Mercurial > repos > xuebing > sharplabtool
comparison tools/sr_mapping/lastz_paired_reads_wrapper.xml @ 0:9071e359b9a3
Uploaded
author | xuebing |
---|---|
date | Fri, 09 Mar 2012 19:37:19 -0500 |
parents | |
children |
comparison
equal
deleted
inserted
replaced
-1:000000000000 | 0:9071e359b9a3 |
---|---|
1 <tool id="lastz_paired_reads_wrapper" name="Lastz paired reads" version="1.1.1"> | |
2 <description> map short paired reads against reference sequence</description> | |
3 <command interpreter="python">lastz_paired_reads_wrapper.py | |
4 #if $seq_name.how_to_name=="yes": | |
5 --ref_name=$seq_name.ref_name | |
6 #end if | |
7 --ref_source=$source.ref_source | |
8 --input2=$input2 | |
9 --input3=$input3 | |
10 --input4=$input4 | |
11 #if $source.ref_source=="history": | |
12 --input1=$source.input1 | |
13 --ref_sequences=$input1.metadata.sequences | |
14 #else: | |
15 --input1="${ filter( lambda x: str( x[0] ) == str( $source.input1_2bit ), $__app__.tool_data_tables[ 'lastz_seqs' ].get_fields() )[0][-1] }" | |
16 #end if | |
17 --output=$output1 | |
18 --lastz_seqs_file_dir=${GALAXY_DATA_INDEX_DIR} | |
19 </command> | |
20 <inputs> | |
21 <param name="input2" format="fasta" type="data" label="Align sequencing reads in" /> | |
22 <conditional name="source"> | |
23 <param name="ref_source" type="select" label="Against reference sequences that are"> | |
24 <option value="cached">locally cached</option> | |
25 <option value="history">in your history</option> | |
26 </param> | |
27 <when value="cached"> | |
28 <param name="input1_2bit" type="select" label="Using reference genome" help="If your genome of interest is not listed, contact the Galaxy team"> | |
29 <options from_data_table="lastz_seqs" /> | |
30 </param> | |
31 </when> | |
32 <when value="history"> | |
33 <param name="input1" type="data" format="fasta" label="Select a reference dataset" /> | |
34 </when> | |
35 </conditional> | |
36 <param name="input3" format="fasta" type="data" label="Linker file" /> | |
37 <param name="input4" format="qual454" type="data" label="Select a base quality score 454 dataset" /> | |
38 <conditional name="seq_name"> | |
39 <param name="how_to_name" type="select" label="Do you want to modify the reference name?"> | |
40 <option value="no">No</option> | |
41 <option value="yes">Yes</option> | |
42 </param> | |
43 <when value="yes"> | |
44 <param name="ref_name" type="text" size="25" value="Type sequence name here" label="Enter name for the Reference sequence"/> | |
45 </when> | |
46 <when value="no" /> | |
47 </conditional> | |
48 </inputs> | |
49 <outputs> | |
50 <data format="sam" name="output1" label="${tool.name} on ${on_string}: mapped reads" /> | |
51 </outputs> | |
52 <requirements> | |
53 <requirement type="package">lastz</requirement> | |
54 </requirements> | |
55 <tests> | |
56 <test> | |
57 <!-- | |
58 input1: a reference genome ( 2bit or fasta ) | |
59 input2: a collection of 454 paired end reads ( a fasta file ) | |
60 input3: a linker sequence ( a very small fasta file ) | |
61 input4: a base quality score 454 file ( qual454 ) | |
62 --> | |
63 <param name="input2" value="lastz_paired_input2.fasta" ftype="fasta" /> | |
64 <param name="ref_source" value="cached" /> | |
65 <param name="input1_2bit" value="/galaxy/data/hg18/seq/chr21.2bit" /> | |
66 <param name="input3" value="lastz_paired_input3.fasta" ftype="fasta" /> | |
67 <param name="input4" value="lastz_paired_input4.qual454" ftype="qual454" /> | |
68 <param name="how_to_name" value="no" /> | |
69 <output name="output1" file="lastz_paired_out1.sam" /> | |
70 </test> | |
71 </tests> | |
72 <help> | |
73 | |
74 **What it does** | |
75 | |
