--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tools/fasta_tools/fasta_compute_length.xml	Fri Mar 09 19:37:19 2012 -0500
@@ -0,0 +1,51 @@
+<tool id="fasta_compute_length" name="Compute sequence length">
+	<description></description>
+	<command interpreter="python">fasta_compute_length.py $input $output $keep_first</command>
+	<inputs>
+		<param name="input" type="data" format="fasta" label="Compute length for these sequences"/>
+		<param name="keep_first" type="integer" size="5" value="0" label="How many title characters to keep?" help="'0' = keep the whole thing"/>
+	</inputs>
+	<outputs>
+		<data name="output" format="tabular"/>
+	</outputs>
+	<tests>
+		<test>
+			<param name="input" value="454.fasta" />
+			<param name="keep_first" value="0"/>
+			<output name="output" file="fasta_tool_compute_length_1.out" />
+		</test>
+		
+		<test>
+			<param name="input" value="extract_genomic_dna_out1.fasta" />
+			<param name="keep_first" value="0"/>
+			<output name="output" file="fasta_tool_compute_length_2.out" />
+		</test>
+		
+		<test>
+			<param name="input" value="454.fasta" />
+			<param name="keep_first" value="14"/>
+			<output name="output" file="fasta_tool_compute_length_3.out" />
+		</test>
+	</tests>
+	<help>
+
+**What it does**
+
+This tool counts the length of each fasta sequence in the file. The output file has two columns per line (separated by tab): fasta titles and lengths of the sequences. The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry. 
+
+-----	
+
+**Example**
+
+Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run::
+
+    &gt;EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_
    TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG
    TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG
    &gt;EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_
    AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAAfa
+
+Running this tool while setting **How many characters to keep?** to **14** will produce this::
+	
+	EYKX4VC02EQLO5  108
+	EYKX4VC02D4GS2	 60
+
+
+	</help>
+</tool>
\ No newline at end of file