Mercurial > repos > xuebing > sharplabtool

comparison tools/sr_mapping/lastz_wrapper.xml @ 0:9071e359b9a3

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author xuebing
date Fri, 09 Mar 2012 19:37:19 -0500
parents
children
comparison
equal deleted inserted replaced
-1:000000000000 0:9071e359b9a3
1 <tool id="lastz_wrapper_2" name="Lastz" version="1.2.2">
2 <description> map short reads against reference sequence</description>
3 <command interpreter="python">lastz_wrapper.py
4 #if $seq_name.how_to_name=="yes":
5 --ref_name=$seq_name.ref_name
6 #end if
7 --ref_source=$source.ref_source
8 --source_select=$params.source_select
9 --out_format=$out_format
10 --input2=$input2
11 #if $source.ref_source=="history":
12 --input1=$source.input1
13 --ref_sequences=$input1.metadata.sequences
14 #else:
15 --input1="${ filter( lambda x: str( x[0] ) == str( $source.input1_2bit ), $__app__.tool_data_tables[ 'lastz_seqs' ].get_fields() )[0][-1] }"
16 --ref_sequences="None"
17 #end if
18 #if $params.source_select=="pre_set":
19 --pre_set_options=${params.pre_set_options}
20 #else:
21 --strand=$params.strand
22 --seed=$params.seed
23 --gfextend=$params.gfextend
24 --chain=$params.chain
25 --transition="$params.transition"
26 --O=$params.O
27 --E=$params.E
28 --X=$params.X
29 --Y=$params.Y
30 --K=$params.K
31 --L=$params.L
32 --entropy=$params.entropy
33 #end if
34 --identity_min=$min_ident
35 --identity_max=$max_ident
36 --coverage=$min_cvrg
37 --output=$output1
38 --unmask=$unmask
39 --lastzSeqsFileDir=${GALAXY_DATA_INDEX_DIR}
40 </command>
41 <inputs>
42 <param name="input2" format="fasta" type="data" label="Align sequencing reads in" />
43 <conditional name="source">
44 <param name="ref_source" type="select" label="Against reference sequences that are">
45 <option value="cached">locally cached</option>
46 <option value="history">in your history</option>
47 </param>
48 <when value="cached">
49 <param name="input1_2bit" type="select" label="Using reference genome" help="If your genome of interest is not listed, contact the Galaxy team">
50 <options from_data_table="lastz_seqs" />
51 </param>
52 </when>
53 <when value="history">
54 <param name="input1" type="data" format="fasta" label="Select a reference dataset" />
55 </when>
56 </conditional>
57 <param name="out_format" type="select" label="Output format">
58 <option value="sam">SAM</option>
59 <option value="diffs">Polymorphisms</option>
60 <option value="tabular">Tabular</option>
61 </param>
62 <conditional name="params">
63 <param name="source_select" type="select" label="Lastz settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full List">
64 <option value="pre_set">Commonly used</option>
65 <option value="full">Full Parameter List</option>
66 </param>
67 <when value="pre_set">
68 <param name="pre_set_options" type="select" label="Select mapping mode">
69 <option value="yasra98">Roche-454 98% identity</option>
70 <option value="yasra95">Roche-454 95% identity</option>
71 <option value="yasra90">Roche-454 90% identity</option>
72 <option value="yasra85">Roche-454 85% identity</option>
73 <option value="yasra75">Roche-454 75% identity</option>
74 <option value="yasra95short">Illumina 95% identity</option>
75 <option value="yasra85short">Illumina 85% identity</option>
76 </param>
77 </when>
78 <when value="full">
79 <param name="strand" type="select" label="Which strand to search?">
80 <option value="both">Both</option>
81 <option value="plus">Search forward strand only (the one in the reference)</option>
82 <option value="minus">Search the reverse complement strand only (opposite of the reference)</option>
83 </param>
84 <param name="seed" type="select" label="Select seeding settings" help="allows you set word size and number of mismatches">
85 <option value="12of19">Seed hits require a 19 bp word with matches in 12 specific positions</option>
86 <option value="14of22">Seed hits require a 22 bp word with matches in 14 specific positions</option>
87 </param>
88 <param name="transition" type="select" label="Select transition settings" help="affects the number of allowed transition substitutions">
89 <option value="transition">Allow one transition in each seed hit</option>
90 <option value="transition=2">Allow two transitions in a seed hit </option>
91 <option value="notransition">Don't allow any transitions in seed hits</option>
92 </param>
93 <param name="gfextend" type="select" label="Perform gap-free extension of seed hits to HSPs (high scoring segment pairs)?">
94 <option value="nogfextend">No</option>
95 <option value="gfextend">Yes</option>
