSTALL_SCRIPT@ +INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@ +LDFLAGS = @LDFLAGS@ +LIBOBJS = @LIBOBJS@ +LIBS = @LIBS@ +LTLIBOBJS = @LTLIBOBJS@ +MAKEINFO = @MAKEINFO@ +MKDIR_P = @MKDIR_P@ +OBJEXT = @OBJEXT@ +PACKAGE = @PACKAGE@ +PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@ +PACKAGE_NAME = @PACKAGE_NAME@ +PACKAGE_STRING = @PACKAGE_STRING@ +PACKAGE_TARNAME = @PACKAGE_TARNAME@ +PACKAGE_VERSION = @PACKAGE_VERSION@ +PATH_SEPARATOR = @PATH_SEPARATOR@ +RANLIB = @RANLIB@ +SET_MAKE = @SET_MAKE@ +SHELL = @SHELL@ +STRIP = @STRIP@ +VERSION = @VERSION@ +abs_builddir = @abs_builddir@ +abs_srcdir = @abs_srcdir@ +abs_top_builddir = @abs_top_builddir@ +abs_top_srcdir = @abs_top_srcdir@ +ac_ct_CC = @ac_ct_CC@ +ac_ct_CXX = @ac_ct_CXX@ +am__include = @am__include@ +am__leading_dot = @am__leading_dot@ +am__quote = @am__quote@ +am__tar = @am__tar@ +am__untar = @am__untar@ +bindir = @bindir@ +build = @build@ +build_alias = @build_alias@ +build_cpu = @build_cpu@ +build_os = @build_os@ +build_vendor = @build_vendor@ +builddir = @builddir@ +canonical_host_type = @canonical_host_type@ +datadir = @datadir@ +datarootdir = @datarootdir@ +docdir = @docdir@ +dvidir = @dvidir@ +exec_prefix = @exec_prefix@ +host = @host@ +host_alias = @host_alias@ +host_cpu = @host_cpu@ +host_os = @host_os@ +host_vendor = @host_vendor@ +htmldir = @htmldir@ +includedir = @includedir@ +infodir = @infodir@ +install_sh = @install_sh@ +libdir = @libdir@ +libexecdir = @libexecdir@ +localedir = @localedir@ +localstatedir = @localstatedir@ +mandir = @mandir@ +mkdir_p = @mkdir_p@ +oldincludedir = @oldincludedir@ +pdfdir = @pdfdir@ +prefix = @prefix@ +program_transform_name = @program_transform_name@ +psdir = @psdir@ +sbindir = @sbindir@ +sharedstatedir = @sharedstatedir@ +srcdir = @srcdir@ +sysconfdir = @sysconfdir@ +target_alias = @target_alias@ +top_builddir = @top_builddir@ +top_srcdir = @top_srcdir@ +AM_CPPFLAGS = \ + $(CC_WARNINGS) \ + -I../libfastx + +fastx_collapser_SOURCES = fastx_collapser.cpp \ + std_hash.h + +fastx_collapser_LDADD = ../libfastx/libfastx.a +all: all-am + +.SUFFIXES: +.SUFFIXES: .cpp .o .obj +$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps) + @for dep in $?; do \ + case '$(am__configure_deps)' in \ + *$$dep*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh \ + && exit 0; \ + exit 1;; \ + esac; \ + done; \ + echo ' cd $(top_srcdir) && $(AUTOMAKE) --gnu src/fastx_collapser/Makefile'; \ + cd $(top_srcdir) && \ + $(AUTOMAKE) --gnu src/fastx_collapser/Makefile +.PRECIOUS: Makefile +Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status + @case '$?' in \ + *config.status*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \ + *) \ + echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \ + cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \ + esac; + +$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +$(top_srcdir)/configure: $(am__configure_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +$(ACLOCAL_M4): $(am__aclocal_m4_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +install-binPROGRAMS: $(bin_PROGRAMS) + @$(NORMAL_INSTALL) + test -z "$(bindir)" || $(MKDIR_P) "$(DESTDIR)$(bindir)" + @list='$(bin_PROGRAMS)'; for p in $$list; do \ + p1=`echo $$p|sed 's/$(EXEEXT)$$//'`; \ + if test -f $$p \ + ; then \ + f=`echo "$$p1" | sed 's,^.*/,,;$(transform);s/$$/$(EXEEXT)/'`; \ + echo " $(INSTALL_PROGRAM_ENV) $(binPROGRAMS_INSTALL) '$$p' '$(DESTDIR)$(bindir)/$$f'"; \ + $(INSTALL_PROGRAM_ENV) $(binPROGRAMS_INSTALL) "$$p" "$(DESTDIR)$(bindir)/$$f" || exit 1; \ + else :; fi; \ + done + +uninstall-binPROGRAMS: + @$(NORMAL_UNINSTALL) + @list='$(bin_PROGRAMS)'; for p in $$list; do \ + f=`echo "$$p" | sed 's,^.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/'`; \ + echo " rm -f '$(DESTDIR)$(bindir)/$$f'"; \ + rm -f "$(DESTDIR)$(bindir)/$$f"; \ + done + +clean-binPROGRAMS: + -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS) +fastx_collapser$(EXEEXT): $(fastx_collapser_OBJECTS) $(fastx_collapser_DEPENDENCIES) + @rm -f fastx_collapser$(EXEEXT) + $(CXXLINK) $(fastx_collapser_OBJECTS) $(fastx_collapser_LDADD) $(LIBS) + +mostlyclean-compile: + -rm -f *.$(OBJEXT) + +distclean-compile: + -rm -f *.tab.c + +@AMDEP_TRUE@@am__include@ @am__quote@./$(DEPDIR)/fastx_collapser.Po@am__quote@ + +.cpp.o: +@am__fastdepCXX_TRUE@ $(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $< +@am__fastdepCXX_TRUE@ mv -f $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po +@AMDEP_TRUE@@am__fastdepCXX_FALSE@ source='$<' object='$@' libtool=no @AMDEPBACKSLASH@ +@AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@ +@am__fastdepCXX_FALSE@ $(CXXCOMPILE) -c -o $@ $< + +.cpp.obj: +@am__fastdepCXX_TRUE@ $(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'` +@am__fastdepCXX_TRUE@ mv -f $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po +@AMDEP_TRUE@@am__fastdepCXX_FALSE@ source='$<' object='$@' libtool=no @AMDEPBACKSLASH@ +@AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@ +@am__fastdepCXX_FALSE@ $(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'` + +ID: $(HEADERS) $(SOURCES) $(LISP) $(TAGS_FILES) + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonemtpy = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + mkid -fID $$unique +tags: TAGS + +TAGS: $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + here=`pwd`; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + if test -z "$(ETAGS_ARGS)$$tags$$unique"; then :; else \ + test -n "$$unique" || unique=$$empty_fix; \ + $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \ + $$tags $$unique; \ + fi +ctags: CTAGS +CTAGS: $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + test -z "$(CTAGS_ARGS)$$tags$$unique" \ + || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \ + $$tags $$unique + +GTAGS: + here=`$(am__cd) $(top_builddir) && pwd` \ + && cd $(top_srcdir) \ + && gtags -i $(GTAGS_ARGS) $$here + +distclean-tags: + -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags + +distdir: $(DISTFILES) + @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + list='$(DISTFILES)'; \ + dist_files=`for file in $$list; do echo $$file; done | \ + sed -e "s|^$$srcdirstrip/||;t" \ + -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \ + case $$dist_files in \ + */*) $(MKDIR_P) `echo "$$dist_files" | \ + sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \ + sort -u` ;; \ + esac; \ + for file in $$dist_files; do \ + if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \ + if test -d $$d/$$file; then \ + dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \ + if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \ + cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \ + fi; \ + cp -pR $$d/$$file $(distdir)$$dir || exit 1; \ + else \ + test -f $(distdir)/$$file \ + || cp -p $$d/$$file $(distdir)/$$file \ + || exit 1; \ + fi; \ + done +check-am: all-am +check: check-am +all-am: Makefile $(PROGRAMS) +installdirs: + for dir in "$(DESTDIR)$(bindir)"; do \ + test -z "$$dir" || $(MKDIR_P) "$$dir"; \ + done +install: install-am +install-exec: install-exec-am +install-data: install-data-am +uninstall: uninstall-am + +install-am: all-am + @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am + +installcheck: installcheck-am +install-strip: + $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \ + install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \ + `test -z '$(STRIP)' || \ + echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install +mostlyclean-generic: + +clean-generic: + +distclean-generic: + -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES) + +maintainer-clean-generic: + @echo "This command is intended for maintainers to use" + @echo "it deletes files that may require special tools to rebuild." +clean: clean-am + +clean-am: clean-binPROGRAMS clean-generic mostlyclean-am + +distclean: distclean-am + -rm -rf ./$(DEPDIR) + -rm -f Makefile +distclean-am: clean-am distclean-compile distclean-generic \ + distclean-tags + +dvi: dvi-am + +dvi-am: + +html: html-am + +info: info-am + +info-am: + +install-data-am: + +install-dvi: install-dvi-am + +install-exec-am: install-binPROGRAMS + +install-html: install-html-am + +install-info: install-info-am + +install-man: + +install-pdf: install-pdf-am + +install-ps: install-ps-am + +installcheck-am: + +maintainer-clean: maintainer-clean-am + -rm -rf ./$(DEPDIR) + -rm -f Makefile +maintainer-clean-am: distclean-am maintainer-clean-generic + +mostlyclean: mostlyclean-am + +mostlyclean-am: mostlyclean-compile mostlyclean-generic + +pdf: pdf-am + +pdf-am: + +ps: ps-am + +ps-am: + +uninstall-am: uninstall-binPROGRAMS + +.MAKE: install-am install-strip + +.PHONY: CTAGS GTAGS all all-am check check-am clean clean-binPROGRAMS \ + clean-generic ctags distclean distclean-compile \ + distclean-generic distclean-tags distdir dvi dvi-am html \ + html-am info info-am install install-am install-binPROGRAMS \ + install-data install-data-am install-dvi install-dvi-am \ + install-exec install-exec-am install-html install-html-am \ + install-info install-info-am install-man install-pdf \ + install-pdf-am install-ps install-ps-am install-strip \ + installcheck installcheck-am installdirs maintainer-clean \ + maintainer-clean-generic mostlyclean mostlyclean-compile \ + mostlyclean-generic pdf pdf-am ps ps-am tags uninstall \ + uninstall-am uninstall-binPROGRAMS + +# Tell versions [3.59,3.63) of GNU make to not export all variables. +# Otherwise a system limit (for SysV at least) may be exceeded. +.NOEXPORT: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_collapser/fastx_collapser.cpp --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastx_collapser/fastx_collapser.cpp Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,116 @@ +/* + FASTX-toolkit - FASTA/FASTQ preprocessing tools. + Copyright (C) 2009 A. Gordon (gordon@cshl.edu) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU Affero General Public License as + published by the Free Software Foundation, either version 3 of the + License, or (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU Affero General Public License for more details. + + You should have received a copy of the GNU Affero General Public License + along with this program. If not, see . +*/ +#include +#include +#include +#include +#include +#include +#include +#include +#include +#include +#include +#include + +#include + +#include "fastx.h" +#include "fastx_args.h" + +using namespace std; + +const char* usage= +"usage: fastx_collapser [-h] [-v] [-i INFILE] [-o OUTFILE]\n" \ +"\n" \ +"version " VERSION "\n" \ +" [-h] = This helpful help screen.\n" \ +" [-v] = verbose: print short summary of input/output counts\n" \ +" [-i INFILE] = FASTA/Q input file. default is STDIN.\n" \ +" [-o OUTFILE] = FASTA/Q output file. default is STDOUT.\n" \ +"\n"; + +FASTX fastx; +#include +std::tr1::unordered_map collapsed_sequences; +std::list< pair > sorted_collapsed_sequences ; + +struct PrintCollapsedSequence +{ + size_t counter; + size_t total_reads ; + + ostream &output ; + PrintCollapsedSequence( ostream& _output ) : + counter(0), + total_reads(0), + output(_output) {} + + void operator() ( const std::pair & sequence ) + { + counter++; + total_reads += sequence.second ; + output << ">" << counter << "-" << sequence.second << endl << sequence.first << endl ; + } +}; + +bool sort_by_abundance_count ( const pair & sequence1, const pair& sequence2 ) +{ + return sequence1.second < sequence2.second ; +} + +int main(int argc, char* argv[]) +{ + ofstream output_file ; + + fastx_parse_cmdline(argc, argv, "", NULL ); + + fastx_init_reader(&fastx, get_input_filename(), + FASTA_OR_FASTQ, ALLOW_N, REQUIRE_UPPERCASE); + + bool use_stdout = true; + if ( strcmp(get_output_filename(), "-")!=0 ) { + use_stdout = false; + output_file.open(get_output_filename()); + if (!output_file) + errx(1,"Failed to create output file (%s)", get_output_filename() ); + } + ostream& real_output = (use_stdout) ? cout : output_file ; + + while ( fastx_read_next_record(&fastx) ) { + collapsed_sequences[string(fastx.nucleotides)]++ ; + } + + copy ( collapsed_sequences.begin(), collapsed_sequences.end(), + back_inserter(sorted_collapsed_sequences) ) ; + + sorted_collapsed_sequences.sort ( sort_by_abundance_count ) ; + + PrintCollapsedSequence stats = for_each ( sorted_collapsed_sequences.rbegin(), + sorted_collapsed_sequences.rend(), PrintCollapsedSequence(real_output) ) ; + + if (stats.total_reads != num_input_reads(&fastx)) + errx(1,"Internal error: stats.total_reads (%zu) != num_input_reads(&fastx) (%zu).\n", + stats.total_reads, num_input_reads(&fastx) ); + + if ( verbose_flag() ) { + fprintf(get_report_file(), "Collapsd %zu reads into %zu unique sequences.\n", + num_input_reads(&fastx), stats.counter) ; + } + return 0; +} diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_collapser/std_hash.h --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastx_collapser/std_hash.h Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,64 @@ +/* + FASTX-toolkit - FASTA/FASTQ preprocessing tools. + Copyright (C) 2009 A. Gordon (gordon@cshl.edu) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU Affero General Public License as + published by the Free Software Foundation, either version 3 of the + License, or (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU Affero General Public License for more details. + + You should have received a copy of the GNU Affero General Public License + along with this program. If not, see . +*/ +#ifndef __STD_HASH__ +#define __STD_HASH__ + + +/* + * Centralized place to load std::hash_map + * + * GCC needs the following hacks... + * Other compilers/systems might require different hacks + */ + +#include +#include + +namespace std +{ + using namespace __gnu_cxx; + + struct std_string_hash + { + size_t operator()( const std::string& x ) const + { + //printf("std_string_hash: hashing '%s'\n", x.c_str()); + return hash< const char* >()( x.c_str() ); + } + }; + + /* + * 'eqstr' and 'hash_map' usage is based on http://www.sgi.com/tech/stl/hash_map.html + */ + struct eqstr + { + bool operator()(const char* s1, const char* s2) const + { + return strcmp(s1, s2) == 0; + } + }; + + typedef hash_map< const char*, int, hash< const char* >, eqstr > hash_map_charptr_to_int; + + typedef hash_map< string, int, std_string_hash > hash_map_string_to_int; + + typedef hash_set < string, std_string_hash > hash_set_string ; +} + +#endif + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_quality_stats/Makefile.am --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastx_quality_stats/Makefile.am Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,21 @@ +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + + +bin_PROGRAMS = fastx_quality_stats + +AM_CPPFLAGS = \ + $(CC_WARNINGS) \ + -I../libfastx + +fastx_quality_stats_SOURCES = fastx_quality_stats.c + +fastx_quality_stats_LDADD = ../libfastx/libfastx.a + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_quality_stats/Makefile.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastx_quality_stats/Makefile.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,438 @@ +# Makefile.in generated by automake 1.10.1 from Makefile.am. +# @configure_input@ + +# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, +# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This Makefile.in is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +@SET_MAKE@ + +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +VPATH = @srcdir@ +pkgdatadir = $(datadir)/@PACKAGE@ +pkglibdir = $(libdir)/@PACKAGE@ +pkgincludedir = $(includedir)/@PACKAGE@ +am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd +install_sh_DATA = $(install_sh) -c -m 644 +install_sh_PROGRAM = $(install_sh) -c +install_sh_SCRIPT = $(install_sh) -c +INSTALL_HEADER = $(INSTALL_DATA) +transform = $(program_transform_name) +NORMAL_INSTALL = : +PRE_INSTALL = : +POST_INSTALL = : +NORMAL_UNINSTALL = : +PRE_UNINSTALL = : +POST_UNINSTALL = : +build_triplet = @build@ +host_triplet = @host@ +bin_PROGRAMS = fastx_quality_stats$(EXEEXT) +subdir = src/fastx_quality_stats +DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in +ACLOCAL_M4 = $(top_srcdir)/aclocal.m4 +am__aclocal_m4_deps = $(top_srcdir)/configure.ac +am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \ + $(ACLOCAL_M4) +mkinstalldirs = $(install_sh) -d +CONFIG_HEADER = $(top_builddir)/config.h +CONFIG_CLEAN_FILES = +am__installdirs = "$(DESTDIR)$(bindir)" +binPROGRAMS_INSTALL = $(INSTALL_PROGRAM) +PROGRAMS = $(bin_PROGRAMS) +am_fastx_quality_stats_OBJECTS = fastx_quality_stats.$(OBJEXT) +fastx_quality_stats_OBJECTS = $(am_fastx_quality_stats_OBJECTS) +fastx_quality_stats_DEPENDENCIES = ../libfastx/libfastx.a +DEFAULT_INCLUDES = -I.