Mercurial > repos > xuebing > sharplab_seq_motif
diff mytools/splicesite.xml @ 0:39217fa39ff2
Uploaded
author | xuebing |
---|---|
date | Tue, 13 Mar 2012 23:34:52 -0400 |
parents | |
children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/mytools/splicesite.xml Tue Mar 13 23:34:52 2012 -0400 @@ -0,0 +1,64 @@ +<tool id="splicesite" name="splice site score"> + <description>using max entropy model</description> + <command interpreter="perl">$script $input > $out_file1 </command> + <inputs> + <param name="input" format="txt" type="data" label="Sequence file" help="fasta or raw sequence (one sequence per line)"/> + <param name="script" type="select" label="Select model"> + <option value="splicesitescore/score5.pl" selected="true">5' splice site</option> + <option value="splicesitescore/score3.pl">3' splice site</option> + </param> + </inputs> + <outputs> + <data format="tabular" name="out_file1" /> + </outputs> + <help> + +**What it does** + +This tool computes splice site scores using a max entropy model. See more details here: + +http://genes.mit.edu/burgelab/maxent/Xmaxentscan_scoreseq.html + +----- + +**Example input for 5' splice site sequence** + +3 exonic and 6 intronic nucleotides flanking the junction:: + + CTGGTGAGT + AAGGTACAG + +or fasta format:: + + >seq1 + CTGGTGAGT + >seq2 + AAGGTACAG + +Output:: + + CTGGTGAGT 10.10 + AAGGTACAG 8.04 + +or fasta format:: + + >seq1 CTGGTGAGT 10.10 + >seq2 AAGGTACAG 8.04 + + +----- + +**Example input for 3' splice site sequence** + +3 exonic and 20 intronic nucleotides flanking the junction:: + + CCTGCATCCTCTGTTCCCAGGTG + TTTCTTCCCTCCGGGAACAGTGG + +Output:: + + CCTGCATCCTCTGTTCCCAGGTG 10.47 + TTTCTTCCCTCCGGGAACAGTGG 6.22 + + </help> +</tool>