96 </param>
97 <param name="chain" type="select" label="Perform chaining of HSPs?">
98 <option value="nochain">No</option>
99 <option value="chain">Yes</option>
100 </param>
101 <param name="O" type="integer" size="5" value="400" label="Gap opening penalty"/>
102 <param name="E" type="integer" size="5" value="30" label="Gap extension penalty"/>
103 <param name="X" type="integer" size="5" value="910" label="X-drop threshold"/>
104 <param name="Y" type="integer" size="5" value="9370" label="Y-drop threshold"/>
105 <param name="K" type="integer" size="5" value="3000" label="Set the threshold for HSPs (ungapped extensions scoring lower are discarded)"/>
106 <param name="L" type="integer" size="5" value="3000" label="Set the threshold for gapped alignments (gapped extensions scoring lower are discarded)"/>
107 <param name="entropy" type="select" label="Involve entropy when filtering HSPs?">
108 <option value="noentropy">No</option>
109 <option value="entropy">Yes</option>
110 </param>
111 </when>
112 </conditional>
113 <conditional name="seq_name">
114 <param name="how_to_name" type="select" label="Do you want to modify the reference name?">
115 <option value="no">No</option>
116 <option value="yes">Yes</option>
117 </param>
118 <when value="yes">
119 <param name="ref_name" type="text" size="25" value="Type sequence name here" label="Enter name for the Reference sequence"/>
120 </when>
121 <when value="no" />
122 </conditional>
123 <param name="min_ident" type="integer" size="3" value="0" label="Do not report matches below this identity (%)"/>
124 <param name="max_ident" type="integer" size="3" value="100" label="Do not report matches above this identity (%)"/>
125 <param name="min_cvrg" type="integer" size="3" value="0" label="Do not report matches that cover less than this percentage of each read"/>
126 <param name="unmask" type="select" label="Convert lowercase bases to uppercase">
127 <option value="yes">Yes</option>
128 <option value="no">No</option>
129 </param>
130 </inputs>
131 <outputs>
132 <data format="tabular" name="output1" label="${tool.name} on ${on_string}: mapped reads">
133 <change_format>
134 <when input="out_format" value="sam" format="sam" />
135 </change_format>
136 </data>
137 </outputs>
138 <requirements>
139 <requirement type="package">lastz</requirement>
140 </requirements>
141 <tests>
142 <test>
143 <!--
144 Lastz command:
145 lastz phiX.2bit/phiX174[nickname=Ref] test-data/b1.fasta +nogfextend +nochain +gapped +strand=both +seed=12of19 +transition O=400 E=30 X=910 Y=9370 K=3000 L=3000 +noentropy +ambiguousn +nolaj +identity=0..100 +coverage=0 +format=sam- > lastz_wrapper_out2.sam
146 You need to point to phiX.2bit somewhere on your system. b1.fasta is located in galaxy's test-data. You will have to replace all the pluses before the
147 commands with 2 dashes, as double-dash can't appear in an XML comment.
148 -->
149 <param name="input2" value="b1.fasta" ftype="fasta" />
150 <param name="ref_source" value="cached" />
151 <!-- this is the backwards-compatible "unique value" for this file, not an actual path -->
152 <param name="input1_2bit" value="/galaxy/data/phiX/seq/phiX.2bit" />
153 <param name="out_format" value="sam" />
154 <param name="source_select" value="full" />
155 <param name="strand" value="both" />
156 <param name="seed" value="12of19" />
157 <param name="transition" value="transition" />
158 <param name="gfextend" value="nogfextend" />
159 <param name="chain" value="nochain" />
160 <param name="O" value="400" />
161 <param name="E" value="30" />
162 <param name="X" value="910" />
163 <param name="Y" value="9370" />
164 <param name="K" value="3000" />
165 <param name="L" value="3000" />
166 <param name="entropy" value="noentropy" />
167 <!--
168 how_to_name is not the default. It is changed to modify
169 input1_2bit by adding the ref_name as a nickname
170 -->
171 <param name="how_to_name" value="yes" />
172 <param name="ref_name" value="Ref" />
173 <param name="min_ident" value="0" />
174 <param name="max_ident" value="100" />
175 <param name="min_cvrg" value="0" />
176 <param name="unmask" value="yes" />
177 <output name="output1" file="lastz_wrapper_out2.sam" />
178 </test>
179 <test>
180 <!--
181 Lastz command:
182 lastz test-data/phiX.fasta test-data/b1.fasta[fullnames] +yasra95short +ambiguousn +nolaj +identity=0..100 +coverage=0 +format=diffs > lastz_wrapper_out3.tabular
183 phiX.fasta and b1.fasta are located in galaxy's test-data. You will have to replace all the pluses before the commands with 2 dashes,
184 as double-dash can't appear in an XML comment.