@am__isrc@ -I$(top_builddir) +depcomp = $(SHELL) $(top_srcdir)/config/depcomp +am__depfiles_maybe = depfiles +COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \ + $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS) +CCLD = $(CC) +LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@ +SOURCES = $(fastx_quality_stats_SOURCES) +DIST_SOURCES = $(fastx_quality_stats_SOURCES) +ETAGS = etags +CTAGS = ctags +DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST) +ACLOCAL = @ACLOCAL@ +AMTAR = @AMTAR@ +AUTOCONF = @AUTOCONF@ +AUTOHEADER = @AUTOHEADER@ +AUTOMAKE = @AUTOMAKE@ +AWK = @AWK@ +CC = @CC@ +CCDEPMODE = @CCDEPMODE@ +CFLAGS = @CFLAGS@ +CPP = @CPP@ +CPPFLAGS = @CPPFLAGS@ +CXX = @CXX@ +CXXCPP = @CXXCPP@ +CXXDEPMODE = @CXXDEPMODE@ +CXXFLAGS = @CXXFLAGS@ +CYGPATH_W = @CYGPATH_W@ +DEFS = @DEFS@ +DEPDIR = @DEPDIR@ +ECHO_C = @ECHO_C@ +ECHO_N = @ECHO_N@ +ECHO_T = @ECHO_T@ +EGREP = @EGREP@ +EXEEXT = @EXEEXT@ +GREP = @GREP@ +INSTALL = @INSTALL@ +INSTALL_DATA = @INSTALL_DATA@ +INSTALL_PROGRAM = @INSTALL_PROGRAM@ +INSTALL_SCRIPT = @INSTALL_SCRIPT@ +INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@ +LDFLAGS = @LDFLAGS@ +LIBOBJS = @LIBOBJS@ +LIBS = @LIBS@ +LTLIBOBJS = @LTLIBOBJS@ +MAKEINFO = @MAKEINFO@ +MKDIR_P = @MKDIR_P@ +OBJEXT = @OBJEXT@ +PACKAGE = @PACKAGE@ +PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@ +PACKAGE_NAME = @PACKAGE_NAME@ +PACKAGE_STRING = @PACKAGE_STRING@ +PACKAGE_TARNAME = @PACKAGE_TARNAME@ +PACKAGE_VERSION = @PACKAGE_VERSION@ +PATH_SEPARATOR = @PATH_SEPARATOR@ +RANLIB = @RANLIB@ +SET_MAKE = @SET_MAKE@ +SHELL = @SHELL@ +STRIP = @STRIP@ +VERSION = @VERSION@ +abs_builddir = @abs_builddir@ +abs_srcdir = @abs_srcdir@ +abs_top_builddir = @abs_top_builddir@ +abs_top_srcdir = @abs_top_srcdir@ +ac_ct_CC = @ac_ct_CC@ +ac_ct_CXX = @ac_ct_CXX@ +am__include = @am__include@ +am__leading_dot = @am__leading_dot@ +am__quote = @am__quote@ +am__tar = @am__tar@ +am__untar = @am__untar@ +bindir = @bindir@ +build = @build@ +build_alias = @build_alias@ +build_cpu = @build_cpu@ +build_os = @build_os@ +build_vendor = @build_vendor@ +builddir = @builddir@ +canonical_host_type = @canonical_host_type@ +datadir = @datadir@ +datarootdir = @datarootdir@ +docdir = @docdir@ +dvidir = @dvidir@ +exec_prefix = @exec_prefix@ +host = @host@ +host_alias = @host_alias@ +host_cpu = @host_cpu@ +host_os = @host_os@ +host_vendor = @host_vendor@ +htmldir = @htmldir@ +includedir = @includedir@ +infodir = @infodir@ +install_sh = @install_sh@ +libdir = @libdir@ +libexecdir = @libexecdir@ +localedir = @localedir@ +localstatedir = @localstatedir@ +mandir = @mandir@ +mkdir_p = @mkdir_p@ +oldincludedir = @oldincludedir@ +pdfdir = @pdfdir@ +prefix = @prefix@ +program_transform_name = @program_transform_name@ +psdir = @psdir@ +sbindir = @sbindir@ +sharedstatedir = @sharedstatedir@ +srcdir = @srcdir@ +sysconfdir = @sysconfdir@ +target_alias = @target_alias@ +top_builddir = @top_builddir@ +top_srcdir = @top_srcdir@ +AM_CPPFLAGS = \ + $(CC_WARNINGS) \ + -I../libfastx + +fastx_quality_stats_SOURCES = fastx_quality_stats.c +fastx_quality_stats_LDADD = ../libfastx/libfastx.a +all: all-am + +.SUFFIXES: +.SUFFIXES: .c .o .obj +$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps) + @for dep in $?; do \ + case '$(am__configure_deps)' in \ + *$$dep*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh \ + && exit 0; \ + exit 1;; \ + esac; \ + done; \ + echo ' cd $(top_srcdir) && $(AUTOMAKE) --gnu src/fastx_quality_stats/Makefile'; \ + cd $(top_srcdir) && \ + $(AUTOMAKE) --gnu src/fastx_quality_stats/Makefile +.PRECIOUS: Makefile +Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status + @case '$?' in \ + *config.status*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \ + *) \ + echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \ + cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \ + esac; + +$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +$(top_srcdir)/configure: $(am__configure_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +$(ACLOCAL_M4): $(am__aclocal_m4_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +install-binPROGRAMS: $(bin_PROGRAMS) + @$(NORMAL_INSTALL) + test -z "$(bindir)" || $(MKDIR_P) "$(DESTDIR)$(bindir)" + @list='$(bin_PROGRAMS)'; for p in $$list; do \ + p1=`echo $$p|sed 's/$(EXEEXT)$$//'`; \ + if test -f $$p \ + ; then \ + f=`echo "$$p1" | sed 's,^.*/,,;$(transform);s/$$/$(EXEEXT)/'`; \ + echo " $(INSTALL_PROGRAM_ENV) $(binPROGRAMS_INSTALL) '$$p' '$(DESTDIR)$(bindir)/$$f'"; \ + $(INSTALL_PROGRAM_ENV) $(binPROGRAMS_INSTALL) "$$p" "$(DESTDIR)$(bindir)/$$f" || exit 1; \ + else :; fi; \ + done + +uninstall-binPROGRAMS: + @$(NORMAL_UNINSTALL) + @list='$(bin_PROGRAMS)'; for p in $$list; do \ + f=`echo "$$p" | sed 's,^.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/'`; \ + echo " rm -f '$(DESTDIR)$(bindir)/$$f'"; \ + rm -f "$(DESTDIR)$(bindir)/$$f"; \ + done + +clean-binPROGRAMS: + -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS) +fastx_quality_stats$(EXEEXT): $(fastx_quality_stats_OBJECTS) $(fastx_quality_stats_DEPENDENCIES) + @rm -f fastx_quality_stats$(EXEEXT) + $(LINK) $(fastx_quality_stats_OBJECTS) $(fastx_quality_stats_LDADD) $(LIBS) + +mostlyclean-compile: + -rm -f *.$(OBJEXT) + +distclean-compile: + -rm -f *.tab.c + +@AMDEP_TRUE@@am__include@ @am__quote@./$(DEPDIR)/fastx_quality_stats.Po@am__quote@ + +.c.o: +@am__fastdepCC_TRUE@ $(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $< +@am__fastdepCC_TRUE@ mv -f $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po +@AMDEP_TRUE@@am__fastdepCC_FALSE@ source='$<' object='$@' libtool=no @AMDEPBACKSLASH@ +@AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@ +@am__fastdepCC_FALSE@ $(COMPILE) -c $< + +.c.obj: +@am__fastdepCC_TRUE@ $(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'` +@am__fastdepCC_TRUE@ mv -f $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po +@AMDEP_TRUE@@am__fastdepCC_FALSE@ source='$<' object='$@' libtool=no @AMDEPBACKSLASH@ +@AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@ +@am__fastdepCC_FALSE@ $(COMPILE) -c `$(CYGPATH_W) '$<'` + +ID: $(HEADERS) $(SOURCES) $(LISP) $(TAGS_FILES) + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonemtpy = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + mkid -fID $$unique +tags: TAGS + +TAGS: $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + here=`pwd`; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + if test -z "$(ETAGS_ARGS)$$tags$$unique"; then :; else \ + test -n "$$unique" || unique=$$empty_fix; \ + $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \ + $$tags $$unique; \ + fi +ctags: CTAGS +CTAGS: $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + test -z "$(CTAGS_ARGS)$$tags$$unique" \ + || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \ + $$tags $$unique + +GTAGS: + here=`$(am__cd) $(top_builddir) && pwd` \ + && cd $(top_srcdir) \ + && gtags -i $(GTAGS_ARGS) $$here + +distclean-tags: + -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags + +distdir: $(DISTFILES) + @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + list='$(DISTFILES)'; \ + dist_files=`for file in $$list; do echo $$file; done | \ + sed -e "s|^$$srcdirstrip/||;t" \ + -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \ + case $$dist_files in \ + */*) $(MKDIR_P) `echo "$$dist_files" | \ + sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \ + sort -u` ;; \ + esac; \ + for file in $$dist_files; do \ + if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \ + if test -d $$d/$$file; then \ + dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \ + if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \ + cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \ + fi; \ + cp -pR $$d/$$file $(distdir)$$dir || exit 1; \ + else \ + test -f $(distdir)/$$file \ + || cp -p $$d/$$file $(distdir)/$$file \ + || exit 1; \ + fi; \ + done +check-am: all-am +check: check-am +all-am: Makefile $(PROGRAMS) +installdirs: + for dir in "$(DESTDIR)$(bindir)"; do \ + test -z "$$dir" || $(MKDIR_P) "$$dir"; \ + done +install: install-am +install-exec: install-exec-am +install-data: install-data-am +uninstall: uninstall-am + +install-am: all-am + @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am + +installcheck: installcheck-am +install-strip: + $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \ + install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \ + `test -z '$(STRIP)' || \ + echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install +mostlyclean-generic: + +clean-generic: + +distclean-generic: + -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES) + +maintainer-clean-generic: + @echo "This command is intended for maintainers to use" + @echo "it deletes files that may require special tools to rebuild." +clean: clean-am + +clean-am: clean-binPROGRAMS clean-generic mostlyclean-am + +distclean: distclean-am + -rm -rf ./$(DEPDIR) + -rm -f Makefile +distclean-am: clean-am distclean-compile distclean-generic \ + distclean-tags + +dvi: dvi-am + +dvi-am: + +html: html-am + +info: info-am + +info-am: + +install-data-am: + +install-dvi: install-dvi-am + +install-exec-am: install-binPROGRAMS + +install-html: install-html-am + +install-info: install-info-am + +install-man: + +install-pdf: install-pdf-am + +install-ps: install-ps-am + +installcheck-am: + +maintainer-clean: maintainer-clean-am + -rm -rf ./$(DEPDIR) + -rm -f Makefile +maintainer-clean-am: distclean-am maintainer-clean-generic + +mostlyclean: mostlyclean-am + +mostlyclean-am: mostlyclean-compile mostlyclean-generic + +pdf: pdf-am + +pdf-am: + +ps: ps-am + +ps-am: + +uninstall-am: uninstall-binPROGRAMS + +.MAKE: install-am install-strip + +.PHONY: CTAGS GTAGS all all-am check check-am clean clean-binPROGRAMS \ + clean-generic ctags distclean distclean-compile \ + distclean-generic distclean-tags distdir dvi dvi-am html \ + html-am info info-am install install-am install-binPROGRAMS \ + install-data install-data-am install-dvi install-dvi-am \ + install-exec install-exec-am install-html install-html-am \ + install-info install-info-am install-man install-pdf \ + install-pdf-am install-ps install-ps-am install-strip \ + installcheck installcheck-am installdirs maintainer-clean \ + maintainer-clean-generic mostlyclean mostlyclean-compile \ + mostlyclean-generic pdf pdf-am ps ps-am tags uninstall \ + uninstall-am uninstall-binPROGRAMS + +# Tell versions [3.59,3.63) of GNU make to not export all variables. +# Otherwise a system limit (for SysV at least) may be exceeded. +.NOEXPORT: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_quality_stats/fastx_quality_stats.c --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastx_quality_stats/fastx_quality_stats.c Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,293 @@ +/* + FASTX-toolkit - FASTA/FASTQ preprocessing tools. + Copyright (C) 2009 A. Gordon (gordon@cshl.edu) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU Affero General Public License as + published by the Free Software Foundation, either version 3 of the + License, or (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU Affero General Public License for more details. + + You should have received a copy of the GNU Affero General Public License + along with this program. If not, see . +*/ +#include +#include +#include +#include +#include +#include + +#include + +#include "chomp.h" +#include "fastx.h" +#include "fastx_args.h" + +#define MAX_SEQUENCE_LENGTH (MAX_SEQ_LINE_LENGTH) // as of Nov. 2008, 110 Cycles is the max... change it as necessary + +const char* usage= +"usage: fastx_quality_stats [-h] [-i INFILE] [-o OUTFILE]\n" \ +"\n" \ +"version " VERSION " \n" \ +" [-h] = This helpful help screen.\n" \ +" [-i INFILE] = FASTQ input file. default is STDIN.\n" \ +" [-o OUTFILE] = TEXT output file. default is STDOUT.\n" \ +"\n"\ +"The output TEXT file will have the following fields (one row per column):\n" \ +" column = column number (1 to 36 for a 36-cycles read solexa file)\n" \ +" count = number of bases found in this column.\n" \ +" min = Lowest quality score value found in this column.\n" \ +" max = Highest quality score value found in this column.\n" \ +" sum = Sum of quality score values for this column.\n" \ +" mean = Mean quality score value for this column.\n" \ +" Q1 = 1st quartile quality score.\n" \ +" med = Median quality score.\n" \ +" Q3 = 3rd quartile quality score.\n" \ +" IQR = Inter-Quartile range (Q3-Q1).\n" \ +" lW = 'Left-Whisker' value (for boxplotting).\n" \ +" rW = 'Right-Whisker' value (for boxplotting).\n" \ +" A_Count = Count of 'A' nucleotides found in this column.\n" \ +" C_Count = Count of 'C' nucleotides found in this column.\n" \ +" G_Count = Count of 'G' nucleotides found in this column.\n" \ +" T_Count = Count of 'T' nucleotides found in this column.\n" \ +" N_Count = Count of 'N' nucleotides found in this column.\n" \ +" max-count = max. number of bases (in all cycles)\n" \ +"\n"; +; + +FILE* outfile; + +/* + Information for each column in the solexa file. + ("Column" here refers to the number of reads in the file, usually 36) +*/ +struct column_data +{ + int min; + int max; + unsigned long long sum; + int count; + int A_count; + int C_count; + int G_count; + int T_count; + int N_count; + + //Instead of keeping a sorted array of all the quality values (which is needed to find the median value), + //We keep the values in this array. similar to "Couting Sort" array in "Introduction to Algorithms", page 169. + //Each time we encounter a quality value number (in the range of MIN_QUALITY_VALUE to MAX_QUALITY_VALUE), + //we increment the count in the corresponding index of this array. + int bases_values_count[QUALITY_VALUES_RANGE]; +}; + +int sequences_count; +struct column_data columns[MAX_SEQUENCE_LENGTH]; +FASTX fastx; + +void init_values() +{ + int i,j; + + sequences_count=0; + + for (i=0;i= MAX_SEQ_LINE_LENGTH) + errx(1, "Internal error: sequence too long (on line %llu). Hard-coded max. length is %d", + fastx.input_line_number, MAX_SEQ_LINE_LENGTH ) ; + + //for each base in the sequence... + for (index=0; index quality_value) + columns[index].min = quality_value; + if (columns[index].max < quality_value) + columns[index].max = quality_value; + columns[index].sum += quality_value; + columns[index].bases_values_count[quality_value - MIN_QUALITY_VALUE ] ++ ; + } + + //Update Nucleotides Counts + reads_count = get_reads_count(&fastx); //if this is a collapsed FASTA file, each sequence can represent multiple reads + columns[index].count += reads_count; + + //update the base counts statistics + switch(fastx.nucleotides[index]) + { + case 'A': columns[index].A_count+=reads_count; break; + case 'C': columns[index].C_count+=reads_count; break; + case 'T': columns[index].T_count+=reads_count; break; + case 'G': columns[index].G_count+=reads_count; break; + case 'N': columns[index].N_count+=reads_count; break; + + /* This shoudn't really happen, as 'fastx_read_next_record' should catch invalid values */ + default: errx(1, "Internal error: invalid base value (%c)!", fastx.nucleotides[index]) ; + } + } + + sequences_count++; + + //DEBUG + //if ( (fileline-1) % 10000==0 ) { fprintf(stderr,"."); fflush(stderr) ; } + } +} + +int get_nth_value(int base_index, int n) +{ + int pos; + + if (base_index<0 || base_index>MAX_SEQUENCE_LENGTH) { + fprintf(stderr,"Internal error at get_nth_value, base_index=%d\n", base_index); + exit(1); + } + if (n<0 || n>=columns[base_index].count) { + fprintf(stderr,"Internal error at get_nth_value (base_index=%d, n=%d), count_values[%d]=%d\n", + base_index, n, base_index, columns[base_index].count ) ; + exit(1); + } + + if (n==0) + return columns[base_index].min; + + + pos = 0 ; + while (n > 0) { + if (columns[base_index].bases_values_count[pos] > n) + break; + n -= columns[base_index].bases_values_count[pos]; + pos++; + while (columns[base_index].bases_values_count[pos]==0) + pos++; + } + return pos + MIN_QUALITY_VALUE ; +} + +void print_statistics() +{ + int i; + int Q1,Q3,IQR; + int LeftWisker, RightWisker; + + //Fields: + fprintf(outfile,"column\t"); + fprintf(outfile,"count\tmin\tmax\tsum\t"); + fprintf(outfile,"mean\tQ1\tmed\tQ3\t"); + fprintf(outfile,"IQR\tlW\trW\t"); + fprintf(outfile,"A_Count\tC_Count\tG_Count\tT_Count\tN_Count\t"); + fprintf(outfile,"Max_count\n"); + for (i=0;i columns[i].max ) + RightWisker = columns[i].max; + else + RightWisker = (Q3 + IQR*3/2); //TODO - make sure there's an observed value at this point + + //Column number + fprintf(outfile,"%d\t", i+1); + + fprintf(outfile,"%d\t%d\t%d\t%lld\t", + columns[i].count, + columns[i].min, + columns[i].max, + columns[i].sum); + + + fprintf(outfile,"%3.2f\t%d\t%d\t%d\t", + ((double)columns[i].sum)/((double)columns[i].count), + Q1, + get_nth_value ( i, columns[i].count / 2 ), + Q3); + + fprintf(outfile,"%d\t%d\t%d\t", + IQR, + LeftWisker, + RightWisker + ); + + fprintf(outfile,"%d\t%d\t%d\t%d\t%d\t", + columns[i].A_count, + columns[i].C_count, + columns[i].G_count, + columns[i].T_count, + columns[i].N_count); + + + //Maximum number of bases (out of all cycles/columns). + //it is always equal to the count of the first column + //(since all reads have a base at the first column, + // but some might not have base at later columns (if they were clipped) ) + fprintf(outfile,"%d\n", + columns[0].count ) ; + } +} + +void parse_commandline(int argc, char* argv[]) +{ + fastx_parse_cmdline(argc, argv, "", NULL); + + fastx_init_reader(&fastx, get_input_filename(), + FASTA_OR_FASTQ, ALLOW_N, REQUIRE_UPPERCASE); + + if (strcmp( get_output_filename(), "-" ) == 0 ) { + outfile = stdout; + } else { + outfile = fopen(get_output_filename(), "w+"); + if (outfile==NULL) + err(1,"Failed to create output file (%s)", get_output_filename()); + } +} + + +int main(int argc, char* argv[]) +{ + parse_commandline(argc,argv); + init_values(); + read_file(); + print_statistics(); + return 0; +} diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_reverse_complement/Makefile.am --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastx_reverse_complement/Makefile.am Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,21 @@ +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + + +bin_PROGRAMS = fastx_reverse_complement + +AM_CPPFLAGS = \ + $(CC_WARNINGS) \ + -I../libfastx + +fastx_reverse_complement_SOURCES = fastx_reverse_complement.c + +fastx_reverse_complement_LDADD = ../libfastx/libfastx.a + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_reverse_complement/Makefile.