76 **LASTZ** is a high performance pairwise sequence aligner derived from BLASTZ. It is written by Bob Harris in Webb Miller's laboratory at Penn State University. Special scoring sets were derived to improve runtime performance and quality. This Galaxy version of LASTZ is geared towards aligning short (Illumina/Solexa, AB/SOLiD) and medium (Roche/454) paired reads against a reference sequence. There is excellent, extensive documentation on LASTZ available here_. | |
77 | |
78 .. _here: http://www.bx.psu.edu/miller_lab/dist/README.lastz-1.02.00/README.lastz-1.02.00.html | |
79 | |
80 ------ | |
81 | |
82 **Input formats** | |
83 | |
84 LASTZ accepts reference and reads in FASTA format. However, because Galaxy supports implicit format conversion the tool will recognize fastq and other method specific formats. | |
85 | |
86 ------ | |
87 | |
88 **Outputs** | |
89 | |
90 This LASTZ tool produces a SAM file showing sequence alignments. | |
91 | |
92 **SAM output** | |
93 | |
94 SAM has 12 columns:: | |
95 | |
96 1 2 3 4 5 6 7 8 9 10 11 12 | |
97 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | |
98 HWI-EAS91_1_30788AAXX:1:2:1670:915 99 chr9 58119878 60 36M = 58120234 392 GACCCCTACCCCACCGTGCTCTGGATCTCAGTGTTT IIIIIIIIIIIIIIIIEIIIIIII7IIIIIIIIIII XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:36 | |
99 HWI-EAS91_1_30788AAXX:1:2:1670:915 147 chr9 58120234 60 36M = 58119878 -392 ATGAGTCGAATTCTATTTTCCAAACTGTTAACAAAA IFIIDI;IIICIIIIIIIIIIIIIIIIIIIIIIIII XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:36 | |
100 | |
101 | |
102 where:: | |
103 | |
104 Column Description | |
105 --------- --------------------------------------------------------------------- | |
106 1. QNAME Query (pair) NAME | |
107 2. FLAG bitwise FLAG | |
108 3. RNAME Reference sequence NAME | |
109 4. POS 1-based leftmost POSition/coordinate of clipped sequence | |
110 5. MAPQ MAPping Quality (Phred-scaled) | |
111 6. CIGAR extended CIGAR string | |
112 7. MRNM Mate Reference sequence NaMe ('=' if same as RNAME) | |
113 8. MPOS 1-based Mate POSition | |
114 9. ISIZE Inferred insert SIZE | |
115 10. SEQ query SEQuence on the same strand as the reference | |
116 11. QUAL query QUALity (ASCII-33 gives the Phred base quality) | |
117 12. OPT variable OPTional fields in the format TAG:VTYPE:VALUE, tab-separated | |
118 | |
119 The flags are as follows:: | |
120 | |
121 Flag Description | |
122 ------ ------------------------------------- | |
123 0x0001 the read is paired in sequencing | |
124 0x0002 the read is mapped in a proper pair | |
125 0x0004 the query sequence itself is unmapped | |
126 0x0008 the mate is unmapped | |
127 0x0010 strand of the query (1 for reverse) | |
128 0x0020 strand of the mate | |
129 0x0040 the read is the first read in a pair | |
130 0x0080 the read is the second read in a pair | |
131 0x0100 the alignment is not primary | |
132 | |
133 ------ | |
134 | |
135 **Do you want to modify the reference name?** | |
136 | |
137 This option allows you to set the name of the reference sequence manually. This is helpful when, for example, you would like to make the reference name compatible with the UCSC naming conventions to be able to display your lastz results as a custom track at the UCSC Genome Browser. | |
138 | |
139 ------ | |
140 | |
141 **LASTZ parameter list** | |
142 | |
143 This is an exhaustive list of LASTZ options. Once again, please note that not all parameters are included in this interface. If you would like to make additional options available through Galaxy, e-mail us at galaxy-bugs@bx.psu.edu:: | |
144 | |
145 target[[s..e]][-] spec/file containing target sequence (fasta or nib) | |
146 [s..e] defines a subrange of the file | |
147 - indicates reverse-complement | |
148 (use --help=files for more details) | |
149 query[[s..e]][-] spec/file containing query sequences (fasta or nib) | |