185 -->
186 <param name="input2" value="b1.fasta" ftype="fasta" />
187 <param name="ref_source" value="history" />
188 <param name="input1" value="phiX.fasta" ftype="fasta" />
189 <param name="out_format" value="diffs" />
190 <param name="source_select" value="pre_set" />
191 <param name="pre_set_options" value="yasra95short" />
192 <param name="how_to_name" value="no" />
193 <param name="min_ident" value="0" />
194 <param name="max_ident" value="100" />
195 <param name="min_cvrg" value="0" />
196 <param name="unmask" value="yes" />
197 <output name="output1" file="lastz_wrapper_out3.tabular" />
198 </test>
199 <test>
200 <!--
201 Lastz command: first you will need to split the file phiX_split.fasta into two files,
202 phiX1.fasta and phiX2.fasta, each with 1 sequence (phiX1 and phiX2, respectively). Then:
203 lastz phiX1.fasta test-data/b1.fasta *yasra95short *ambiguousn *nolaj *identity=0..100 *coverage=0 *format=general-:score,name1,strand1,size1,start1,zstart1,end1,length1,text1,name2,strand2,size2,start2,zstart2,end2,start2+,zstart2+,end2+,length2,text2,diff,cigar,identity,coverage,gaprate,diagonal,shingle > lastz_wrapper_out4.tabular
204 lastz phiX2.fasta test-data/b1.fasta *yasra95short *ambiguousn *nolaj *identity=0..100 *coverage=0 *format=general-:score,name1,strand1,size1,start1,zstart1,end1,length1,text1,name2,strand2,size2,start2,zstart2,end2,start2+,zstart2+,end2+,length2,text2,diff,cigar,identity,coverage,gaprate,diagonal,shingle >> lastz_wrapper_out4.tabular
205 You need to point to phiX1.fasta and phiX2.fasta somewhere on your system.
206 phiX_split.fasta and b1.fasta are located in galaxy's test-data
207 You will have to replace all the asterisks before the commands with 2 dashes,
208 as double-dash can't appear in an XML comment
209
210 NOTE: since the input file include more than 1 sequence, the output must be sorted in
211 order for functional test to pass. This is done using the sort="True" attribute on the output.
212 -->
213 <param name="input2" value="b1.fasta" ftype="fasta" />
214 <param name="ref_source" value="history" />
215 <param name="input1" value="phiX_split.fasta" ftype="fasta" />
216 <param name="out_format" value="tabular" />
217 <param name="source_select" value="pre_set" />
218 <param name="pre_set_options" value="yasra95short" />
219 <param name="how_to_name" value="no" />
220 <param name="min_ident" value="0" />
221 <param name="max_ident" value="100" />
222 <param name="min_cvrg" value="0" />
223 <param name="unmask" value="yes" />
224 <output name="output1" file="lastz_wrapper_out4.tabular" sort="True" />
225 </test>
226 </tests>
227 <help>
228
229 **What it does**
230
231 **LASTZ** is a high performance pairwise sequence aligner derived from BLASTZ. It is written by Bob Harris in Webb Miller's laboratory at Penn State University. Special scoring sets were derived to improve runtime performance and quality. This Galaxy version of LASTZ is geared towards aligning short (Illumina/Solexa, AB/SOLiD) and medium (Roche/454) reads against a reference sequence. There is excellent, extensive documentation on LASTZ available here_.