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastx_reverse_complement/Makefile.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,440 @@ +# Makefile.in generated by automake 1.10.1 from Makefile.am. +# @configure_input@ + +# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, +# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This Makefile.in is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +@SET_MAKE@ + +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +VPATH = @srcdir@ +pkgdatadir = $(datadir)/@PACKAGE@ +pkglibdir = $(libdir)/@PACKAGE@ +pkgincludedir = $(includedir)/@PACKAGE@ +am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd +install_sh_DATA = $(install_sh) -c -m 644 +install_sh_PROGRAM = $(install_sh) -c +install_sh_SCRIPT = $(install_sh) -c +INSTALL_HEADER = $(INSTALL_DATA) +transform = $(program_transform_name) +NORMAL_INSTALL = : +PRE_INSTALL = : +POST_INSTALL = : +NORMAL_UNINSTALL = : +PRE_UNINSTALL = : +POST_UNINSTALL = : +build_triplet = @build@ +host_triplet = @host@ +bin_PROGRAMS = fastx_reverse_complement$(EXEEXT) +subdir = src/fastx_reverse_complement +DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in +ACLOCAL_M4 = $(top_srcdir)/aclocal.m4 +am__aclocal_m4_deps = $(top_srcdir)/configure.ac +am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \ + $(ACLOCAL_M4) +mkinstalldirs = $(install_sh) -d +CONFIG_HEADER = $(top_builddir)/config.h +CONFIG_CLEAN_FILES = +am__installdirs = "$(DESTDIR)$(bindir)" +binPROGRAMS_INSTALL = $(INSTALL_PROGRAM) +PROGRAMS = $(bin_PROGRAMS) +am_fastx_reverse_complement_OBJECTS = \ + fastx_reverse_complement.$(OBJEXT) +fastx_reverse_complement_OBJECTS = \ + $(am_fastx_reverse_complement_OBJECTS) +fastx_reverse_complement_DEPENDENCIES = ../libfastx/libfastx.a +DEFAULT_INCLUDES = -I.@am__isrc@ -I$(top_builddir) +depcomp = $(SHELL) $(top_srcdir)/config/depcomp +am__depfiles_maybe = depfiles +COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \ + $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS) +CCLD = $(CC) +LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@ +SOURCES = $(fastx_reverse_complement_SOURCES) +DIST_SOURCES = $(fastx_reverse_complement_SOURCES) +ETAGS = etags +CTAGS = ctags +DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST) +ACLOCAL = @ACLOCAL@ +AMTAR = @AMTAR@ +AUTOCONF = @AUTOCONF@ +AUTOHEADER = @AUTOHEADER@ +AUTOMAKE = @AUTOMAKE@ +AWK = @AWK@ +CC = @CC@ +CCDEPMODE = @CCDEPMODE@ +CFLAGS = @CFLAGS@ +CPP = @CPP@ +CPPFLAGS = @CPPFLAGS@ +CXX = @CXX@ +CXXCPP = @CXXCPP@ +CXXDEPMODE = @CXXDEPMODE@ +CXXFLAGS = @CXXFLAGS@ +CYGPATH_W = @CYGPATH_W@ +DEFS = @DEFS@ +DEPDIR = @DEPDIR@ +ECHO_C = @ECHO_C@ +ECHO_N = @ECHO_N@ +ECHO_T = @ECHO_T@ +EGREP = @EGREP@ +EXEEXT = @EXEEXT@ +GREP = @GREP@ +INSTALL = @INSTALL@ +INSTALL_DATA = @INSTALL_DATA@ +INSTALL_PROGRAM = @INSTALL_PROGRAM@ +INSTALL_SCRIPT = @INSTALL_SCRIPT@ +INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@ +LDFLAGS = @LDFLAGS@ +LIBOBJS = @LIBOBJS@ +LIBS = @LIBS@ +LTLIBOBJS = @LTLIBOBJS@ +MAKEINFO = @MAKEINFO@ +MKDIR_P = @MKDIR_P@ +OBJEXT = @OBJEXT@ +PACKAGE = @PACKAGE@ +PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@ +PACKAGE_NAME = @PACKAGE_NAME@ +PACKAGE_STRING = @PACKAGE_STRING@ +PACKAGE_TARNAME = @PACKAGE_TARNAME@ +PACKAGE_VERSION = @PACKAGE_VERSION@ +PATH_SEPARATOR = @PATH_SEPARATOR@ +RANLIB = @RANLIB@ +SET_MAKE = @SET_MAKE@ +SHELL = @SHELL@ +STRIP = @STRIP@ +VERSION = @VERSION@ +abs_builddir = @abs_builddir@ +abs_srcdir = @abs_srcdir@ +abs_top_builddir = @abs_top_builddir@ +abs_top_srcdir = @abs_top_srcdir@ +ac_ct_CC = @ac_ct_CC@ +ac_ct_CXX = @ac_ct_CXX@ +am__include = @am__include@ +am__leading_dot = @am__leading_dot@ +am__quote = @am__quote@ +am__tar = @am__tar@ +am__untar = @am__untar@ +bindir = @bindir@ +build = @build@ +build_alias = @build_alias@ +build_cpu = @build_cpu@ +build_os = @build_os@ +build_vendor = @build_vendor@ +builddir = @builddir@ +canonical_host_type = @canonical_host_type@ +datadir = @datadir@ +datarootdir = @datarootdir@ +docdir = @docdir@ +dvidir = @dvidir@ +exec_prefix = @exec_prefix@ +host = @host@ +host_alias = @host_alias@ +host_cpu = @host_cpu@ +host_os = @host_os@ +host_vendor = @host_vendor@ +htmldir = @htmldir@ +includedir = @includedir@ +infodir = @infodir@ +install_sh = @install_sh@ +libdir = @libdir@ +libexecdir = @libexecdir@ +localedir = @localedir@ +localstatedir = @localstatedir@ +mandir = @mandir@ +mkdir_p = @mkdir_p@ +oldincludedir = @oldincludedir@ +pdfdir = @pdfdir@ +prefix = @prefix@ +program_transform_name = @program_transform_name@ +psdir = @psdir@ +sbindir = @sbindir@ +sharedstatedir = @sharedstatedir@ +srcdir = @srcdir@ +sysconfdir = @sysconfdir@ +target_alias = @target_alias@ +top_builddir = @top_builddir@ +top_srcdir = @top_srcdir@ +AM_CPPFLAGS = \ + $(CC_WARNINGS) \ + -I../libfastx + +fastx_reverse_complement_SOURCES = fastx_reverse_complement.c +fastx_reverse_complement_LDADD = ../libfastx/libfastx.a +all: all-am + +.SUFFIXES: +.SUFFIXES: .c .o .obj +$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps) + @for dep in $?; do \ + case '$(am__configure_deps)' in \ + *$$dep*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh \ + && exit 0; \ + exit 1;; \ + esac; \ + done; \ + echo ' cd $(top_srcdir) && $(AUTOMAKE) --gnu src/fastx_reverse_complement/Makefile'; \ + cd $(top_srcdir) && \ + $(AUTOMAKE) --gnu src/fastx_reverse_complement/Makefile +.PRECIOUS: Makefile +Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status + @case '$?' in \ + *config.status*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \ + *) \ + echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \ + cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \ + esac; + +$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +$(top_srcdir)/configure: $(am__configure_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +$(ACLOCAL_M4): $(am__aclocal_m4_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +install-binPROGRAMS: $(bin_PROGRAMS) + @$(NORMAL_INSTALL) + test -z "$(bindir)" || $(MKDIR_P) "$(DESTDIR)$(bindir)" + @list='$(bin_PROGRAMS)'; for p in $$list; do \ + p1=`echo $$p|sed 's/$(EXEEXT)$$//'`; \ + if test -f $$p \ + ; then \ + f=`echo "$$p1" | sed 's,^.*/,,;$(transform);s/$$/$(EXEEXT)/'`; \ + echo " $(INSTALL_PROGRAM_ENV) $(binPROGRAMS_INSTALL) '$$p' '$(DESTDIR)$(bindir)/$$f'"; \ + $(INSTALL_PROGRAM_ENV) $(binPROGRAMS_INSTALL) "$$p" "$(DESTDIR)$(bindir)/$$f" || exit 1; \ + else :; fi; \ + done + +uninstall-binPROGRAMS: + @$(NORMAL_UNINSTALL) + @list='$(bin_PROGRAMS)'; for p in $$list; do \ + f=`echo "$$p" | sed 's,^.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/'`; \ + echo " rm -f '$(DESTDIR)$(bindir)/$$f'"; \ + rm -f "$(DESTDIR)$(bindir)/$$f"; \ + done + +clean-binPROGRAMS: + -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS) +fastx_reverse_complement$(EXEEXT): $(fastx_reverse_complement_OBJECTS) $(fastx_reverse_complement_DEPENDENCIES) + @rm -f fastx_reverse_complement$(EXEEXT) + $(LINK) $(fastx_reverse_complement_OBJECTS) $(fastx_reverse_complement_LDADD) $(LIBS) + +mostlyclean-compile: + -rm -f *.$(OBJEXT) + +distclean-compile: + -rm -f *.tab.c + +@AMDEP_TRUE@@am__include@ @am__quote@./$(DEPDIR)/fastx_reverse_complement.Po@am__quote@ + +.c.o: +@am__fastdepCC_TRUE@ $(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $< +@am__fastdepCC_TRUE@ mv -f $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po +@AMDEP_TRUE@@am__fastdepCC_FALSE@ source='$<' object='$@' libtool=no @AMDEPBACKSLASH@ +@AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@ +@am__fastdepCC_FALSE@ $(COMPILE) -c $< + +.c.obj: +@am__fastdepCC_TRUE@ $(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'` +@am__fastdepCC_TRUE@ mv -f $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po +@AMDEP_TRUE@@am__fastdepCC_FALSE@ source='$<' object='$@' libtool=no @AMDEPBACKSLASH@ +@AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@ +@am__fastdepCC_FALSE@ $(COMPILE) -c `$(CYGPATH_W) '$<'` + +ID: $(HEADERS) $(SOURCES) $(LISP) $(TAGS_FILES) + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonemtpy = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + mkid -fID $$unique +tags: TAGS + +TAGS: $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + here=`pwd`; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + if test -z "$(ETAGS_ARGS)$$tags$$unique"; then :; else \ + test -n "$$unique" || unique=$$empty_fix; \ + $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \ + $$tags $$unique; \ + fi +ctags: CTAGS +CTAGS: $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + test -z "$(CTAGS_ARGS)$$tags$$unique" \ + || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \ + $$tags $$unique + +GTAGS: + here=`$(am__cd) $(top_builddir) && pwd` \ + && cd $(top_srcdir) \ + && gtags -i $(GTAGS_ARGS) $$here + +distclean-tags: + -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags + +distdir: $(DISTFILES) + @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + list='$(DISTFILES)'; \ + dist_files=`for file in $$list; do echo $$file; done | \ + sed -e "s|^$$srcdirstrip/||;t" \ + -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \ + case $$dist_files in \ + */*) $(MKDIR_P) `echo "$$dist_files" | \ + sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \ + sort -u` ;; \ + esac; \ + for file in $$dist_files; do \ + if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \ + if test -d $$d/$$file; then \ + dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \ + if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \ + cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \ + fi; \ + cp -pR $$d/$$file $(distdir)$$dir || exit 1; \ + else \ + test -f $(distdir)/$$file \ + || cp -p $$d/$$file $(distdir)/$$file \ + || exit 1; \ + fi; \ + done +check-am: all-am +check: check-am +all-am: Makefile $(PROGRAMS) +installdirs: + for dir in "$(DESTDIR)$(bindir)"; do \ + test -z "$$dir" || $(MKDIR_P) "$$dir"; \ + done +install: install-am +install-exec: install-exec-am +install-data: install-data-am +uninstall: uninstall-am + +install-am: all-am + @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am + +installcheck: installcheck-am +install-strip: + $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \ + install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \ + `test -z '$(STRIP)' || \ + echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install +mostlyclean-generic: + +clean-generic: + +distclean-generic: + -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES) + +maintainer-clean-generic: + @echo "This command is intended for maintainers to use" + @echo "it deletes files that may require special tools to rebuild." +clean: clean-am + +clean-am: clean-binPROGRAMS clean-generic mostlyclean-am + +distclean: distclean-am + -rm -rf ./$(DEPDIR) + -rm -f Makefile +distclean-am: clean-am distclean-compile distclean-generic \ + distclean-tags + +dvi: dvi-am + +dvi-am: + +html: html-am + +info: info-am + +info-am: + +install-data-am: + +install-dvi: install-dvi-am + +install-exec-am: install-binPROGRAMS + +install-html: install-html-am + +install-info: install-info-am + +install-man: + +install-pdf: install-pdf-am + +install-ps: install-ps-am + +installcheck-am: + +maintainer-clean: maintainer-clean-am + -rm -rf ./$(DEPDIR) + -rm -f Makefile +maintainer-clean-am: distclean-am maintainer-clean-generic + +mostlyclean: mostlyclean-am + +mostlyclean-am: mostlyclean-compile mostlyclean-generic + +pdf: pdf-am + +pdf-am: + +ps: ps-am + +ps-am: + +uninstall-am: uninstall-binPROGRAMS + +.MAKE: install-am install-strip + +.PHONY: CTAGS GTAGS all all-am check check-am clean clean-binPROGRAMS \ + clean-generic ctags distclean distclean-compile \ + distclean-generic distclean-tags distdir dvi dvi-am html \ + html-am info info-am install install-am install-binPROGRAMS \ + install-data install-data-am install-dvi install-dvi-am \ + install-exec install-exec-am install-html install-html-am \ + install-info install-info-am install-man install-pdf \ + install-pdf-am install-ps install-ps-am install-strip \ + installcheck installcheck-am installdirs maintainer-clean \ + maintainer-clean-generic mostlyclean mostlyclean-compile \ + mostlyclean-generic pdf pdf-am ps ps-am tags uninstall \ + uninstall-am uninstall-binPROGRAMS + +# Tell versions [3.59,3.63) of GNU make to not export all variables. +# Otherwise a system limit (for SysV at least) may be exceeded. +.NOEXPORT: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_reverse_complement/fastx_reverse_complement.c --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastx_reverse_complement/fastx_reverse_complement.c Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,126 @@ +/* + FASTX-toolkit - FASTA/FASTQ preprocessing tools. + Copyright (C) 2009 A. Gordon (gordon@cshl.edu) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU Affero General Public License as + published by the Free Software Foundation, either version 3 of the + License, or (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU Affero General Public License for more details. + + You should have received a copy of the GNU Affero General Public License + along with this program. If not, see . +*/ +#include +#include +#include +#include +#include +#include +#include + +#include + +#include "fastx.h" +#include "fastx_args.h" + +const char* usage= +"usage: fastx_reverse_complement [-h] [-r] [-z] [-v] [-i INFILE] [-o OUTFILE]\n" \ +"\n" \ +"version " VERSION "\n" \ +" [-h] = This helpful help screen.\n" \ +" [-z] = Compress output with GZIP.\n" \ +" [-i INFILE] = FASTA/Q input file. default is STDIN.\n" \ +" [-o OUTFILE] = FASTA/Q output file. default is STDOUT.\n" \ +"\n"; + +FASTX fastx; + +char reverse_complement_base ( const char input ) +{ + switch(input) + { + case 'N': + return 'N'; + case 'n': + return 'n'; + case 'A': + return 'T'; + case 'T': + return 'A'; + case 'G': + return 'C'; + case 'C': + return 'G'; + case 'a': + return 't'; + case 't': + return 'a'; + case 'g': + return 'c'; + case 'c': + return 'g'; + default: + errx(1,"Invalid nucleotide value (%c) in reverse_complement_base()", input ); + } + +} + +void reverse_complement_fastx(FASTX* pFASTX) +{ + int i,j ; + int length = strlen(pFASTX->nucleotides); + + char temp_nuc; + int temp_qual; + + for (i=0;inucleotides[i] = reverse_complement_base ( pFASTX->nucleotides[i] ) ; + + i = 0 ; + j = length - 1 ; + while ( i < j ) { + //Swap the nucleotides + temp_nuc = pFASTX->nucleotides[i] ; + pFASTX->nucleotides[i] = pFASTX->nucleotides[j] ; + pFASTX->nucleotides[j] = temp_nuc; + + //Swap the quality scores + if (pFASTX->read_fastq) { + temp_qual = pFASTX->quality[i]; + pFASTX->quality[i] = pFASTX->quality[j]; + pFASTX->quality[j] = temp_qual ; + } + + //Advance to next position + i++; + j--; + } +} + + +int main(int argc, char* argv[]) +{ + fastx_parse_cmdline(argc, argv, "", NULL); + + fastx_init_reader(&fastx, get_input_filename(), + FASTA_OR_FASTQ, ALLOW_N, REQUIRE_UPPERCASE); + + fastx_init_writer(&fastx, get_output_filename(), OUTPUT_SAME_AS_INPUT, compress_output_flag()); + + while ( fastx_read_next_record(&fastx) ) { + reverse_complement_fastx(&fastx); + fastx_write_record(&fastx); + } + + if ( verbose_flag() ) { + fprintf(get_report_file(), "Printing Reverse-Complement Sequences.\n" ); + fprintf(get_report_file(), "Input: %zu reads.\n", num_input_reads(&fastx) ) ; + fprintf(get_report_file(), "Output: %zu reads.\n", num_output_reads(&fastx) ) ; + } + return 0; +} diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_trimmer/Makefile.am --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastx_trimmer/Makefile.am Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,21 @@ +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + + +bin_PROGRAMS = fastx_trimmer + +AM_CPPFLAGS = \ + $(CC_WARNINGS) \ + -I../libfastx + +fastx_trimmer_SOURCES = fastx_trimmer.c + +fastx_trimmer_LDADD = ../libfastx/libfastx.a + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_trimmer/Makefile.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastx_trimmer/Makefile.