150 if absent, queries come from stdin (unless they | |
151 aren't needed, as for --self or --tableonly) | |
152 (use --help=files for more details) | |
153 --self the target sequence is also the query | |
154 --quantum the query sequence contains quantum DNA | |
155 --seed=match<length> use a word with no gaps instead of a seed pattern | |
156 --seed=half<length> use space-free half-weight word instead of seed pattern | |
157 --match=<reward>[,<penalty>] set the score values for a match (+<reward>) | |
158 and mismatch (-<penalty>) | |
159 --[no]trans[ition][=2] allow one or two transitions in a seed hit | |
160 (by default a transition is allowed) | |
161 --word=<bits> set max bits for word hash; use this to trade time for | |
162 memory, eliminating thrashing for heavy seeds | |
163 (default is 28 bits) | |
164 --[no]filter=[<T>:]<M> filter half-weight seed hits, requiring at least M | |
165 matches and allowing no more than T transversions | |
166 (default is no filtering) | |
167 --notwins require just one seed hit | |
168 --twins=[<min>:]<maxgap> require two nearby seed hits on the same diagonal | |
169 (default is twins aren't required) | |
170 --notwins allow single, isolated seeds | |
171 --[no]recoverseeds avoid losing seeds in hash collisions. Cannot be used with --twins | |
172 --seedqueue=<entries> set number of entries in seed hit queue | |
173 (default is 262144) | |
174 --anchors=<file> read anchors from a file, instead of discovering anchors | |
175 via seeding | |
176 --recoverhits recover hash-collision seed hits | |
177 (default is not to recover seed hits) | |
178 --step=<length> set step length (default is 1) | |
179 --maxwordcount=<limit> words occurring more often than <limit> in the target | |
180 are not eligible for seeds | |
181 --strand=both search both strands | |
182 --strand=plus search + strand only (matching strand of query spec) | |
183 --strand=minus search - strand only (opposite strand of query spec) | |
184 (by default both strands are searched) | |
185 --ambiguousn treat N as an ambiguous nucleotide | |
186 (by default N is treated as a sequence splicing character) | |
187 --[no]gfextend perform gap-free extension of seed hits to HSPs | |
188 (by default no extension is performed) | |
189 --[no]chain perform chaining | |
190 --chain=<diag,anti> perform chaining with given penalties for diagonal and | |
191 anti-diagonal | |
192 (by default no chaining is performed) | |
193 --[no]gapped perform gapped alignment (instead of gap-free) | |
194 (by default gapped alignment is performed) | |
195 --score[s]=<file> read substitution scores from a file | |
196 (default is HOXD70) | |
197 --unitscore[s] scores are +1/-1 for match/mismatch | |
198 --gap=<[open,]extend> set gap open and extend penalties (default is 400,30) | |
199 --xdrop=<score> set x-drop threshold (default is 10*sub[A][A]) | |
200 --ydrop=<score> set y-drop threshold (default is open+300extend) | |
201 --infer[=<control>] infer scores from the sequences, then use them | |
202 --inferonly[=<control>] infer scores, but don't use them (requires --infscores) | |
203 all inference options are read from the control file | |
204 --infscores[=<file>] write inferred scores to a file | |
205 --hspthresh=<score> set threshold for high scoring pairs (default is 3000) | |
206 ungapped extensions scoring lower are discarded | |
207 <score> can also be a percentage or base count | |
208 --entropy adjust for entropy when qualifying HSPs in the x-drop extension | |
209 method | |
210 --noentropy don't adjust for entropy when qualifying HSPs | |
211 --exact=<length> set threshold for exact matches | |
212 if specified, exact matches are found rather than high | |