232
233 .. _here: http://www.bx.psu.edu/miller_lab/dist/README.lastz-1.02.00/README.lastz-1.02.00.html
234
235 ------
236
237 **Input formats**
238
239 LASTZ accepts reference and reads in FASTA format. However, because Galaxy supports implicit format conversion the tool will recognize fastq and other method specific formats.
240
241 ------
242
243 **Outputs**
244
245 LASTZ generates one output. Depending on the choice you make in the *Select output format* drop-down, LASTZ will produce a SAM file showing sequence alignments, a list of differences between the reads and reference (Polymorphisms), or a general table with one line per alignment block (Tabular). Examples of these outputs are shown below.
246
247 **SAM output**
248
249 SAM has 12 columns::
250
251 1 2 3 4 5 6 7 8 9 10 11 12
252 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
253 HWI-EAS91_1_30788AAXX:1:2:1670:915 99 chr9 58119878 60 36M = 58120234 392 GACCCCTACCCCACCGTGCTCTGGATCTCAGTGTTT IIIIIIIIIIIIIIIIEIIIIIII7IIIIIIIIIII XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:36
254 HWI-EAS91_1_30788AAXX:1:2:1670:915 147 chr9 58120234 60 36M = 58119878 -392 ATGAGTCGAATTCTATTTTCCAAACTGTTAACAAAA IFIIDI;IIICIIIIIIIIIIIIIIIIIIIIIIIII XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:36
255
256
257 where::
258
259 Column Description
260 --------- ---------------------------------------------------------------------
261 1. QNAME Query (pair) NAME
262 2. FLAG bitwise FLAG
263 3. RNAME Reference sequence NAME
264 4. POS 1-based leftmost POSition/coordinate of clipped sequence
265 5. MAPQ MAPping Quality (Phred-scaled)
266 6. CIGAR extended CIGAR string
267 7. MRNM Mate Reference sequence NaMe ('=' if same as RNAME)
268 8. MPOS 1-based Mate POSition
269 9. ISIZE Inferred insert SIZE
270 10. SEQ query SEQuence on the same strand as the reference
271 11. QUAL query QUALity (ASCII-33 gives the Phred base quality)
272 12. OPT variable OPTional fields in the format TAG:VTYPE:VALUE, tab-separated
273
274 The flags are as follows::
275
276 Flag Description
277 ------ -------------------------------------
278 0x0001 the read is paired in sequencing
279 0x0002 the read is mapped in a proper pair
280 0x0004 the query sequence itself is unmapped
281 0x0008 the mate is unmapped
282 0x0010 strand of the query (1 for reverse)
283 0x0020 strand of the mate
284 0x0040 the read is the first read in a pair
285 0x0080 the read is the second read in a pair
286 0x0100 the alignment is not primary
287
288 **Polymorphism (SNP or differences) output**
289
290 Polymorphism output contains 14 columns::
291
292 1 2 3 4 5 6 7 8 9 10 11 12 13 14
293 --------------------------------------------------------------------------------------------------------------------------------------------------------------
294 chrM 2490 2491 + 5386 HWI-EAS91_1_306UPAAXX:6:1:486:822 10 11 - 36 C A ACCTGTTTTACAGACACCTAAAGCTACATCGTCAAC ACCTGTTTTAAAGACACCTAAAGCTACATCGTCAAC
295 chrM 2173 2174 + 5386 HWI-EAS91_1_306UPAAXX:6:1:259:1389 26 27 + 36 G T GCGTACTTATTCGCCACCATGATTATGACCAGTGTT GCGTACTTATTCGCCACCATGATTATTACCAGTGTT
296
297 where::
298
299 1. (chrM) - Reference sequence id
300 2. (2490) - Start position of the difference in the reference
301 3. (2491) - End position of the difference in the reference
302 4. (+) - Strand of the reference (always plus)
303 5. (5386) - Length of the reference sequence
304 6. (HWI...) - read id
305 7. (10) - Start position of the difference in the read
306 8. (11) - End position of the difference in the read
307 9. (+) - Strand of the read
308 10. (36) - Length of the read
309 11. (C) - Nucleotide in the reference
310 12. (A) - Nucleotide in the read
311 13. (ACC...) - Reference side os the alignment
312 14. (ACC...) - Read side of the alignment
313
314 **Tabular output**
315
316 Tabular output is a tab-separated format with 30 columns::
317
318 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
319 -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
320 14 PHIX174 + 5386 4648 4647 4661 14 ATTTTCGTGATATT EYKX4VC01BV8HS + 204 154 153 167 154 153 167 14 ATTTTCGTGATATT .............. 14M 14/14 100.0% 14/204 6.9% 0/14 0.0% 4494 NA
321 16 PHIX174 + 5386 3363 3362 3378 16 GACGCCGGATTTGAGA EYKX4VC01AWJ88 - 259 36 35 51 209 208 224 16 GACGCCGGATTTGAGA ................ 16M 16/16 100.0% 16/259 6.2% 0/16 0.0% 3327 NA
322
323 The following columns are present::
324
325 Field Meaning
326 ---------------- -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
327 1. score Score of the alignment block. The scale and meaning of this number will vary, depending on the final stage performed and other command-line options.