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,438 @@ +# Makefile.in generated by automake 1.10.1 from Makefile.am. +# @configure_input@ + +# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, +# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This Makefile.in is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +@SET_MAKE@ + +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +VPATH = @srcdir@ +pkgdatadir = $(datadir)/@PACKAGE@ +pkglibdir = $(libdir)/@PACKAGE@ +pkgincludedir = $(includedir)/@PACKAGE@ +am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd +install_sh_DATA = $(install_sh) -c -m 644 +install_sh_PROGRAM = $(install_sh) -c +install_sh_SCRIPT = $(install_sh) -c +INSTALL_HEADER = $(INSTALL_DATA) +transform = $(program_transform_name) +NORMAL_INSTALL = : +PRE_INSTALL = : +POST_INSTALL = : +NORMAL_UNINSTALL = : +PRE_UNINSTALL = : +POST_UNINSTALL = : +build_triplet = @build@ +host_triplet = @host@ +bin_PROGRAMS = fastx_trimmer$(EXEEXT) +subdir = src/fastx_trimmer +DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in +ACLOCAL_M4 = $(top_srcdir)/aclocal.m4 +am__aclocal_m4_deps = $(top_srcdir)/configure.ac +am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \ + $(ACLOCAL_M4) +mkinstalldirs = $(install_sh) -d +CONFIG_HEADER = $(top_builddir)/config.h +CONFIG_CLEAN_FILES = +am__installdirs = "$(DESTDIR)$(bindir)" +binPROGRAMS_INSTALL = $(INSTALL_PROGRAM) +PROGRAMS = $(bin_PROGRAMS) +am_fastx_trimmer_OBJECTS = fastx_trimmer.$(OBJEXT) +fastx_trimmer_OBJECTS = $(am_fastx_trimmer_OBJECTS) +fastx_trimmer_DEPENDENCIES = ../libfastx/libfastx.a +DEFAULT_INCLUDES = -I.@am__isrc@ -I$(top_builddir) +depcomp = $(SHELL) $(top_srcdir)/config/depcomp +am__depfiles_maybe = depfiles +COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \ + $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS) +CCLD = $(CC) +LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@ +SOURCES = $(fastx_trimmer_SOURCES) +DIST_SOURCES = $(fastx_trimmer_SOURCES) +ETAGS = etags +CTAGS = ctags +DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST) +ACLOCAL = @ACLOCAL@ +AMTAR = @AMTAR@ +AUTOCONF = @AUTOCONF@ +AUTOHEADER = @AUTOHEADER@ +AUTOMAKE = @AUTOMAKE@ +AWK = @AWK@ +CC = @CC@ +CCDEPMODE = @CCDEPMODE@ +CFLAGS = @CFLAGS@ +CPP = @CPP@ +CPPFLAGS = @CPPFLAGS@ +CXX = @CXX@ +CXXCPP = @CXXCPP@ +CXXDEPMODE = @CXXDEPMODE@ +CXXFLAGS = @CXXFLAGS@ +CYGPATH_W = @CYGPATH_W@ +DEFS = @DEFS@ +DEPDIR = @DEPDIR@ +ECHO_C = @ECHO_C@ +ECHO_N = @ECHO_N@ +ECHO_T = @ECHO_T@ +EGREP = @EGREP@ +EXEEXT = @EXEEXT@ +GREP = @GREP@ +INSTALL = @INSTALL@ +INSTALL_DATA = @INSTALL_DATA@ +INSTALL_PROGRAM = @INSTALL_PROGRAM@ +INSTALL_SCRIPT = @INSTALL_SCRIPT@ +INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@ +LDFLAGS = @LDFLAGS@ +LIBOBJS = @LIBOBJS@ +LIBS = @LIBS@ +LTLIBOBJS = @LTLIBOBJS@ +MAKEINFO = @MAKEINFO@ +MKDIR_P = @MKDIR_P@ +OBJEXT = @OBJEXT@ +PACKAGE = @PACKAGE@ +PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@ +PACKAGE_NAME = @PACKAGE_NAME@ +PACKAGE_STRING = @PACKAGE_STRING@ +PACKAGE_TARNAME = @PACKAGE_TARNAME@ +PACKAGE_VERSION = @PACKAGE_VERSION@ +PATH_SEPARATOR = @PATH_SEPARATOR@ +RANLIB = @RANLIB@ +SET_MAKE = @SET_MAKE@ +SHELL = @SHELL@ +STRIP = @STRIP@ +VERSION = @VERSION@ +abs_builddir = @abs_builddir@ +abs_srcdir = @abs_srcdir@ +abs_top_builddir = @abs_top_builddir@ +abs_top_srcdir = @abs_top_srcdir@ +ac_ct_CC = @ac_ct_CC@ +ac_ct_CXX = @ac_ct_CXX@ +am__include = @am__include@ +am__leading_dot = @am__leading_dot@ +am__quote = @am__quote@ +am__tar = @am__tar@ +am__untar = @am__untar@ +bindir = @bindir@ +build = @build@ +build_alias = @build_alias@ +build_cpu = @build_cpu@ +build_os = @build_os@ +build_vendor = @build_vendor@ +builddir = @builddir@ +canonical_host_type = @canonical_host_type@ +datadir = @datadir@ +datarootdir = @datarootdir@ +docdir = @docdir@ +dvidir = @dvidir@ +exec_prefix = @exec_prefix@ +host = @host@ +host_alias = @host_alias@ +host_cpu = @host_cpu@ +host_os = @host_os@ +host_vendor = @host_vendor@ +htmldir = @htmldir@ +includedir = @includedir@ +infodir = @infodir@ +install_sh = @install_sh@ +libdir = @libdir@ +libexecdir = @libexecdir@ +localedir = @localedir@ +localstatedir = @localstatedir@ +mandir = @mandir@ +mkdir_p = @mkdir_p@ +oldincludedir = @oldincludedir@ +pdfdir = @pdfdir@ +prefix = @prefix@ +program_transform_name = @program_transform_name@ +psdir = @psdir@ +sbindir = @sbindir@ +sharedstatedir = @sharedstatedir@ +srcdir = @srcdir@ +sysconfdir = @sysconfdir@ +target_alias = @target_alias@ +top_builddir = @top_builddir@ +top_srcdir = @top_srcdir@ +AM_CPPFLAGS = \ + $(CC_WARNINGS) \ + -I../libfastx + +fastx_trimmer_SOURCES = fastx_trimmer.c +fastx_trimmer_LDADD = ../libfastx/libfastx.a +all: all-am + +.SUFFIXES: +.SUFFIXES: .c .o .obj +$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps) + @for dep in $?; do \ + case '$(am__configure_deps)' in \ + *$$dep*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh \ + && exit 0; \ + exit 1;; \ + esac; \ + done; \ + echo ' cd $(top_srcdir) && $(AUTOMAKE) --gnu src/fastx_trimmer/Makefile'; \ + cd $(top_srcdir) && \ + $(AUTOMAKE) --gnu src/fastx_trimmer/Makefile +.PRECIOUS: Makefile +Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status + @case '$?' in \ + *config.status*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \ + *) \ + echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \ + cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \ + esac; + +$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +$(top_srcdir)/configure: $(am__configure_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +$(ACLOCAL_M4): $(am__aclocal_m4_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +install-binPROGRAMS: $(bin_PROGRAMS) + @$(NORMAL_INSTALL) + test -z "$(bindir)" || $(MKDIR_P) "$(DESTDIR)$(bindir)" + @list='$(bin_PROGRAMS)'; for p in $$list; do \ + p1=`echo $$p|sed 's/$(EXEEXT)$$//'`; \ + if test -f $$p \ + ; then \ + f=`echo "$$p1" | sed 's,^.*/,,;$(transform);s/$$/$(EXEEXT)/'`; \ + echo " $(INSTALL_PROGRAM_ENV) $(binPROGRAMS_INSTALL) '$$p' '$(DESTDIR)$(bindir)/$$f'"; \ + $(INSTALL_PROGRAM_ENV) $(binPROGRAMS_INSTALL) "$$p" "$(DESTDIR)$(bindir)/$$f" || exit 1; \ + else :; fi; \ + done + +uninstall-binPROGRAMS: + @$(NORMAL_UNINSTALL) + @list='$(bin_PROGRAMS)'; for p in $$list; do \ + f=`echo "$$p" | sed 's,^.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/'`; \ + echo " rm -f '$(DESTDIR)$(bindir)/$$f'"; \ + rm -f "$(DESTDIR)$(bindir)/$$f"; \ + done + +clean-binPROGRAMS: + -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS) +fastx_trimmer$(EXEEXT): $(fastx_trimmer_OBJECTS) $(fastx_trimmer_DEPENDENCIES) + @rm -f fastx_trimmer$(EXEEXT) + $(LINK) $(fastx_trimmer_OBJECTS) $(fastx_trimmer_LDADD) $(LIBS) + +mostlyclean-compile: + -rm -f *.$(OBJEXT) + +distclean-compile: + -rm -f *.tab.c + +@AMDEP_TRUE@@am__include@ @am__quote@./$(DEPDIR)/fastx_trimmer.Po@am__quote@ + +.c.o: +@am__fastdepCC_TRUE@ $(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $< +@am__fastdepCC_TRUE@ mv -f $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po +@AMDEP_TRUE@@am__fastdepCC_FALSE@ source='$<' object='$@' libtool=no @AMDEPBACKSLASH@ +@AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@ +@am__fastdepCC_FALSE@ $(COMPILE) -c $< + +.c.obj: +@am__fastdepCC_TRUE@ $(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'` +@am__fastdepCC_TRUE@ mv -f $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po +@AMDEP_TRUE@@am__fastdepCC_FALSE@ source='$<' object='$@' libtool=no @AMDEPBACKSLASH@ +@AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@ +@am__fastdepCC_FALSE@ $(COMPILE) -c `$(CYGPATH_W) '$<'` + +ID: $(HEADERS) $(SOURCES) $(LISP) $(TAGS_FILES) + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonemtpy = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + mkid -fID $$unique +tags: TAGS + +TAGS: $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + here=`pwd`; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + if test -z "$(ETAGS_ARGS)$$tags$$unique"; then :; else \ + test -n "$$unique" || unique=$$empty_fix; \ + $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \ + $$tags $$unique; \ + fi +ctags: CTAGS +CTAGS: $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + test -z "$(CTAGS_ARGS)$$tags$$unique" \ + || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \ + $$tags $$unique + +GTAGS: + here=`$(am__cd) $(top_builddir) && pwd` \ + && cd $(top_srcdir) \ + && gtags -i $(GTAGS_ARGS) $$here + +distclean-tags: + -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags + +distdir: $(DISTFILES) + @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + list='$(DISTFILES)'; \ + dist_files=`for file in $$list; do echo $$file; done | \ + sed -e "s|^$$srcdirstrip/||;t" \ + -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \ + case $$dist_files in \ + */*) $(MKDIR_P) `echo "$$dist_files" | \ + sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \ + sort -u` ;; \ + esac; \ + for file in $$dist_files; do \ + if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \ + if test -d $$d/$$file; then \ + dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \ + if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \ + cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \ + fi; \ + cp -pR $$d/$$file $(distdir)$$dir || exit 1; \ + else \ + test -f $(distdir)/$$file \ + || cp -p $$d/$$file $(distdir)/$$file \ + || exit 1; \ + fi; \ + done +check-am: all-am +check: check-am +all-am: Makefile $(PROGRAMS) +installdirs: + for dir in "$(DESTDIR)$(bindir)"; do \ + test -z "$$dir" || $(MKDIR_P) "$$dir"; \ + done +install: install-am +install-exec: install-exec-am +install-data: install-data-am +uninstall: uninstall-am + +install-am: all-am + @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am + +installcheck: installcheck-am +install-strip: + $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \ + install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \ + `test -z '$(STRIP)' || \ + echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install +mostlyclean-generic: + +clean-generic: + +distclean-generic: + -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES) + +maintainer-clean-generic: + @echo "This command is intended for maintainers to use" + @echo "it deletes files that may require special tools to rebuild." +clean: clean-am + +clean-am: clean-binPROGRAMS clean-generic mostlyclean-am + +distclean: distclean-am + -rm -rf ./$(DEPDIR) + -rm -f Makefile +distclean-am: clean-am distclean-compile distclean-generic \ + distclean-tags + +dvi: dvi-am + +dvi-am: + +html: html-am + +info: info-am + +info-am: + +install-data-am: + +install-dvi: install-dvi-am + +install-exec-am: install-binPROGRAMS + +install-html: install-html-am + +install-info: install-info-am + +install-man: + +install-pdf: install-pdf-am + +install-ps: install-ps-am + +installcheck-am: + +maintainer-clean: maintainer-clean-am + -rm -rf ./$(DEPDIR) + -rm -f Makefile +maintainer-clean-am: distclean-am maintainer-clean-generic + +mostlyclean: mostlyclean-am + +mostlyclean-am: mostlyclean-compile mostlyclean-generic + +pdf: pdf-am + +pdf-am: + +ps: ps-am + +ps-am: + +uninstall-am: uninstall-binPROGRAMS + +.MAKE: install-am install-strip + +.PHONY: CTAGS GTAGS all all-am check check-am clean clean-binPROGRAMS \ + clean-generic ctags distclean distclean-compile \ + distclean-generic distclean-tags distdir dvi dvi-am html \ + html-am info info-am install install-am install-binPROGRAMS \ + install-data install-data-am install-dvi install-dvi-am \ + install-exec install-exec-am install-html install-html-am \ + install-info install-info-am install-man install-pdf \ + install-pdf-am install-ps install-ps-am install-strip \ + installcheck installcheck-am installdirs maintainer-clean \ + maintainer-clean-generic mostlyclean mostlyclean-compile \ + mostlyclean-generic pdf pdf-am ps ps-am tags uninstall \ + uninstall-am uninstall-binPROGRAMS + +# Tell versions [3.59,3.63) of GNU make to not export all variables. +# Otherwise a system limit (for SysV at least) may be exceeded. +.NOEXPORT: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_trimmer/fastx_trimmer.c --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/fastx_trimmer/fastx_trimmer.c Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,114 @@ +/* + FASTX-toolkit - FASTA/FASTQ preprocessing tools. + Copyright (C) 2009 A. Gordon (gordon@cshl.edu) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU Affero General Public License as + published by the Free Software Foundation, either version 3 of the + License, or (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU Affero General Public License for more details. + + You should have received a copy of the GNU Affero General Public License + along with this program. If not, see . +*/ +#include +#include +#include +#include +#include +#include +#include + +#include + +#include "fastx.h" +#include "fastx_args.h" + +#define MAX_ADAPTER_LEN 100 + +const char* usage= +"usage: fastx_trimmer [-h] [-f N] [-l N] [-z] [-v] [-i INFILE] [-o OUTFILE]\n" \ +"\n" \ +"version " VERSION "\n" \ +" [-h] = This helpful help screen.\n" \ +" [-f N] = First base to keep. Default is 1 (=first base).\n" \ +" [-l N] = Last base to keep. Default is entire read.\n" \ +" [-z] = Compress output with GZIP.\n" \ +" [-i INFILE] = FASTA/Q input file. default is STDIN.\n" \ +" [-o OUTFILE] = FASTA/Q output file. default is STDOUT.\n" \ +"\n"; + +#define DO_NOT_TRIM_LAST_BASE (0) + +int keep_first_base=1; +int keep_last_base=DO_NOT_TRIM_LAST_BASE; + +FASTX fastx; + +int parse_program_args(int __attribute__((unused)) optind, int optc, char* optarg) +{ + switch(optc) { + case 'f': + if (optarg==NULL) + errx(1, "[-f] parameter requires an argument value"); + keep_first_base = strtoul(optarg,NULL,10); + if (keep_first_base<=0 || keep_first_base>=MAX_SEQ_LINE_LENGTH) + errx(1,"Invalid number bases to keep (-f %s)", optarg); + break; + + case 'l': + if (optarg==NULL) + errx(1, "[-l] parameter requires an argument value"); + keep_last_base = strtoul(optarg,NULL,10); + if (keep_last_base<=0 || keep_last_base>=MAX_SEQ_LINE_LENGTH) + errx(1,"Invalid number bases to keep (-l %s)", optarg); + break; + + default: + errx(1, __FILE__ ":%d: Unknown argument (%c)", __LINE__, optc ) ; + + } + return 1; +} + + +int main(int argc, char* argv[]) +{ + size_t i; + + fastx_parse_cmdline(argc, argv, "l:f:", parse_program_args); + + fastx_init_reader(&fastx, get_input_filename(), + FASTA_OR_FASTQ, ALLOW_N, REQUIRE_UPPERCASE); + + fastx_init_writer(&fastx, get_output_filename(), OUTPUT_SAME_AS_INPUT, compress_output_flag()); + + while ( fastx_read_next_record(&fastx) ) { + + if (keep_last_base != DO_NOT_TRIM_LAST_BASE) { + fastx.nucleotides[keep_last_base] = 0 ; + } + + if (keep_first_base != 1) { + for (i=0; i < strlen(fastx.nucleotides)-keep_first_base+1 ; i++) { + fastx.nucleotides[i] = fastx.nucleotides[i+keep_first_base-1]; + fastx.quality[i] = fastx.quality[i+keep_first_base-1]; + } + fastx.nucleotides[i] = 0 ; + } + + //none of the above condition matched, so print this sequence. + fastx_write_record(&fastx); + } + + if ( verbose_flag() ) { + fprintf(get_report_file(), "Trimming: base %d to %d\n", keep_first_base, keep_last_base ) ; + fprintf(get_report_file(), "Input: %zu reads.\n", num_input_reads(&fastx) ) ; + fprintf(get_report_file(), "Output: %zu reads.\n", num_output_reads(&fastx) ) ; + } + return 0; +} diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/libfastx/Makefile.am --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/libfastx/Makefile.am Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,8 @@ + +noinst_LIBRARIES = libfastx.a + +libfastx_a_SOURCES = chomp.c chomp.h \ + fastx.c fastx.h \ + fastx_args.c fastx_args.h \ + sequence_alignment.h sequence_alignment.cpp + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/libfastx/Makefile.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/libfastx/Makefile.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,429 @@ +# Makefile.in generated by automake 1.10.1 from Makefile.am. +# @configure_input@ + +# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, +# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This Makefile.in is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +@SET_MAKE@ + +VPATH = @srcdir@ +pkgdatadir = $(datadir)/@PACKAGE@ +pkglibdir = $(libdir)/@PACKAGE@ +pkgincludedir = $(includedir)/@PACKAGE@ +am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd +install_sh_DATA = $(install_sh) -c -m 644 +install_sh_PROGRAM = $(install_sh) -c +install_sh_SCRIPT = $(install_sh) -c +INSTALL_HEADER = $(INSTALL_DATA) +transform = $(program_transform_name) +NORMAL_INSTALL = : +PRE_INSTALL = : +POST_INSTALL = : +NORMAL_UNINSTALL = : +PRE_UNINSTALL = : +POST_UNINSTALL = : +build_triplet = @build@ +host_triplet = @host@ +subdir = src/libfastx +DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in +ACLOCAL_M4 = $(top_srcdir)/aclocal.m4 +am__aclocal_m4_deps = $(top_srcdir)/configure.ac +am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \ + $(ACLOCAL_M4) +mkinstalldirs = $(install_sh) -d +CONFIG_HEADER = $(top_builddir)/config.h +CONFIG_CLEAN_FILES = +LIBRARIES = $(noinst_LIBRARIES) +AR = ar +ARFLAGS = cru +libfastx_a_AR = $(AR) $(ARFLAGS) +libfastx_a_LIBADD = +am_libfastx_a_OBJECTS = chomp.$(OBJEXT) fastx.$(OBJEXT) \ + fastx_args.$(OBJEXT) sequence_alignment.$(OBJEXT) +libfastx_a_OBJECTS = $(am_libfastx_a_OBJECTS) +DEFAULT_INCLUDES = -I.