213 scoring pairs (replaces --hspthresh) | |
214 --inner=<score> set threshold for HSPs during interpolation | |
215 (default is no interpolation) | |
216 --gappedthresh=<score> set threshold for gapped alignments | |
217 gapped extensions scoring lower are discarded | |
218 <score> can also be a percentage or base count | |
219 (default is to use same value as --hspthresh) | |
220 --ball=<score> set minimum score required of words 'in' a quantum ball | |
221 --[no]entropy involve entropy in filtering high scoring pairs | |
222 (default is "entropy") | |
223 --[no]mirror report/use mirror image of all gap-free alignments | |
224 (default is "mirror" for self-alignments only) | |
225 --traceback=<bytes> space for trace-back information | |
226 (default is 80.0M) | |
227 --masking=<count> mask any position in target hit this many times | |
228 zero indicates no masking | |
229 (default is no masking) | |
230 --targetcapsule=<capsule_file> the target seed word position table and seed | |
231 (as well as the target sequence)are read from specified file | |
232 --segments=<segment_file> read segments from a file, instead of discovering | |
233 them via seeding. Replaces other seeding or gap-free extension | |
234 options | |
235 --[no]census[=<file>] count/report how many times each target base aligns | |
236 (default is to not report census) | |
237 --identity=<min>[..<max>] filter alignments by percent identity | |
238 0<=min<=max<=100; blocks (or HSPs) outside min..max | |
239 are discarded | |
240 (default is no identity filtering) | |
241 --coverage=<min>[..<max>] filter alignments by percentage pf query covered | |
242 0<=min<=max<=100; blocks (or HSPs) outside min..max | |
243 are discarded | |
244 (default is no query coverage filtering) | |
245 --notrivial do not output trivial self-alignment block if the target and query | |
246 sequences are identical. Using --self enables this option automatically | |
247 --output=<output_file> write the alignments to the specified file name instead of stdout | |
248 --code=<file> give quantum code for query sequence (only for display) | |
249 --format=<type> specify output format; one of lav, axt, maf, maf+, maf-, text, | |
250 lav+text, cigar, text, rdplot, general, or general:<fields> | |
251 (by default output is LAV) | |
252 --rdotplot=<file> create an additional output file suitable for plotting the alignments | |
253 with the R statistical package. | |
254 --markend Just before normal completion, write "# lastz end-of-file" to output file | |
255 --census[=<output_file>] count and report how many times each target base aligns, up | |
256 to 255. Ns are included in the count | |
257 --census16[=<output_file>] count and report how many times each target base aligns, up | |
258 up 65 thousand | |
259 --census32[=<output_file>] count and report how many times each target bas aligns, up | |
260 to 4 billion | |
261 --writecapsule=<capsule_file> just write out a targegt capsule file and quit; don't | |
262 search for seeds or perform subsequent stages | |
263 --verbosity=<level> set info level (0 is minimum, 10 is everything) | |
264 (default is 0) | |
265 --[no]runtime report runtime in the output file | |
266 (default is to not report runtime) | |
267 --tableonly[=count] just produce the target position table, don't | |
268 search for seeds | |
269 --[no]stats[=<file>] show search statistics (or don't) | |
270 (not available in this build) | |
271 --version report the program version and quit | |
272 --help list all options | |
273 --help=files list information about file specifiers | |
274 --help=short[cuts] list blastz-compatible shortcuts | |
275 --help=yasra list yasra-specific shortcuts | |
276 | |
277 </help> | |
278 </tool> |