328 2. name1 Name of the target sequence.
329 3. strand1 Target sequence strand, either "+" or "−".
330 4. size1 Size of the entire target sequence.
331 5. start1 Starting position of the alignment block in the target, origin-one.
332 6. zstart1 Starting position of the alignment block in the target, origin-zero.
333 7. end1 Ending position of the alignment block in the target, expressed either as origin-one closed or origin-zero half-open (the ending value is the same in both systems).
334 8. length1 Length of the alignment block in the target (excluding gaps).
335 9. text1 Aligned characters in the target, including gap characters.
336 10. name2 Name of the query sequence.
337 11. strand2 Query sequence strand, either "+" or "−".
338 12. size2 Size of the entire query sequence.
339 13. start2 Starting position of the alignment block in the query, origin-one.
340 14. zstart2 Starting position of the alignment block in the query, origin-zero.
341 15. end2 Ending position of the alignment block in the query, expressed either as origin-one closed or origin-zero half-open (the ending value is the same in both systems).
342 16. start2+ Starting position of the alignment block in the query, counting along the query sequence's positive strand (regardless of which query strand was aligned), origin-one. Note that if strand2 is "−", then this is the other end of the block from start2.
343 17. zstart2+ Starting position of the alignment block in the query, counting along the query sequence's positive strand (regardless of which query strand was aligned), origin-zero. Note that if strand2 is "−", then this is the other end of the block from zstart2.
344 18. end2+ Ending position of the alignment block in the query, counting along the query sequence's positive strand (regardless of which query strand was aligned), expressed either as origin-one closed or origin-zero half-open (the ending value is the same in both systems). Note that if strand2 is "−", then this is the other end of the block from end2.
345 19. length2 Length of the alignment block in the query (excluding gaps).
346 20. text2 Aligned characters in the query, including gap characters.
347 21. diff Differences between what would be written for text1 and text2. Matches are written as . (period), transitions as : (colon), transversions as X, and gaps as - (hyphen).
348 22. cigar A CIGAR-like representation of the alignment's path through the Dynamic Programming matrix. This is the short representation, without spaces, described in the Ensembl CIGAR specification.
349 23./24. identity Fraction of aligned bases in the block that are matches (see Identity). This is written as two fields. The first field is a fraction, written as &lt;n&gt;/&lt;d&gt;. The second field contains the same value, computed as a percentage.
350 25./26. coverage Fraction of the entire input sequence (target or query, whichever is shorter) that is covered by the alignment block (see Coverage). This is written as two fields. The first field is a fraction, written as &lt;n&gt;/&lt;d&gt;. The second field contains the same value, computed as a percentage.
351 27./28. gaprate Rate of gaps (also called indels) in the alignment block. This is written as two fields. The first field is a fraction, written as &lt;n&gt;/&lt;d&gt;, with the numerator being the number of alignment columns containing gaps and the denominator being the number without gaps. The second field contains the same value, computed as a percentage.
352 29. diagonal The diagonal of the start of the alignment block in the dynamic programming matrix, expressed as an identifying number start1-start2.
353 30. shingle A measurement of the shingle overlap between the target and the query. This is intended for the case where both the target and query are relatively short, and their ends are expected to overlap.
354
355 -------
356
357 **LASTZ Settings**
358
359 There are two setting modes: (1) **Commonly used settings** and (2) **Full Parameter List**.
360
361 **Commonly used settings**
362
363 There are seven modes::
364
365 Illumina-Solexa/AB-SOLiD 95% identity
366 Illumina-Solexa/AB-SOLiD 85% identity
367 Roche-454 98% identity
368 Roche-454 95% identity
369 Roche-454 90% identity
370 Roche-454 85% identity
371 Roche-454 75% identity
372
373 When deciding which one to use, consider the following: a 36 bp read with two differences will be 34/36 = 94% identical to the reference.