@am__isrc@ -I$(top_builddir) +depcomp = $(SHELL) $(top_srcdir)/config/depcomp +am__depfiles_maybe = depfiles +COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \ + $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS) +CCLD = $(CC) +LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@ +CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \ + $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) +CXXLD = $(CXX) +CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \ + -o $@ +SOURCES = $(libfastx_a_SOURCES) +DIST_SOURCES = $(libfastx_a_SOURCES) +ETAGS = etags +CTAGS = ctags +DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST) +ACLOCAL = @ACLOCAL@ +AMTAR = @AMTAR@ +AUTOCONF = @AUTOCONF@ +AUTOHEADER = @AUTOHEADER@ +AUTOMAKE = @AUTOMAKE@ +AWK = @AWK@ +CC = @CC@ +CCDEPMODE = @CCDEPMODE@ +CFLAGS = @CFLAGS@ +CPP = @CPP@ +CPPFLAGS = @CPPFLAGS@ +CXX = @CXX@ +CXXCPP = @CXXCPP@ +CXXDEPMODE = @CXXDEPMODE@ +CXXFLAGS = @CXXFLAGS@ +CYGPATH_W = @CYGPATH_W@ +DEFS = @DEFS@ +DEPDIR = @DEPDIR@ +ECHO_C = @ECHO_C@ +ECHO_N = @ECHO_N@ +ECHO_T = @ECHO_T@ +EGREP = @EGREP@ +EXEEXT = @EXEEXT@ +GREP = @GREP@ +INSTALL = @INSTALL@ +INSTALL_DATA = @INSTALL_DATA@ +INSTALL_PROGRAM = @INSTALL_PROGRAM@ +INSTALL_SCRIPT = @INSTALL_SCRIPT@ +INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@ +LDFLAGS = @LDFLAGS@ +LIBOBJS = @LIBOBJS@ +LIBS = @LIBS@ +LTLIBOBJS = @LTLIBOBJS@ +MAKEINFO = @MAKEINFO@ +MKDIR_P = @MKDIR_P@ +OBJEXT = @OBJEXT@ +PACKAGE = @PACKAGE@ +PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@ +PACKAGE_NAME = @PACKAGE_NAME@ +PACKAGE_STRING = @PACKAGE_STRING@ +PACKAGE_TARNAME = @PACKAGE_TARNAME@ +PACKAGE_VERSION = @PACKAGE_VERSION@ +PATH_SEPARATOR = @PATH_SEPARATOR@ +RANLIB = @RANLIB@ +SET_MAKE = @SET_MAKE@ +SHELL = @SHELL@ +STRIP = @STRIP@ +VERSION = @VERSION@ +abs_builddir = @abs_builddir@ +abs_srcdir = @abs_srcdir@ +abs_top_builddir = @abs_top_builddir@ +abs_top_srcdir = @abs_top_srcdir@ +ac_ct_CC = @ac_ct_CC@ +ac_ct_CXX = @ac_ct_CXX@ +am__include = @am__include@ +am__leading_dot = @am__leading_dot@ +am__quote = @am__quote@ +am__tar = @am__tar@ +am__untar = @am__untar@ +bindir = @bindir@ +build = @build@ +build_alias = @build_alias@ +build_cpu = @build_cpu@ +build_os = @build_os@ +build_vendor = @build_vendor@ +builddir = @builddir@ +canonical_host_type = @canonical_host_type@ +datadir = @datadir@ +datarootdir = @datarootdir@ +docdir = @docdir@ +dvidir = @dvidir@ +exec_prefix = @exec_prefix@ +host = @host@ +host_alias = @host_alias@ +host_cpu = @host_cpu@ +host_os = @host_os@ +host_vendor = @host_vendor@ +htmldir = @htmldir@ +includedir = @includedir@ +infodir = @infodir@ +install_sh = @install_sh@ +libdir = @libdir@ +libexecdir = @libexecdir@ +localedir = @localedir@ +localstatedir = @localstatedir@ +mandir = @mandir@ +mkdir_p = @mkdir_p@ +oldincludedir = @oldincludedir@ +pdfdir = @pdfdir@ +prefix = @prefix@ +program_transform_name = @program_transform_name@ +psdir = @psdir@ +sbindir = @sbindir@ +sharedstatedir = @sharedstatedir@ +srcdir = @srcdir@ +sysconfdir = @sysconfdir@ +target_alias = @target_alias@ +top_builddir = @top_builddir@ +top_srcdir = @top_srcdir@ +noinst_LIBRARIES = libfastx.a +libfastx_a_SOURCES = chomp.c chomp.h \ + fastx.c fastx.h \ + fastx_args.c fastx_args.h \ + sequence_alignment.h sequence_alignment.cpp + +all: all-am + +.SUFFIXES: +.SUFFIXES: .c .cpp .o .obj +$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps) + @for dep in $?; do \ + case '$(am__configure_deps)' in \ + *$$dep*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh \ + && exit 0; \ + exit 1;; \ + esac; \ + done; \ + echo ' cd $(top_srcdir) && $(AUTOMAKE) --gnu src/libfastx/Makefile'; \ + cd $(top_srcdir) && \ + $(AUTOMAKE) --gnu src/libfastx/Makefile +.PRECIOUS: Makefile +Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status + @case '$?' in \ + *config.status*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \ + *) \ + echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \ + cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \ + esac; + +$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +$(top_srcdir)/configure: $(am__configure_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +$(ACLOCAL_M4): $(am__aclocal_m4_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +clean-noinstLIBRARIES: + -test -z "$(noinst_LIBRARIES)" || rm -f $(noinst_LIBRARIES) +libfastx.a: $(libfastx_a_OBJECTS) $(libfastx_a_DEPENDENCIES) + -rm -f libfastx.a + $(libfastx_a_AR) libfastx.a $(libfastx_a_OBJECTS) $(libfastx_a_LIBADD) + $(RANLIB) libfastx.a + +mostlyclean-compile: + -rm -f *.$(OBJEXT) + +distclean-compile: + -rm -f *.tab.c + +@AMDEP_TRUE@@am__include@ @am__quote@./$(DEPDIR)/chomp.Po@am__quote@ +@AMDEP_TRUE@@am__include@ @am__quote@./$(DEPDIR)/fastx.Po@am__quote@ +@AMDEP_TRUE@@am__include@ @am__quote@./$(DEPDIR)/fastx_args.Po@am__quote@ +@AMDEP_TRUE@@am__include@ @am__quote@./$(DEPDIR)/sequence_alignment.Po@am__quote@ + +.c.o: +@am__fastdepCC_TRUE@ $(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $< +@am__fastdepCC_TRUE@ mv -f $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po +@AMDEP_TRUE@@am__fastdepCC_FALSE@ source='$<' object='$@' libtool=no @AMDEPBACKSLASH@ +@AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@ +@am__fastdepCC_FALSE@ $(COMPILE) -c $< + +.c.obj: +@am__fastdepCC_TRUE@ $(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'` +@am__fastdepCC_TRUE@ mv -f $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po +@AMDEP_TRUE@@am__fastdepCC_FALSE@ source='$<' object='$@' libtool=no @AMDEPBACKSLASH@ +@AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@ +@am__fastdepCC_FALSE@ $(COMPILE) -c `$(CYGPATH_W) '$<'` + +.cpp.o: +@am__fastdepCXX_TRUE@ $(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $< +@am__fastdepCXX_TRUE@ mv -f $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po +@AMDEP_TRUE@@am__fastdepCXX_FALSE@ source='$<' object='$@' libtool=no @AMDEPBACKSLASH@ +@AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@ +@am__fastdepCXX_FALSE@ $(CXXCOMPILE) -c -o $@ $< + +.cpp.obj: +@am__fastdepCXX_TRUE@ $(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'` +@am__fastdepCXX_TRUE@ mv -f $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po +@AMDEP_TRUE@@am__fastdepCXX_FALSE@ source='$<' object='$@' libtool=no @AMDEPBACKSLASH@ +@AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@ +@am__fastdepCXX_FALSE@ $(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'` + +ID: $(HEADERS) $(SOURCES) $(LISP) $(TAGS_FILES) + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonemtpy = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + mkid -fID $$unique +tags: TAGS + +TAGS: $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + here=`pwd`; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + if test -z "$(ETAGS_ARGS)$$tags$$unique"; then :; else \ + test -n "$$unique" || unique=$$empty_fix; \ + $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \ + $$tags $$unique; \ + fi +ctags: CTAGS +CTAGS: $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + test -z "$(CTAGS_ARGS)$$tags$$unique" \ + || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \ + $$tags $$unique + +GTAGS: + here=`$(am__cd) $(top_builddir) && pwd` \ + && cd $(top_srcdir) \ + && gtags -i $(GTAGS_ARGS) $$here + +distclean-tags: + -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags + +distdir: $(DISTFILES) + @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + list='$(DISTFILES)'; \ + dist_files=`for file in $$list; do echo $$file; done | \ + sed -e "s|^$$srcdirstrip/||;t" \ + -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \ + case $$dist_files in \ + */*) $(MKDIR_P) `echo "$$dist_files" | \ + sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \ + sort -u` ;; \ + esac; \ + for file in $$dist_files; do \ + if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \ + if test -d $$d/$$file; then \ + dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \ + if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \ + cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \ + fi; \ + cp -pR $$d/$$file $(distdir)$$dir || exit 1; \ + else \ + test -f $(distdir)/$$file \ + || cp -p $$d/$$file $(distdir)/$$file \ + || exit 1; \ + fi; \ + done +check-am: all-am +check: check-am +all-am: Makefile $(LIBRARIES) +installdirs: +install: install-am +install-exec: install-exec-am +install-data: install-data-am +uninstall: uninstall-am + +install-am: all-am + @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am + +installcheck: installcheck-am +install-strip: + $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \ + install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \ + `test -z '$(STRIP)' || \ + echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install +mostlyclean-generic: + +clean-generic: + +distclean-generic: + -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES) + +maintainer-clean-generic: + @echo "This command is intended for maintainers to use" + @echo "it deletes files that may require special tools to rebuild." +clean: clean-am + +clean-am: clean-generic clean-noinstLIBRARIES mostlyclean-am + +distclean: distclean-am + -rm -rf ./$(DEPDIR) + -rm -f Makefile +distclean-am: clean-am distclean-compile distclean-generic \ + distclean-tags + +dvi: dvi-am + +dvi-am: + +html: html-am + +info: info-am + +info-am: + +install-data-am: + +install-dvi: install-dvi-am + +install-exec-am: + +install-html: install-html-am + +install-info: install-info-am + +install-man: + +install-pdf: install-pdf-am + +install-ps: install-ps-am + +installcheck-am: + +maintainer-clean: maintainer-clean-am + -rm -rf ./$(DEPDIR) + -rm -f Makefile +maintainer-clean-am: distclean-am maintainer-clean-generic + +mostlyclean: mostlyclean-am + +mostlyclean-am: mostlyclean-compile mostlyclean-generic + +pdf: pdf-am + +pdf-am: + +ps: ps-am + +ps-am: + +uninstall-am: + +.MAKE: install-am install-strip + +.PHONY: CTAGS GTAGS all all-am check check-am clean clean-generic \ + clean-noinstLIBRARIES ctags distclean distclean-compile \ + distclean-generic distclean-tags distdir dvi dvi-am html \ + html-am info info-am install install-am install-data \ + install-data-am install-dvi install-dvi-am install-exec \ + install-exec-am install-html install-html-am install-info \ + install-info-am install-man install-pdf install-pdf-am \ + install-ps install-ps-am install-strip installcheck \ + installcheck-am installdirs maintainer-clean \ + maintainer-clean-generic mostlyclean mostlyclean-compile \ + mostlyclean-generic pdf pdf-am ps ps-am tags uninstall \ + uninstall-am + +# Tell versions [3.59,3.63) of GNU make to not export all variables. +# Otherwise a system limit (for SysV at least) may be exceeded. +.NOEXPORT: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/libfastx/chomp.c --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/libfastx/chomp.c Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,46 @@ +/* + FASTX-toolkit - FASTA/FASTQ preprocessing tools. + Copyright (C) 2009 A. Gordon (gordon@cshl.edu) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU Affero General Public License as + published by the Free Software Foundation, either version 3 of the + License, or (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU Affero General Public License for more details. + + You should have received a copy of the GNU Affero General Public License + along with this program. If not, see . +*/ +#include "chomp.h" + +/* + Chomp - + Removes CR/LF from given string. + + Input - + string - NULL terminated string. + WILL BE MODIFIED! + Output - + None + + Remarks - + The first CR (ASCII 13) or LF (ASCII 10) found in the string will be replaced with a NULL - + Effectively chomping the string. +*/ +void chomp(char *string) +{ + while (*string != 0) { + if (*string==13 || *string==10) { + *string = 0 ; + return; + } + string++; + } + return ; +} + + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/libfastx/chomp.h --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/libfastx/chomp.h Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,24 @@ +/* + FASTX-toolkit - FASTA/FASTQ preprocessing tools. + Copyright (C) 2009 A. Gordon (gordon@cshl.edu) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU Affero General Public License as + published by the Free Software Foundation, either version 3 of the + License, or (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU Affero General Public License for more details. + + You should have received a copy of the GNU Affero General Public License + along with this program. If not, see . +*/ +#ifndef __CHOMP_H__ +#define __CHOMP_H__ + +void chomp(char *string); + +#endif + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/libfastx/fastx.c --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/libfastx/fastx.c Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,481 @@ +/* + FASTX-toolkit - FASTA/FASTQ preprocessing tools. + Copyright (C) 2009 A. Gordon (gordon@cshl.edu) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU Affero General Public License as + published by the Free Software Foundation, either version 3 of the + License, or (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU Affero General Public License for more details. + + You should have received a copy of the GNU Affero General Public License + along with this program. If not, see . +*/ +#include +#include +#include +#include +#include +#include +#include +#include +#include +#include + + +#include "chomp.h" +#include "fastx.h" + +/* + valid_sequence_string - + check validity of a given sequence string. + + input - + sequence - NULL terminated string to be validated. + + Output - + 1 (true) - The given sequence is valid - contained only A/C/G/N/T characters. + 0 (false) - The given string contained invalid characeters. + + Remark - + sequences with unknown (N) bases are considered VALID. +*/ +static int validate_nucleotides_string(const FASTX *pFASTX) +{ + int match = 1 ; + const char* seq = pFASTX->nucleotides; + + while (*seq != '\0' && match) { + match &= pFASTX->allowed_nucleotides[ (int) *seq ]; + seq++; + } + return match; +} + +static void create_lookup_table(FASTX *pFASTX) +{ + int i; + + for (i=0; i<256; i++) + pFASTX->allowed_nucleotides[i] = 0 ; + + pFASTX->allowed_nucleotides['A'] = 1; + pFASTX->allowed_nucleotides['C'] = 1; + pFASTX->allowed_nucleotides['G'] = 1; + pFASTX->allowed_nucleotides['T'] = 1; + + if (pFASTX->allow_N) + pFASTX->allowed_nucleotides['N'] = 1; + + if (pFASTX->allow_lowercase) { + pFASTX->allowed_nucleotides['a'] = 1; + pFASTX->allowed_nucleotides['c'] = 1; + pFASTX->allowed_nucleotides['g'] = 1; + pFASTX->allowed_nucleotides['t'] = 1; + + if (pFASTX->allow_N) + pFASTX->allowed_nucleotides['n'] = 1; + } +} + +static void detect_input_format(FASTX *pFASTX) +{ + //Get the first character in the file, + //and put it right back + int c = fgetc(pFASTX->input); + ungetc(c, pFASTX->input); + + switch(c) { + case '>': /* FASTA file */ + if ( pFASTX->allow_input_filetype==FASTQ_ONLY ) + errx(1,"input file (%s) is FASTA, but only FASTQ input is allowed.", + pFASTX->input_file_name); + pFASTX->read_fastq = 0 ; + break; + + case '@': /* FASTQ file */ + if ( pFASTX->allow_input_filetype==FASTA_ONLY ) + errx(1,"input file (%s) is FASTQ, but only FASTA input is allowed.", + pFASTX->input_file_name); + pFASTX->read_fastq = 1; + break; + + case -1: /* EOF as first character - no input */ + errx(1, "Premature End-Of-File (filename ='%s')", pFASTX->input_file_name); + break; + + default: + errx(1, "input file (%s) has unknown file format (not FASTA or FASTQ), first character = %c (%d)", + pFASTX->input_file_name, c,c); + } +} + +static void convert_ascii_quality_score_line(const char* ascii_quality_scores, FASTX *pFASTX) +{ + size_t i; + + if (strlen(ascii_quality_scores) != strlen(pFASTX->nucleotides)) + errx(1,"number of quality values (%zu) doesn't match number of nucleotides (%zu) on line %lld", + strlen(ascii_quality_scores), strlen(pFASTX->nucleotides), + pFASTX->input_line_number); + + for (i=0; iquality[i] = (int) (ascii_quality_scores[i] - 64) ; + if (pFASTX->quality[i] < -15 || pFASTX->quality[i] > 40) + errx(1, "Invalid quality score value (char '%c' ord %d quality value %d) on line %lld", + ascii_quality_scores[i], ascii_quality_scores[i], + pFASTX->quality[i], pFASTX->input_line_number ); + } + +} + +static void convert_numeric_quality_score_line ( const char* numeric_quality_line, FASTX *pFASTX ) +{ + size_t index; + const char *quality_tok; + char *endptr; + int quality_value; + + index=0; + quality_tok = numeric_quality_line; + do { + //read the quality score as an integer value + quality_value = strtol(quality_tok, &endptr, 10); + if (endptr == quality_tok) + errx(1,"Error: invalid quality score data on line %lld (quality_tok = \"%s\"", + pFASTX->input_line_number ,quality_tok); + + if (quality_value > 40 || quality_value < -15) + errx(1, "invalid quality score value (%d) in line %lld.", + quality_value, pFASTX->input_line_number); + + //convert it ASCII (as per solexa's encoding) + pFASTX->quality[index] = quality_value; + index++; + quality_tok = endptr; + } while (quality_tok != NULL && *quality_tok!