374
375 **Full Parameter List**
376
377 This mode gives you fuller control over lastz. The description of these and other parameters is found at the end of this page. Note that not all parameters are included in this interface. If you would like to make additional options available through Galaxy, e-mail us at galaxy-bugs@bx.psu.edu.
378
379 ------
380
381 **Do you want to modify the reference name?**
382
383 This option allows you to set the name of the reference sequence manually. This is helpful when, for example, you would like to make the reference name compatible with the UCSC naming conventions to be able to display your lastz results as a custom track at the UCSC Genome Browser.
384
385 ------
386
387 **LASTZ parameter list**
388
389 This is an exhaustive list of LASTZ options. Once again, please note that not all options are included in this interface. If you would like to make additional options available through Galaxy, e-mail us at galaxy-bugs@bx.psu.edu::
390
391 target[[s..e]][-] spec/file containing target sequence (fasta or nib)
392 [s..e] defines a subrange of the file
393 - indicates reverse-complement
394 (use --help=files for more details)
395 query[[s..e]][-] spec/file containing query sequences (fasta or nib)
396 if absent, queries come from stdin (unless they
397 aren't needed, as for --self or --tableonly)
398 (use --help=files for more details)
399 --self the target sequence is also the query
400 --quantum the query sequence contains quantum DNA
401 --seed=match&lt;length&gt; use a word with no gaps instead of a seed pattern
402 --seed=half&lt;length&gt; use space-free half-weight word instead of seed pattern
403 --match=&lt;reward&gt;[,&lt;penalty&gt;] set the score values for a match (+&lt;reward&gt;)
404 and mismatch (-&lt;penalty&gt;)
405 --[no]trans[ition][=2] allow one or two transitions in a seed hit
406 (by default a transition is allowed)
407 --word=&lt;bits&gt; set max bits for word hash; use this to trade time for
408 memory, eliminating thrashing for heavy seeds
409 (default is 28 bits)
410 --[no]filter=[&lt;T&gt;:]&lt;M&gt; filter half-weight seed hits, requiring at least M
411 matches and allowing no more than T transversions
412 (default is no filtering)
413 --notwins require just one seed hit
414 --twins=[&lt;min&gt;:]&lt;maxgap&gt; require two nearby seed hits on the same diagonal
415 (default is twins aren't required)
416 --notwins allow single, isolated seeds
417 --[no]recoverseeds avoid losing seeds in hash collisions. Cannot be used with --twins
418 --seedqueue=&lt;entries&gt; set number of entries in seed hit queue
419 (default is 262144)
420 --anchors=&lt;file&gt; read anchors from a file, instead of discovering anchors
421 via seeding
422 --recoverhits recover hash-collision seed hits
423 (default is not to recover seed hits)
424 --step=&lt;length&gt; set step length (default is 1)
425 --maxwordcount=&lt;limit&gt; words occurring more often than &lt;limit&gt; in the target
426 are not eligible for seeds
427 --strand=both search both strands
428 --strand=plus search + strand only (matching strand of query spec)
429 --strand=minus search - strand only (opposite strand of query spec)
430 (by default both strands are searched)
431 --ambiguousn treat N as an ambiguous nucleotide
432 (by default N is treated as a sequence splicing character)
433 --[no]gfextend perform gap-free extension of seed hits to HSPs
434 (by default no extension is performed)
435 --[no]chain perform chaining
436 --chain=&lt;diag,anti&gt; perform chaining with given penalties for diagonal and
437 anti-diagonal
438 (by default no chaining is performed)
439 --[no]gapped perform gapped alignment (instead of gap-free)
440 (by default gapped alignment is performed)
441 --score[s]=&lt;file&gt; read substitution scores from a file
442 (default is HOXD70)
443 --unitscore[s] scores are +1/-1 for match/mismatch
444 --gap=&lt;[open,]extend&gt; set gap open and extend penalties (default is 400,30)
445 --xdrop=&lt;score&gt; set x-drop threshold (default is 10*sub[A][A])
446 --ydrop=&lt;score&gt; set y-drop threshold (default is open+300extend)
447 --infer[=&lt;control&gt;] infer scores from the sequences, then use them
448 --inferonly[=&lt;control&gt;] infer scores, but don't use them (requires --infscores)