='\0') ; + + if (index != strlen(pFASTX->nucleotides)) { + errx(1,"number of quality values (%zu) doesn't match number of nucleotides (%zu) on line %lld", + index, strlen(pFASTX->nucleotides), pFASTX->input_line_number ); + } +} + +void fastx_init_reader(FASTX *pFASTX, const char* filename, + ALLOWED_INPUT_FILE_TYPES allowed_input_filetype, + ALLOWED_INPUT_UNKNOWN_BASES allow_N, + ALLOWED_INPUT_CASE allow_lowercase) +{ + if (pFASTX==NULL) + errx(1,"Internal error: pFASTX==NULL (%s:%d)", __FILE__,__LINE__); + + memset(pFASTX, 0, sizeof(FASTX)); + + if (strncmp(filename,"-",5)==0) { + pFASTX->input = stdin; + } else { + pFASTX->input = fopen(filename, "r"); + if (pFASTX->input==NULL) + err(1, "failed to open input file '%s'", filename); + } + + strncpy(pFASTX->input_file_name, filename, sizeof(pFASTX->input_file_name)-1); + + pFASTX->allow_input_filetype = allowed_input_filetype; + pFASTX->allow_lowercase = allow_lowercase; + pFASTX->allow_N = allow_N; + + create_lookup_table(pFASTX); + + detect_input_format(pFASTX); +} + +int open_output_file(const char* filename) +{ + int fd ; + if (strncmp(filename,"-", 6)==0) { + fd = STDOUT_FILENO; + } else { + fd = open(filename, O_CREAT | O_WRONLY | O_TRUNC, 0666 ); + if (fd==-1) + err(1, "Failed to create output file (%s)", filename); + } + return fd; +} + +int open_output_compressor(FASTX __attribute__((unused)) *pFASTX, const char* filename) +{ + int fd; + pid_t child_pid; + int parent_pipe[2]; + if (pipe(parent_pipe)!=0) + err(1,"pipe (for gzip) failed"); + + child_pid = fork(); + if (child_pid>0) { + /* The parent process */ + fd = parent_pipe[1]; + close(parent_pipe[0]); + return fd; + } + + /* The child process */ + + //the compressor's STDIN is the pipe from the parent + dup2(parent_pipe[0], STDIN_FILENO); + close(parent_pipe[1]); + + //the compressor's STDOUT is the output file + //(which can be the parent's STDOUT, too) + fd = open_output_file(filename); + dup2(fd, STDOUT_FILENO); + + //Run GZIP + execlp("gzip","gzip",NULL); + + //Should never get here... + err(1,"execlp(gzip) failed"); +} + + +void fastx_init_writer(FASTX *pFASTX, + const char *filename, + OUTPUT_FILE_TYPE output_type, + int compress_output) +{ + int fd; + + if (pFASTX==NULL) + errx(1,"Internal error: pFASTX==NULL (%s:%d)", __FILE__,__LINE__); + if (pFASTX->input==NULL) + errx(1,"Internal error: pFASTX not initialized (%s:%d)", __FILE__, __LINE__); + + pFASTX->compress_output = compress_output; + if (pFASTX->compress_output) + fd = open_output_compressor(pFASTX, filename); + else + fd = open_output_file(filename); + + pFASTX->output = fdopen(fd,"w"); + if (pFASTX->output==NULL) + err(1,"fdopen failed"); + + switch(output_type) + { + case OUTPUT_FASTA: + pFASTX->write_fastq = 0 ; + pFASTX->output_sequence_id_prefix = '>'; + break ; + + case OUTPUT_FASTQ_ASCII_QUAL: + if (! pFASTX->read_fastq) + errx(1,"Can't output FASTQ when input is FASTA."); + pFASTX->write_fastq = 1; + pFASTX->write_fastq_ascii = 1; + pFASTX->output_sequence_id_prefix = '@'; + break ; + + case OUTPUT_FASTQ_NUMERIC_QUAL: + if (! pFASTX->read_fastq) + errx(1,"Can't output FASTQ when input is FASTA."); + pFASTX->write_fastq = 1; + pFASTX->write_fastq_ascii = 0; + pFASTX->output_sequence_id_prefix = '@'; + break ; + + case OUTPUT_SAME_AS_INPUT: + pFASTX->write_fastq = pFASTX->read_fastq; + + //Assume we're writing ASCII format, + pFASTX->write_fastq_ascii = 1 ; + //But set this flag and the real format will be determined + //when we actually read the FASTQ record + pFASTX->copy_input_fastq_format_to_output = 1; + + pFASTX->output_sequence_id_prefix = (pFASTX->write_fastq) ? '@' : '>'; + break; + + default: + errx(1, __FILE__ ":%d: Unknown output_type (%d)", + __LINE__, output_type ) ; + } +} + +int fastx_read_next_record(FASTX *pFASTX) +{ + char temp_qual[MAX_SEQ_LINE_LENGTH+1]; + + temp_qual[MAX_SEQ_LINE_LENGTH] = 0; + + if (pFASTX==NULL) + errx(1,"Internal error: pFASTX==NULL (%s:%d)", __FILE__,__LINE__); + + if (fgets(pFASTX->input_sequence_id_prefix, MAX_SEQ_LINE_LENGTH, pFASTX->input) == NULL) + return 0; //assume end-of-file, if we couldn't read the first line of the foursome + + //for the rest of the lines, if they don't appear, it's an error + pFASTX->input_line_number++; + + if (fgets(pFASTX->nucleotides, MAX_SEQ_LINE_LENGTH, pFASTX->input) == NULL) + errx(1,"Failed to read complete record, missing 2nd line (nucleotides), on line %lld\n", + pFASTX->input_line_number); + + chomp(pFASTX->name); + chomp(pFASTX->nucleotides); + + validate_nucleotides_string(pFASTX); + + if (pFASTX->read_fastq) { + pFASTX->input_line_number++; + if (fgets(pFASTX->input_name2_prefix, MAX_SEQ_LINE_LENGTH, pFASTX->input) == NULL) + errx(1,"Failed to read complete record, missing 3rd line (name-2), on line %lld\n", + pFASTX->input_line_number); + + pFASTX->input_line_number++; + if (fgets(temp_qual, sizeof(temp_qual), pFASTX->input) == NULL) + errx(1,"Failed to read complete record, missing 4th line (quality), on line %lld\n", + pFASTX->input_line_number); + + chomp(pFASTX->name2); + chomp(temp_qual); + + if (strlen(temp_qual) == strlen(pFASTX->nucleotides)) { + //Assume this is an ASCII quality score line, convert it to values + convert_ascii_quality_score_line ( temp_qual, pFASTX ) ; + pFASTX->read_fastq_ascii = 1 ; + } else { + //Assume this is a numeric quality score line, convert it to values + convert_numeric_quality_score_line ( temp_qual, pFASTX ) ; + pFASTX->read_fastq_ascii = 0 ; + } + + //Copy the input format to the output format flag + if (pFASTX->copy_input_fastq_format_to_output) { + pFASTX->write_fastq_ascii = pFASTX->read_fastq_ascii; + } + + + } + + pFASTX->num_input_sequences++; + pFASTX->num_input_reads += get_reads_count(pFASTX); + + return 1; +} + +static void write_ascii_qual_string(FASTX *pFASTX, int length) +{ + int i; + int rc; + + for (i=0; ioutput, "%c", pFASTX->quality[i] + 64 ) ; + if (rc<=0) + err(1,"writing quality scores failed"); + } + rc = fprintf(pFASTX->output, "\n"); + if (rc<=0) + err(1,"writing quality scores failed"); +} + +static void write_numeric_qual_string(FASTX *pFASTX, int length) +{ + int i; + int rc; + for (i=0; ioutput, "%d", pFASTX->quality[i] ) ; + if (rc<=0) + err(1,"writing quality scores failed"); + if (ioutput," "); + if (rc<=0) + err(1,"writing quality scores failed"); + } + } + rc = fprintf(pFASTX->output, "\n"); + if (rc<=0) + err(1,"writing quality scores failed"); +} + +void fastx_write_record(FASTX *pFASTX) +{ + int len; + int rc; + + if (pFASTX==NULL) + errx(1,"Internal error: pFASTX==NULL (%s:%d)", __FILE__,__LINE__); + + + rc = fprintf(pFASTX->output, "%c%s\n", + pFASTX->output_sequence_id_prefix, + pFASTX->name ) ; + if (rc<=0) + err(1,"writing sequence identifier failed"); + + rc = fprintf(pFASTX->output, "%s\n", pFASTX->nucleotides); + if (rc<=0) + err(1,"writing nucleotides failed"); + + if (pFASTX->write_fastq) { + rc = fprintf(pFASTX->output, "+%s\n", pFASTX->name2 ) ; + if (rc<=0) + err(1,"writing 2nd sequence identifier failed"); + + len = strlen(pFASTX->nucleotides); + if (pFASTX->write_fastq_ascii) + write_ascii_qual_string(pFASTX, len); + else + write_numeric_qual_string(pFASTX, len); + } + + pFASTX->num_output_sequences++; + pFASTX->num_output_reads += get_reads_count(pFASTX); +} + +int get_reads_count(const FASTX *pFASTX) +{ + char *dash = NULL ; + + //FASTQ files are never collapsed (at least not in Gordon's Galaxy) + if (pFASTX->read_fastq) + return 1; + + dash = strchr(pFASTX->name,'-'); + + // minus character wasn't found- + // this sequence is most probably not collapsed + if (dash==NULL) + return 1; + + int count = atoi(dash+1); + if (count>0) + return count; + + return 1; +} + +size_t num_input_sequences(const FASTX *pFASTX) +{ + return pFASTX->num_input_sequences; +} + +size_t num_input_reads(const FASTX *pFASTX) +{ + return pFASTX->num_input_reads; +} + +size_t num_output_sequences(const FASTX *pFASTX) +{ + return pFASTX->num_output_sequences; +} + +size_t num_output_reads(const FASTX *pFASTX) +{ + return pFASTX->num_output_reads; +} + + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/libfastx/fastx.h --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/libfastx/fastx.h Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,136 @@ +/* + FASTX-toolkit - FASTA/FASTQ preprocessing tools. + Copyright (C) 2009 A. Gordon (gordon@cshl.edu) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU Affero General Public License as + published by the Free Software Foundation, either version 3 of the + License, or (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU Affero General Public License for more details. + + You should have received a copy of the GNU Affero General Public License + along with this program. If not, see . +*/ +#ifndef __FASTX_HEADER__ +#define __FASTX_HEADER__ + +#ifdef __cplusplus +extern "C" { +#endif + +#ifndef PATH_MAX +#include +#endif + +#define MIN_QUALITY_VALUE (-50) +#define MAX_QUALITY_VALUE 50 +#define QUALITY_VALUES_RANGE (MAX_QUALITY_VALUE-MIN_QUALITY_VALUE) + + +#ifndef MAX_SEQ_LINE_LENGTH +#define MAX_SEQ_LINE_LENGTH (25000) +#endif + +typedef enum { + FASTA_ONLY=0, + FASTA_OR_FASTQ=1, + FASTQ_ONLY=2 +} ALLOWED_INPUT_FILE_TYPES; + +typedef enum { + DISALLOW_N=0, + ALLOW_N=1 +} ALLOWED_INPUT_UNKNOWN_BASES; + +typedef enum { + REQUIRE_UPPERCASE=0, + ALLOW_LOWERCASE=1 +} ALLOWED_INPUT_CASE; + +typedef enum { + OUTPUT_FASTA=0, + OUTPUT_FASTQ_ASCII_QUAL=1, + OUTPUT_FASTQ_NUMERIC_QUAL=2, + OUTPUT_SAME_AS_INPUT=3 +} OUTPUT_FILE_TYPE; + +#pragma pack(1) +typedef struct +{ + /* Record data - common for FASTA/FASTQ */ + char input_sequence_id_prefix[1]; //DON'T touch this - this hack will read the entire name into the variable 'name', + //leaving the prefix ('>' or '@') in 'input_sequence_id_name'. + char name[MAX_SEQ_LINE_LENGTH+1]; + char nucleotides[MAX_SEQ_LINE_LENGTH+1]; + /* Record data - only for FASTQ */ + char input_name2_prefix[1]; //same hack as 'input_sequence_id_prefix' + char name2[MAX_SEQ_LINE_LENGTH+1]; + int quality[MAX_SEQ_LINE_LENGTH+1]; //note: this is NOT ascii values, but numerical values + // numeric quality scores and ASCII quality scores + // are automatically converted to numbers (-15 to 40) + + /* Configuration */ + int allow_input_filetype; // 0 = Allow only FASTA + int allow_N; // 1 = N is valid nucleotide, 0 = only A/G/C/T are valid + int allow_lowercase; + int read_fastq; // 1 = Input is FASTQ (only if allow_input_fastq==1) + int read_fastq_ascii; // 1 = Input is FASTQ with ASCII quality scores (0 = with numeric quality scores) + int write_fastq; // 0 = Write only FASTA (regardless of input type) + int write_fastq_ascii; // 1 = Write ASCII quality scores, 0 = write numeric quality scores + int compress_output; // 1 = pass output through GZIP + + int copy_input_fastq_format_to_output ; // 1 = copy 'read_fastq_ascii' to 'write_fastq_ascii' + // so that the output format is the same as the input + + + /* Internal data */ + int allowed_nucleotides[256]; //quick lookup table for valid input + char output_sequence_id_prefix; // '>' or '@', depending on the requested output type + + char input_file_name[PATH_MAX]; //in linux, PATH_MAX is defined in + unsigned long long input_line_number; + char output_file_name[PATH_MAX]; //in linux, PATH_MAX is defined in + + size_t num_input_sequences; + size_t num_output_sequences; + size_t num_input_reads; + size_t num_output_reads; + + FILE* input; + FILE* output; +} FASTX ; + + +void fastx_init_reader(FASTX *pFASTX, const char* filename, + ALLOWED_INPUT_FILE_TYPES allowed_input_filetype, + ALLOWED_INPUT_UNKNOWN_BASES allow_N, + ALLOWED_INPUT_CASE allow_lowercase); + +// If the sequence identifier is collapsed (= "N-N") returns the reads_count, +// otherwise, returns 1 +int get_reads_count(const FASTX *pFASTX); + +void fastx_init_writer(FASTX *pFASTX, + const char* filename, + OUTPUT_FILE_TYPE output_type, + int compress_output); + +int fastx_read_next_record(FASTX *pFASTX); + +void fastx_write_record(FASTX *pFASTX); + +size_t num_input_sequences(const FASTX *pFASTX); +size_t num_input_reads(const FASTX *pFASTX); +size_t num_output_sequences(const FASTX *pFASTX); +size_t num_output_reads(const FASTX *pFASTX); + +#ifdef __cplusplus +} +#endif + +#endif + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/libfastx/fastx_args.c --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/libfastx/fastx_args.c Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,132 @@ +/* + FASTX-toolkit - FASTA/FASTQ preprocessing tools. + Copyright (C) 2009 A. Gordon (gordon@cshl.edu) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU Affero General Public License as + published by the Free Software Foundation, either version 3 of the + License, or (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU Affero General Public License for more details. + + You should have received a copy of the GNU Affero General Public License + along with this program. If not, see . +*/ +#include +#include +#include +#include +#include +#include +#include + +#include "fastx_args.h" + +/* + * Each program should specify its own usage string + */ +extern char* usage; + + +/* + * globals.. yuck + * + * some day this will be a stand alone class + */ +const char* input_filename = "-"; +const char* output_filename = "-"; +int verbose = 0; +int compress_output = 0 ; +FILE* report_file; + +const char* get_input_filename() +{ + return input_filename; +} + +const char* get_output_filename() +{ + return output_filename; +} + +int verbose_flag() +{ + return verbose; +} + +int compress_output_flag() +{ + return compress_output ; +} + +FILE* get_report_file() +{ + return report_file; +} + +int fastx_parse_cmdline( int argc, char* argv[], + const char* program_options, + parse_argument_func program_parse_args ) +{ + int opt; + + char combined_options_string[100]; + + strcpy(combined_options_string, "zhvi:o:"); + strcat(combined_options_string, program_options); + + report_file = stderr ; //since the default output is STDOUT, the report goes by default to STDERR + + while ( (opt = getopt(argc, argv, combined_options_string) ) != -1 ) { + + // Parse the program's custom options + if ( strchr(program_options, opt) != NULL ) { + if (!program_parse_args(optind, opt, optarg)) + return 0; + continue; + } + + //Parse the default options + switch(opt) { + case 'h': + printf("%s", usage); + exit(1); + + case 'v': + verbose = 1 ; + break ; + + case 'z': + compress_output = 1 ; + break ; + + + case 'i': + if (optarg==NULL) + errx(1,"[-i] option requires FILENAME argument"); + input_filename = optarg; + break; + + case 'o': + if (optarg==NULL) + errx(1,"[-o] option requires FILENAME argument"); + output_filename = optarg; + + //The user specified a specific output file, so the report can go to STDOUT + report_file = stdout; + break; + + default: + printf("use '-h' for usage information.\n"); + exit(1); + break; + + } + } + + return 1; +} + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/libfastx/fastx_args.h --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/libfastx/fastx_args.h Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,45 @@ +/* + FASTX-toolkit - FASTA/FASTQ preprocessing tools. + Copyright (C) 2009 A. Gordon (gordon@cshl.edu) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU Affero General Public License as + published by the Free Software Foundation, either version 3 of the + License, or (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU Affero General Public License for more details. + + You should have received a copy of the GNU Affero General Public License + along with this program. If not, see . +*/ +#ifndef __FASTX_ARGS__ +#define __FASTX_ARGS__ + +#ifdef __cplusplus +extern "C" { +#endif + +//One day this would all be OO :-) + +const char* get_input_filename(); +const char* get_output_filename(); +int verbose_flag(); +int compress_output_flag(); +FILE* get_report_file(); + +typedef int (*parse_argument_func)(int optind, int optc, char* optarg) ; + +int fastx_parse_cmdline( int argc, char* argv[], + const char* program_options, + parse_argument_func program_parse_arg ) ; + + +#ifdef __cplusplus +} +#endif + +#endif + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/libfastx/sequence_alignment.cpp --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/libfastx/sequence_alignment.cpp Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,710 @@ +#include +#include +#include +#include +#include +#include +#include + +#include "sequence_alignment.h" + +using namespace std; + +void SequenceAlignmentResults::print(std::ostream& strm) const +{ + size_t delta; + size_t index; + + strm << "Query-Alingment = " << query_alignment << endl ; + strm << "target-Alingment= " << target_alignment << endl ; + + + strm << (alignment_found ? "Alignment Found" : "Alignment NOT found") << endl; + strm << "Score = " << score << " (" + << matches << " matches, " + << neutral_matches << " neutral-matches, " + << mismatches << " mismatches, " + << gaps << " gaps) " + << std::endl ; + + strm << "Query = " << query_sequence + << "(qsize " << query_size + << " qstart " << query_start + << " qend " << query_end + << std::endl ; + + strm << "Target= " << target_sequence + << "(tsize " << target_size + << " tstart " << target_start + << " tend " << target_end + << std::endl ; + + strm << endl; + + delta = max(target_start, query_start); + + + //Spaces before the query string + if ( delta - query_start > 0 ) + strm << std::string( delta - query_start-1, ' ') ; + //Un-Aligned query part (prefix) + if ( query_start > 0 ) + strm << query_sequence.substr(0, query_start-1) ; + //Aligned query part + strm << "(" << query_alignment << ")"; + //Un-Aligned query part (suffix) + if ( query_end < query_sequence.length() ) + strm << query_sequence.substr( query_end+1 ) ; + strm << std::endl ; + + //Alignment bars + if ( delta > 0 ) + strm << std::string( delta-1, ' ') ; + strm << "(" ; + for (index=0; index 0 ) + strm << std::string( delta - target_start, ' ') ; + //Un-Aligned target part (prefix) + if ( target_start > 0 ) + strm << target_sequence.substr(0, target_start-1); + //Aligned target part + strm << "(" << target_alignment << ")"; + + //Un-Aligned target part (suffix) + if ( target_end < target_sequence.length() ) + strm << target_sequence.substr( target_end+1 ); + strm << std::endl; + +} + +SequenceAlignment::SequenceAlignment ( ) : + _gap_panelty(-5), + _match_panelty(1), + _mismatch_panelty(-1), + _neutral_panelty(0.1) + +{ +} + + +void SequenceAlignment::set_sequences(const std::string& _query, const std::string& _target) +{ + _query_sequence = _query ; + _target_sequence = _target ; +} + +void SequenceAlignment::reset_alignment_results() +{ + _alignment_results = SequenceAlignmentResults() ; + // + //Reset the results + _alignment_results.query_sequence = query_sequence() ; + _alignment_results.target_sequence = target_sequence() ; +} + +const SequenceAlignmentResults& SequenceAlignment::align ( const std::string& query, const std::string& target ) +{ + set_sequences ( query, target ) ; + + reset_alignment_results(); + + resize_matrix ( query_sequence().length(), target_sequence().length() ) ; + populate_match_matrix(); + + reset_matrix( matrix_width(), matrix_height() ); + populate_matrix(); + find_optimal_alignment(); + + post_process(); + + return _alignment_results; +} + +void SequenceAlignment::resize_matrix(size_t width, size_t height) +{ + size_t i; + + if ( matrix_width() >= width && matrix_height() >= height ) + return ; + + query_border.resize ( width ) ; + target_border.resize ( height ) ; + + score_matrix.resize ( width ); + for (i=0;i0) ? score : 0 ; + + //NOTE + // not sure ">=" is strictly correct SW (might be just ">") + if ( score > highest_score ) { + highest_scored_query_index = query_index ; + highest_scored_target_index = target_index ; + highest_score = score ; + } + } + + } +} + +void LocalSequenceAlignment::find_optimal_alignment ( ) +{ + size_t query_index = highest_scored_query_index ; + size_t target_index = highest_scored_target_index; + + _alignment_results.query_end = query_index-1 ; + _alignment_results.target_end= target_index-1 ; + + _alignment_results.score = score_matrix[query_index][target_index]; + + _alignment_results.matches = 0 ; + _alignment_results.mismatches = 0 ; + + while ( query_index > 0 || target_index > 0 ) { + if ( score_matrix[query_index][target_index]==0) + break ; + + //go "left" in the matrix + if ( query_index>0 && + score_matrix[query_index][target_index] == score_matrix[query_index-1][target_index] + gap_panelty() ) { + + _alignment_results.target_alignment += "-" ; + _alignment_results.query_alignment += query_sequence()[query_index-1] ; + query_index--; + } + else + //go "up-left" in the matrix + if ( query_index>0 && target_index>0 && + score_matrix[query_index][target_index] == + score_matrix[query_index-1][target_index-1] + match_score(query_index, target_index) ) { + + _alignment_results.target_alignment += target_sequence()[target_index-1]; + _alignment_results.query_alignment += query_sequence()[query_index-1] ; + + (query_sequence()[query_index-1] == target_sequence()[target_index-1]) ? + (++_alignment_results.matches) : (++_alignment_results.mismatches) ; + + query_index--; + target_index--; + } + else + //go "up" in the matrix + { + _alignment_results.target_alignment += target_sequence()[target_index-1]; + _alignment_results.query_alignment += "-" ; + target_index--; + } + } + + _alignment_results.query_start = query_index ; + _alignment_results.target_start= target_index ; + + _alignment_results.query_size = query_sequence().length(); + _alignment_results.target_size= target_sequence().length(); + + std::reverse(_alignment_results.target_alignment.begin(), _alignment_results.target_alignment.end()); + std::reverse(_alignment_results.query_alignment.begin(), _alignment_results.query_alignment.end()); +} +#endif + +void HalfLocalSequenceAlignment::set_sequences(const std::string& _query, const std::string& _target) +{ + //_query_sequence = _query + std::string( _target.length(), 'N' ); + //_target_sequence = std::string( _query.length(), 'N' ) + _target; + _query_sequence = _query ; + _target_sequence = _target ; +} + + +void HalfLocalSequenceAlignment::reset_matrix( size_t width, size_t height ) +{ + size_t x,y ; + + highest_scored_query_index = 0 ; + highest_scored_target_index = 0 ; + + for (x=0; x3 && target_index-3 > query_index ) { + left_score = -100000 ; + } + + //printf("query_index=%d, target_index=%d, upscore=%f, left_score=%f, upleft_score=%f\n", + // query_index, target_index, up_score,left_score,upleft_score ); + + score_type score = -100000000 ; + + if ( upleft_score > score ) { + score = upleft_score ; + origin = FROM_UPPER_LEFT; + } + if ( up_score > score ) { + score = up_score ; + origin = FROM_UPPER ; + } + if ( left_score > score ) { + score = left_score ; + origin = FROM_LEFT ; + } + //printf("query_index=%d, target_index=%d, score=%f origin=%d\n", + // query_index, target_index, score, origin ); + + /*if (score<0) { + score = 0 ; + origin = FROM_NOWHERE ; + }*/ + + score_matrix[query_index][target_index] = score ; + origin_matrix[query_index][target_index] = origin ; + + //NOTE + // not sure ">=" is strictly correct SW (might be just ">") + if ( score > highest_score ) { + highest_scored_query_index = query_index ; + highest_scored_target_index = target_index ; + highest_score = score ; + } + } + } +} + +bool HalfLocalSequenceAlignment::starting_point_close_to_end_of_sequences(const size_t query_index, const size_t target_index) const +{ + if ( (size_t)query_index >= query_sequence().length() - 2 || + (size_t)target_index >= target_sequence().length() - 2 ) { + /* We've reach either the end of the Adapter + * (and the adapter is shorter than the query) + * Or the end of the query + * (and the adapter covers up to the end of the query, and then continues on) + * + * So we can safely start the alignment from this point + */ + return true; + } + else { + /* The adapter is not covering the query until the end. + */ + return false; + } +} + +#undef DEBUG_STARTING_POINT +void HalfLocalSequenceAlignment::find_alignment_starting_point(ssize_t &new_query_index, ssize_t &new_target_index) const +{ + /* + * Force the alignment to start from the end of the query, + * find the best score at the end of the query + * + * Try (desperately) to find a match that starts at the end of the query or the end of the target/adapter) + */ + score_type max_score = score( matrix_width()-1, matrix_height()-1 ) ; + for ( size_t q_index = 0 ; q_index < matrix_width(); q_index++ ) { + for ( size_t t_index = matrix_height()-2 ; t_index < matrix_height(); t_index++ ) { + if ( origin ( q_index, t_index ) > 0 && + safe_score ( q_index, t_index ) > max_score ) { + max_score = safe_score ( q_index, t_index ) ; + #ifdef DEBUG_STARTING_POINT + printf("Found new max score = %f at %d,%d\n", max_score, q_index, t_index ) ; + #endif + new_target_index = t_index ; + new_query_index = q_index ; + } + } + } + for ( size_t q_index = matrix_width()-2 ; q_index < matrix_width(); q_index++ ) { + for ( size_t t_index = 0 ; t_index < matrix_height(); t_index++ ) { + if ( origin ( q_index, t_index ) > 0 && + safe_score ( q_index, t_index ) > max_score ) { + max_score = safe_score ( q_index, t_index ) ; + #ifdef DEBUG_STARTING_POINT + printf("Found new max score = %f at %d,%d\n", max_score, q_index, t_index ) ; + #endif + new_target_index = t_index ; + new_query_index = q_index ; + } + } + } + #ifdef DEBUG_STARTING_POINT + printf("Forcing alignment from query_index=%d, target_index=%d, score=%f, origin=%d\n", + new_query_index, new_target_index, + score ( new_query_index, new_target_index ), + origin ( new_query_index, new_target_index ) ); + #endif +} + + +#undef DEBUG_FIND_OPTIMAL_ALIGNMENT +SequenceAlignmentResults HalfLocalSequenceAlignment::find_optimal_alignment_from_point ( const size_t query_start, const size_t target_start ) const +{ + SequenceAlignmentResults results; + + results.query_sequence = query_sequence(); + results.target_sequence= target_sequence(); + + ssize_t query_index = query_start; + ssize_t target_index = target_start ; + + results.query_end = query_index ; + results.target_end= target_index ; + + #ifdef DEBUG_FIND_OPTIMAL_ALIGNMENT + printf ( "backtrace starting from (qindex=%d, tindex=%d, score=%f)\n", + query_index, target_index, score_matrix[query_index][target_index]) ; + #endif + + while ( query_index >= 0 && target_index >= 0 ) { + + const char q_nuc = query_nucleotide(query_index); + const char t_nuc = target_nucleotide(target_index); + + const DIRECTION current_origin = origin(query_index, target_index); + const char current_match = match ( query_index, target_index ) ; + + + #ifdef DEBUG_FIND_OPTIMAL_ALIGNMENT + const score_type current_score = score(query_index, target_index); + printf("query_index=%d target_index=%d query=%c target=%c score_matrix=%3.1f origin=%d accumulated_score = %3.2f\n", + query_index, target_index, + q_nuc, t_nuc, + current_score, + current_origin, + results.score) ; + #endif + + results.query_start = query_index ; + results.target_start= target_index ; + + switch ( current_origin ) + { + case FROM_LEFT: + results.target_alignment += "-" ; + results.query_alignment += q_nuc ; + results.gaps++; + results.score += gap_panelty(); + + query_index--; + break ; + + case FROM_UPPER_LEFT: + results.target_alignment += t_nuc; + results.query_alignment += q_nuc ; + + switch ( current_match ) + { + case 'N': + results.neutral_matches++ ; + results.score += neutral_panelty(); + break ; + + case 'M': + results.matches++; + results.score += match_panelty(); + break; + + case 'x': + results.mismatches++; + results.score += mismatch_panelty(); + break ; + + default: + errx(1,"Internal error: unknown match type (%c) at query_index=%zu, target_index=%zu\n", + current_match, query_index, target_index ) ; + } + + query_index--; + target_index--; + break ; + + case FROM_UPPER: + results.target_alignment += t_nuc ; + results.query_alignment += "-" ; + results.gaps++; + results.score += gap_panelty(); + + target_index--; + break; + + case FROM_NOWHERE: + default: + print_matrix(); + printf("Invalid origin (%d) at query_index=%zu, target_index=%zu\n", + current_origin, query_index, target_index ) ; + printf("Query = %s\n", query_sequence().c_str()); + printf("Target= %s\n", target_sequence().c_str()); + exit(1); + } + } + + results.query_size = query_sequence().length(); + results.target_size= target_sequence().length(); + + std::reverse(results.target_alignment.begin(),results.target_alignment.end()); + std::reverse(results.query_alignment.begin(), results.query_alignment.end()); + + return results; +} + +void HalfLocalSequenceAlignment::find_optimal_alignment ( ) +{ + SequenceAlignmentResults results ; + + + //Try to find a good alignment, + //starting from the highest score cell. + results = find_optimal_alignment_from_point ( highest_scored_query_index, + highest_scored_target_index ) ; + + //Some heuristics: + //If the adapter matched 7 nucleotides anywhere in the query + //without mismatches/gaps, accept it. + if ( results.matches >= 7 + && + results.mismatches == 0 + && + results.gaps == 0 ) { + + _alignment_results = results ; + return ; + } + + if ( starting_point_close_to_end_of_sequences ( highest_scored_query_index, + highest_scored_target_index ) ) { + //We're already very close to the end of the target or query, + //can't improve much else, so return what we've got. + _alignment_results = results ; + return ; + } + + + //More heuristics: + /* The adapter is not covering the query until the end. + * Force the alignment to start from the end of the query, + * find the best score at the end of the query + * + * Try (desperately) to find a match that starts at the end of the query or the end of the target/adapter) + */ + ssize_t query_index = highest_scored_query_index ; + ssize_t target_index = highest_scored_target_index; + find_alignment_starting_point ( query_index, target_index ) ; + + _alignment_results = results ; +} + +void HalfLocalSequenceAlignment::post_process() +{ +#if 0 + //Removes the Ns which were added in 'set_sequences' + //And adjust the results values accordingly + + //return ; + //_query_sequence.erase ( _query_sequence.find_last_not_of('N') + 1) ; + //_target_sequence.erase ( 0, _target_sequence.find_first_not_of('N') ) ; + + _alignment_results.query_sequence.erase ( _query_sequence.find_last_not_of('N') + 1) ; + _alignment_results.target_sequence.erase ( 0, _target_sequence.find_first_not_of('N') ) ; + _alignment_results.query_size = _alignment_results.query_sequence.length(); + _alignment_results.target_size = _alignment_results.target_sequence.length(); + + + size_t query_n_position = _alignment_results.query_alignment.find_last_not_of('N') ; + int query_n_count; + + if ( query_n_position != string::npos ) + query_n_count = _alignment_results.query_alignment.length() - query_n_position ; + else + query_n_count = 0 ; + + int target_n_count = _alignment_results.target_alignment.find_first_not_of('N') ; + + if (query_n_position != string::npos ) + _alignment_results.query_alignment.erase( query_n_position ) ; + _alignment_results.target_alignment.erase( 0,target_n_count ) ; + + //Update Results strucure + _alignment_results.query_start+= target_n_count ; + _alignment_results.query_end -= query_n_count ; + + _alignment_results.target_start = 0; + _alignment_results.target_end = _alignment_results.query_end - _alignment_results.query_start ; + + _alignment_results.query_alignment.erase ( 0, _alignment_results.query_start ) ; + _alignment_results.target_alignment.erase ( _alignment_results.target_end+1 ) ; + + //Update match/mismatch/gap counts + _alignment_results.matches = 0 ; + _alignment_results.mismatches = 0 ; + _alignment_results.gaps = 0 ; + + for (size_t index=0; index<_alignment_results.query_alignment.length(); index++) { + char q = _alignment_results.query_alignment[index]; + char t = _alignment_results.target_alignment[index]; + + if ( q == '-' || t=='-' ) { + _alignment_results.gaps ++ ; + } else { + if ( q== t ) + _alignment_results.matches++; + else + _alignment_results.mismatches++; + } + } +#endif +} + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/libfastx/sequence_alignment.h --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/libfastx/sequence_alignment.h Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,250 @@ +/* + FASTX-toolkit - FASTA/FASTQ preprocessing tools. + Copyright (C) 2009 A. Gordon (gordon@cshl.edu) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU Affero General Public License as + published by the Free Software Foundation, either version 3 of the + License, or (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU Affero General Public License for more details. + + You should have received a copy of the GNU Affero General Public License + along with this program. If not, see . +*/ +#ifndef __SEQUENCE_ALIGNMENT_HEADER__ +#define __SEQUENCE_ALIGNMENT_HEADER__ + +#include + +struct SequenceAlignmentResults +{ + int alignment_found ; + + size_t query_size ; + size_t query_start ; + size_t query_end ; + + size_t target_size ; + size_t target_start ; + size_t target_end ; + + size_t gaps; + size_t neutral_matches ; + size_t matches ; + size_t mismatches ; + + float score ; + + std::string query_alignment ; + std::string target_alignment ; + + std::string query_sequence ; + std::string target_sequence ; + + SequenceAlignmentResults() : + alignment_found(false), + query_size(0), + query_start(0), + query_end(0), + + target_size(0), + target_start(0), + target_end(0), + + gaps(0), + neutral_matches(0), + matches(0), + mismatches(0), + + score(0) + { + } + + void print( std::ostream& ostrm = std::cout ) const; + + virtual ~SequenceAlignmentResults() {} +} ; + + +class SequenceAlignment +{ +protected: + typedef float score_type; + + typedef enum { + FROM_UPPER = 1, + FROM_LEFT = 2, + FROM_UPPER_LEFT = 3, + FROM_NOWHERE = 4 + //STOP_MARKER = 5 + } DIRECTION ; + + std::vector < score_type > query_border ; + std::vector < score_type > target_border ; + + std::vector< std::vector< score_type > > score_matrix ; + std::vector< std::vector< DIRECTION > > origin_matrix ; + std::vector< std::vector< char > > match_matrix ; + + score_type _gap_panelty ; + score_type _match_panelty ; + score_type _mismatch_panelty ; + score_type _neutral_panelty ; + + + SequenceAlignmentResults _alignment_results ; + + std::string _query_sequence; + std::string _target_sequence; + +public: + SequenceAlignment ( ) ; + virtual ~SequenceAlignment() {} + + size_t matrix_width() const { return score_matrix.size(); } + size_t matrix_height() const { return score_matrix[0].size(); } + + score_type gap_panelty() const { return _gap_panelty ; } + score_type match_panelty() const { return _match_panelty ; } + score_type mismatch_panelty() const { return _mismatch_panelty ; } + score_type neutral_panelty() const { return _neutral_panelty ; } + + const std::string& query_sequence() const { return _query_sequence; } + const std::string& target_sequence() const { return _target_sequence; } + + char query_nucleotide(size_t query_index) const { return _query_sequence[query_index] ; } + char target_nucleotide(size_t target_index) const { return _target_sequence[target_index] ; } + + const SequenceAlignmentResults& results() const { return _alignment_results; } + + char match_value ( const char q, const char t ) const + { + if ( q=='N' || t=='N' ) + return 'N' ; + + return ( q==t ) ? 