449 all inference options are read from the control file
450 --infscores[=&lt;file&gt;] write inferred scores to a file
451 --hspthresh=&lt;score&gt; set threshold for high scoring pairs (default is 3000)
452 ungapped extensions scoring lower are discarded
453 &lt;score&gt; can also be a percentage or base count
454 --entropy adjust for entropy when qualifying HSPs in the x-drop extension
455 method
456 --noentropy don't adjust for entropy when qualifying HSPs
457 --exact=&lt;length&gt; set threshold for exact matches
458 if specified, exact matches are found rather than high
459 scoring pairs (replaces --hspthresh)
460 --inner=&lt;score&gt; set threshold for HSPs during interpolation
461 (default is no interpolation)
462 --gappedthresh=&lt;score&gt; set threshold for gapped alignments
463 gapped extensions scoring lower are discarded
464 &lt;score&gt; can also be a percentage or base count
465 (default is to use same value as --hspthresh)
466 --ball=&lt;score&gt; set minimum score required of words 'in' a quantum ball
467 --[no]entropy involve entropy in filtering high scoring pairs
468 (default is "entropy")
469 --[no]mirror report/use mirror image of all gap-free alignments
470 (default is "mirror" for self-alignments only)
471 --traceback=&lt;bytes&gt; space for trace-back information
472 (default is 80.0M)
473 --masking=&lt;count&gt; mask any position in target hit this many times
474 zero indicates no masking
475 (default is no masking)
476 --targetcapsule=&lt;capsule_file&gt; the target seed word position table and seed
477 (as well as the target sequence)are read from specified file
478 --segments=&lt;segment_file&gt; read segments from a file, instead of discovering
479 them via seeding. Replaces other seeding or gap-free extension
480 options
481 --[no]census[=&lt;file&gt;] count/report how many times each target base aligns
482 (default is to not report census)
483 --identity=&lt;min&gt;[..&lt;max&gt;] filter alignments by percent identity
484 0&lt;=min&lt;=max&lt;=100; blocks (or HSPs) outside min..max
485 are discarded
486 (default is no identity filtering)
487 --coverage=&lt;min&gt;[..&lt;max&gt;] filter alignments by percentage pf query covered
488 0&lt;=min&lt;=max&lt;=100; blocks (or HSPs) outside min..max
489 are discarded
490 (default is no query coverage filtering)
491 --notrivial do not output trivial self-alignment block if the target and query
492 sequences are identical. Using --self enables this option automatically
493 --output=&lt;output_file&gt; write the alignments to the specified file name instead of stdout
494 --code=&lt;file&gt; give quantum code for query sequence (only for display)
495 --format=&lt;type&gt; specify output format; one of lav, axt, maf, maf+, maf-, text,
496 lav+text, cigar, text, rdplot, general, or general:&lt;fields&gt;
497 (by default output is LAV)
498 --rdotplot=&lt;file&gt; create an additional output file suitable for plotting the alignments
499 with the R statistical package.
500 --markend Just before normal completion, write "# lastz end-of-file" to output file
501 --census[=&lt;output_file&gt;] count and report how many times each target base aligns, up
502 to 255. Ns are included in the count
503 --census16[=&lt;output_file&gt;] count and report how many times each target base aligns, up
504 up 65 thousand
505 --census32[=&lt;output_file&gt;] count and report how many times each target bas aligns, up
506 to 4 billion
507 --writecapsule=&lt;capsule_file&gt; just write out a target capsule file and quit; don't
508 search for seeds or perform subsequent stages
509 --verbosity=&lt;level&gt; set info level (0 is minimum, 10 is everything)
510 (default is 0)
511 --[no]runtime report runtime in the output file
512 (default is to not report runtime)
513 --tableonly[=count] just produce the target position table, don't
514 search for seeds
515 --[no]stats[=&lt;file&gt;] show search statistics (or don't)
516 (not available in this build)
517 --version report the program version and quit
518 --help list all options
519 --help=files list information about file specifiers
520 --help=short[cuts] list blastz-compatible shortcuts
521 --help=yasra list yasra-specific shortcuts
522
523 </help>
524 </tool>