'M' : 'x' ; + } + + char match ( const size_t query_index, const size_t target_index) const + { + return match_matrix[query_index][target_index]; + } + DIRECTION origin ( const size_t query_index, const size_t target_index) const + { + return origin_matrix[query_index][target_index]; + } + + score_type score ( const size_t query_index, const size_t target_index) const + { + return score_matrix[query_index][target_index]; + } + + score_type safe_score ( const ssize_t query_index, const ssize_t target_index) const + { + if (query_index==-1) + return target_border[target_index]; + if (target_index==-1) + return query_border[query_index]; + + return score_matrix[query_index][target_index]; + } + + score_type nucleotide_match_score(const size_t query_index, const size_t target_index) const + { + char q = query_nucleotide(query_index); + char t = target_nucleotide(target_index); + + if ( q=='N' && t=='N' ) + return 0.0 ; + + if ( q=='N' || t=='N' ) + return neutral_panelty() ; + + return ( q==t ) ? match_panelty() : mismatch_panelty() ; + } + + void print_matrix(std::ostream& strm = std::cout) const; + + #if 0 + score_type calculate_alignment_score(const size_t query_index, const size_t target_index) const + { + score_type score = -100000000; + + /* + score_type + + //Score from the left-cell + if ( query_index > 0 ) + if ( (score(query_index-1,target_index) + gap_panelty()) > score) + score = score_matrix[query_index-1][target_index] + gap_panelty(); + + //Score from the upper-cell + if ( target_index > 0 ) + if ((score_matrix[query_index][target_index-1] + gap_panelty()) > score) + score = score_matrix[query_index][target_index-1] + gap_panelty(); + + //Score from the upper-left-cell + if ( target_index>0 && query_index> 0) { + if (score_matrix[query_index-1][target_index-1] + match_score(query_index,target_index) > score) + score = score_matrix[query_index-1][target_index-1] + match_score(query_index,target_index) ; + }*/ + return score; + + } + #endif + + const SequenceAlignmentResults& align ( const std::string& query, const std::string& target ) ; + +protected: + void resize_matrix(size_t width, size_t height); + void populate_match_matrix(); + + virtual void reset_alignment_results() ; + + virtual void set_sequences ( const std::string& _query, const std::string &target ) ; + virtual void reset_matrix( size_t width, size_t height ) = 0 ; + virtual void populate_matrix ( ) = 0; + virtual void find_optimal_alignment ( ) = 0 ; + virtual void post_process() ; +} ; + +#if 0 +class LocalSequenceAlignment : public SequenceAlignment +{ +protected: + size_t highest_scored_query_index ; + size_t highest_scored_target_index ; + +public: + virtual void reset_matrix( size_t width, size_t height ) ; + virtual void populate_matrix ( ) ; + virtual void find_optimal_alignment ( ) ; +}; +#endif + + +class HalfLocalSequenceAlignment : public SequenceAlignment +{ +protected: + size_t highest_scored_query_index ; + size_t highest_scored_target_index ; + +public: + virtual void set_sequences ( const std::string& _query, const std::string &target ) ; + virtual void reset_matrix( size_t width, size_t height ) ; + virtual void populate_matrix ( ) ; + virtual void find_optimal_alignment ( ) ; + virtual void post_process() ; + + bool starting_point_close_to_end_of_sequences(const size_t query_index, const size_t target_index) const; + void find_alignment_starting_point(ssize_t &new_query_index, ssize_t &new_target_index) const; + + SequenceAlignmentResults find_optimal_alignment_from_point ( const size_t query_start, const size_t target_start ) const ; +}; + +#endif + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/seqalign_test/Makefile.am --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/seqalign_test/Makefile.am Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,21 @@ +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + + +noinst_PROGRAMS = seqalign_test + +AM_CPPFLAGS = \ + $(CC_WARNINGS) \ + -I../libfastx + +seqalign_test_SOURCES = seqalign_test.cpp + +seqalign_test_LDADD = ../libfastx/libfastx.a + diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/seqalign_test/Makefile.in --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/seqalign_test/Makefile.in Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,414 @@ +# Makefile.in generated by automake 1.10.1 from Makefile.am. +# @configure_input@ + +# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, +# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc. +# This Makefile.in is free software; the Free Software Foundation +# gives unlimited permission to copy and/or distribute it, +# with or without modifications, as long as this notice is preserved. + +# This program is distributed in the hope that it will be useful, +# but WITHOUT ANY WARRANTY, to the extent permitted by law; without +# even the implied warranty of MERCHANTABILITY or FITNESS FOR A +# PARTICULAR PURPOSE. + +@SET_MAKE@ + +# Copyright (C) 2008 Assaf Gordon +# +# This file is free software; as a special exception the author gives +# unlimited permission to copy and/or distribute it, with or without +# modifications, as long as this notice is preserved. +# +# This program is distributed in the hope that it will be useful, but +# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the +# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +VPATH = @srcdir@ +pkgdatadir = $(datadir)/@PACKAGE@ +pkglibdir = $(libdir)/@PACKAGE@ +pkgincludedir = $(includedir)/@PACKAGE@ +am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd +install_sh_DATA = $(install_sh) -c -m 644 +install_sh_PROGRAM = $(install_sh) -c +install_sh_SCRIPT = $(install_sh) -c +INSTALL_HEADER = $(INSTALL_DATA) +transform = $(program_transform_name) +NORMAL_INSTALL = : +PRE_INSTALL = : +POST_INSTALL = : +NORMAL_UNINSTALL = : +PRE_UNINSTALL = : +POST_UNINSTALL = : +build_triplet = @build@ +host_triplet = @host@ +noinst_PROGRAMS = seqalign_test$(EXEEXT) +subdir = src/seqalign_test +DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in +ACLOCAL_M4 = $(top_srcdir)/aclocal.m4 +am__aclocal_m4_deps = $(top_srcdir)/configure.ac +am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \ + $(ACLOCAL_M4) +mkinstalldirs = $(install_sh) -d +CONFIG_HEADER = $(top_builddir)/config.h +CONFIG_CLEAN_FILES = +PROGRAMS = $(noinst_PROGRAMS) +am_seqalign_test_OBJECTS = seqalign_test.$(OBJEXT) +seqalign_test_OBJECTS = $(am_seqalign_test_OBJECTS) +seqalign_test_DEPENDENCIES = ../libfastx/libfastx.a +DEFAULT_INCLUDES = -I.@am__isrc@ -I$(top_builddir) +depcomp = $(SHELL) $(top_srcdir)/config/depcomp +am__depfiles_maybe = depfiles +CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \ + $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) +CXXLD = $(CXX) +CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \ + -o $@ +SOURCES = $(seqalign_test_SOURCES) +DIST_SOURCES = $(seqalign_test_SOURCES) +ETAGS = etags +CTAGS = ctags +DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST) +ACLOCAL = @ACLOCAL@ +AMTAR = @AMTAR@ +AUTOCONF = @AUTOCONF@ +AUTOHEADER = @AUTOHEADER@ +AUTOMAKE = @AUTOMAKE@ +AWK = @AWK@ +CC = @CC@ +CCDEPMODE = @CCDEPMODE@ +CFLAGS = @CFLAGS@ +CPP = @CPP@ +CPPFLAGS = @CPPFLAGS@ +CXX = @CXX@ +CXXCPP = @CXXCPP@ +CXXDEPMODE = @CXXDEPMODE@ +CXXFLAGS = @CXXFLAGS@ +CYGPATH_W = @CYGPATH_W@ +DEFS = @DEFS@ +DEPDIR = @DEPDIR@ +ECHO_C = @ECHO_C@ +ECHO_N = @ECHO_N@ +ECHO_T = @ECHO_T@ +EGREP = @EGREP@ +EXEEXT = @EXEEXT@ +GREP = @GREP@ +INSTALL = @INSTALL@ +INSTALL_DATA = @INSTALL_DATA@ +INSTALL_PROGRAM = @INSTALL_PROGRAM@ +INSTALL_SCRIPT = @INSTALL_SCRIPT@ +INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@ +LDFLAGS = @LDFLAGS@ +LIBOBJS = @LIBOBJS@ +LIBS = @LIBS@ +LTLIBOBJS = @LTLIBOBJS@ +MAKEINFO = @MAKEINFO@ +MKDIR_P = @MKDIR_P@ +OBJEXT = @OBJEXT@ +PACKAGE = @PACKAGE@ +PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@ +PACKAGE_NAME = @PACKAGE_NAME@ +PACKAGE_STRING = @PACKAGE_STRING@ +PACKAGE_TARNAME = @PACKAGE_TARNAME@ +PACKAGE_VERSION = @PACKAGE_VERSION@ +PATH_SEPARATOR = @PATH_SEPARATOR@ +RANLIB = @RANLIB@ +SET_MAKE = @SET_MAKE@ +SHELL = @SHELL@ +STRIP = @STRIP@ +VERSION = @VERSION@ +abs_builddir = @abs_builddir@ +abs_srcdir = @abs_srcdir@ +abs_top_builddir = @abs_top_builddir@ +abs_top_srcdir = @abs_top_srcdir@ +ac_ct_CC = @ac_ct_CC@ +ac_ct_CXX = @ac_ct_CXX@ +am__include = @am__include@ +am__leading_dot = @am__leading_dot@ +am__quote = @am__quote@ +am__tar = @am__tar@ +am__untar = @am__untar@ +bindir = @bindir@ +build = @build@ +build_alias = @build_alias@ +build_cpu = @build_cpu@ +build_os = @build_os@ +build_vendor = @build_vendor@ +builddir = @builddir@ +canonical_host_type = @canonical_host_type@ +datadir = @datadir@ +datarootdir = @datarootdir@ +docdir = @docdir@ +dvidir = @dvidir@ +exec_prefix = @exec_prefix@ +host = @host@ +host_alias = @host_alias@ +host_cpu = @host_cpu@ +host_os = @host_os@ +host_vendor = @host_vendor@ +htmldir = @htmldir@ +includedir = @includedir@ +infodir = @infodir@ +install_sh = @install_sh@ +libdir = @libdir@ +libexecdir = @libexecdir@ +localedir = @localedir@ +localstatedir = @localstatedir@ +mandir = @mandir@ +mkdir_p = @mkdir_p@ +oldincludedir = @oldincludedir@ +pdfdir = @pdfdir@ +prefix = @prefix@ +program_transform_name = @program_transform_name@ +psdir = @psdir@ +sbindir = @sbindir@ +sharedstatedir = @sharedstatedir@ +srcdir = @srcdir@ +sysconfdir = @sysconfdir@ +target_alias = @target_alias@ +top_builddir = @top_builddir@ +top_srcdir = @top_srcdir@ +AM_CPPFLAGS = \ + $(CC_WARNINGS) \ + -I../libfastx + +seqalign_test_SOURCES = seqalign_test.cpp +seqalign_test_LDADD = ../libfastx/libfastx.a +all: all-am + +.SUFFIXES: +.SUFFIXES: .cpp .o .obj +$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps) + @for dep in $?; do \ + case '$(am__configure_deps)' in \ + *$$dep*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh \ + && exit 0; \ + exit 1;; \ + esac; \ + done; \ + echo ' cd $(top_srcdir) && $(AUTOMAKE) --gnu src/seqalign_test/Makefile'; \ + cd $(top_srcdir) && \ + $(AUTOMAKE) --gnu src/seqalign_test/Makefile +.PRECIOUS: Makefile +Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status + @case '$?' in \ + *config.status*) \ + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \ + *) \ + echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \ + cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \ + esac; + +$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +$(top_srcdir)/configure: $(am__configure_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh +$(ACLOCAL_M4): $(am__aclocal_m4_deps) + cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh + +clean-noinstPROGRAMS: + -test -z "$(noinst_PROGRAMS)" || rm -f $(noinst_PROGRAMS) +seqalign_test$(EXEEXT): $(seqalign_test_OBJECTS) $(seqalign_test_DEPENDENCIES) + @rm -f seqalign_test$(EXEEXT) + $(CXXLINK) $(seqalign_test_OBJECTS) $(seqalign_test_LDADD) $(LIBS) + +mostlyclean-compile: + -rm -f *.$(OBJEXT) + +distclean-compile: + -rm -f *.tab.c + +@AMDEP_TRUE@@am__include@ @am__quote@./$(DEPDIR)/seqalign_test.Po@am__quote@ + +.cpp.o: +@am__fastdepCXX_TRUE@ $(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $< +@am__fastdepCXX_TRUE@ mv -f $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po +@AMDEP_TRUE@@am__fastdepCXX_FALSE@ source='$<' object='$@' libtool=no @AMDEPBACKSLASH@ +@AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@ +@am__fastdepCXX_FALSE@ $(CXXCOMPILE) -c -o $@ $< + +.cpp.obj: +@am__fastdepCXX_TRUE@ $(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'` +@am__fastdepCXX_TRUE@ mv -f $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po +@AMDEP_TRUE@@am__fastdepCXX_FALSE@ source='$<' object='$@' libtool=no @AMDEPBACKSLASH@ +@AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@ +@am__fastdepCXX_FALSE@ $(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'` + +ID: $(HEADERS) $(SOURCES) $(LISP) $(TAGS_FILES) + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonemtpy = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + mkid -fID $$unique +tags: TAGS + +TAGS: $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + here=`pwd`; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + if test -z "$(ETAGS_ARGS)$$tags$$unique"; then :; else \ + test -n "$$unique" || unique=$$empty_fix; \ + $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \ + $$tags $$unique; \ + fi +ctags: CTAGS +CTAGS: $(HEADERS) $(SOURCES) $(TAGS_DEPENDENCIES) \ + $(TAGS_FILES) $(LISP) + tags=; \ + list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \ + unique=`for i in $$list; do \ + if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \ + done | \ + $(AWK) '{ files[$$0] = 1; nonempty = 1; } \ + END { if (nonempty) { for (i in files) print i; }; }'`; \ + test -z "$(CTAGS_ARGS)$$tags$$unique" \ + || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \ + $$tags $$unique + +GTAGS: + here=`$(am__cd) $(top_builddir) && pwd` \ + && cd $(top_srcdir) \ + && gtags -i $(GTAGS_ARGS) $$here + +distclean-tags: + -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags + +distdir: $(DISTFILES) + @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \ + list='$(DISTFILES)'; \ + dist_files=`for file in $$list; do echo $$file; done | \ + sed -e "s|^$$srcdirstrip/||;t" \ + -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \ + case $$dist_files in \ + */*) $(MKDIR_P) `echo "$$dist_files" | \ + sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \ + sort -u` ;; \ + esac; \ + for file in $$dist_files; do \ + if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \ + if test -d $$d/$$file; then \ + dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \ + if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \ + cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \ + fi; \ + cp -pR $$d/$$file $(distdir)$$dir || exit 1; \ + else \ + test -f $(distdir)/$$file \ + || cp -p $$d/$$file $(distdir)/$$file \ + || exit 1; \ + fi; \ + done +check-am: all-am +check: check-am +all-am: Makefile $(PROGRAMS) +installdirs: +install: install-am +install-exec: install-exec-am +install-data: install-data-am +uninstall: uninstall-am + +install-am: all-am + @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am + +installcheck: installcheck-am +install-strip: + $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \ + install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \ + `test -z '$(STRIP)' || \ + echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install +mostlyclean-generic: + +clean-generic: + +distclean-generic: + -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES) + +maintainer-clean-generic: + @echo "This command is intended for maintainers to use" + @echo "it deletes files that may require special tools to rebuild." +clean: clean-am + +clean-am: clean-generic clean-noinstPROGRAMS mostlyclean-am + +distclean: distclean-am + -rm -rf ./$(DEPDIR) + -rm -f Makefile +distclean-am: clean-am distclean-compile distclean-generic \ + distclean-tags + +dvi: dvi-am + +dvi-am: + +html: html-am + +info: info-am + +info-am: + +install-data-am: + +install-dvi: install-dvi-am + +install-exec-am: + +install-html: install-html-am + +install-info: install-info-am + +install-man: + +install-pdf: install-pdf-am + +install-ps: install-ps-am + +installcheck-am: + +maintainer-clean: maintainer-clean-am + -rm -rf ./$(DEPDIR) + -rm -f Makefile +maintainer-clean-am: distclean-am maintainer-clean-generic + +mostlyclean: mostlyclean-am + +mostlyclean-am: mostlyclean-compile mostlyclean-generic + +pdf: pdf-am + +pdf-am: + +ps: ps-am + +ps-am: + +uninstall-am: + +.MAKE: install-am install-strip + +.PHONY: CTAGS GTAGS all all-am check check-am clean clean-generic \ + clean-noinstPROGRAMS ctags distclean distclean-compile \ + distclean-generic distclean-tags distdir dvi dvi-am html \ + html-am info info-am install install-am install-data \ + install-data-am install-dvi install-dvi-am install-exec \ + install-exec-am install-html install-html-am install-info \ + install-info-am install-man install-pdf install-pdf-am \ + install-ps install-ps-am install-strip installcheck \ + installcheck-am installdirs maintainer-clean \ + maintainer-clean-generic mostlyclean mostlyclean-compile \ + mostlyclean-generic pdf pdf-am ps ps-am tags uninstall \ + uninstall-am + +# Tell versions [3.59,3.63) of GNU make to not export all variables. +# Otherwise a system limit (for SysV at least) may be exceeded. +.NOEXPORT: diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/seqalign_test/seqalign_test.cpp --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_toolkit-0.0.6/src/seqalign_test/seqalign_test.cpp Thu Aug 14 04:52:17 2014 -0400 @@ -0,0 +1,18 @@ +#include +#include +#include +#include +#include "sequence_alignment.h" + + +int main( /*int argc, char* argv[] */) +{ + HalfLocalSequenceAlignment lsa ; + + const SequenceAlignmentResults& results = lsa.align("AAAGGTTTCCC","AGGCTT" ); + lsa.print_matrix(); + results.print(); + + + return 0; +}