Mercurial > repos > xuebing > sharplabtool
diff tools/fastx_toolkit/fasta_clipping_histogram.xml @ 0:9071e359b9a3
Uploaded
| author | xuebing | 
|---|---|
| date | Fri, 09 Mar 2012 19:37:19 -0500 | 
| parents | |
| children | 
line wrap: on
 line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/fastx_toolkit/fasta_clipping_histogram.xml Fri Mar 09 19:37:19 2012 -0500 @@ -0,0 +1,104 @@ +<tool id="cshl_fasta_clipping_histogram" name="Length Distribution"> + <description>chart</description> + <requirements><requirement type="package">fastx_toolkit</requirement></requirements> + <command>fasta_clipping_histogram.pl $input $outfile</command> + + <inputs> + <param format="fasta" name="input" type="data" label="Library to analyze" /> + </inputs> + + <outputs> + <data format="png" name="outfile" metadata_source="input" /> + </outputs> +<help> + +**What it does** + +This tool creates a histogram image of sequence lengths distribution in a given fasta dataset file. + +**TIP:** Use this tool after clipping your library (with **FASTX Clipper tool**), to visualize the clipping results. + +----- + +**Output Examples** + +In the following library, most sequences are 24-mers to 27-mers. +This could indicate an abundance of endo-siRNAs (depending of course of what you've tried to sequence in the first place). + +.. image:: ./static/fastx_icons/fasta_clipping_histogram_1.png + + +In the following library, most sequences are 19,22 or 23-mers. +This could indicate an abundance of miRNAs (depending of course of what you've tried to sequence in the first place). + +.. image:: ./static/fastx_icons/fasta_clipping_histogram_2.png + + +----- + + +**Input Formats** + +This tool accepts short-reads FASTA files. The reads don't have to be short, but they do have to be on a single line, like so:: + + >sequence1 + AGTAGTAGGTGATGTAGAGAGAGAGAGAGTAG + >sequence2 + GTGTGTGTGGGAAGTTGACACAGTA + >sequence3 + CCTTGAGATTAACGCTAATCAAGTAAAC + + +If the sequences span over multiple lines:: + + >sequence1 + CAGCATCTACATAATATGATCGCTATTAAACTTAAATCTCCTTGACGGAG + TCTTCGGTCATAACACAAACCCAGACCTACGTATATGACAAAGCTAATAG + aactggtctttacctTTAAGTTG + +Use the **FASTA Width Formatter** tool to re-format the FASTA into a single-lined sequences:: + + >sequence1 + CAGCATCTACATAATATGATCGCTATTAAACTTAAATCTCCTTGACGGAGTCTTCGGTCATAACACAAACCCAGACCTACGTATATGACAAAGCTAATAGaactggtctttacctTTAAGTTG + + +----- + + + +**Multiplicity counts (a.k.a reads-count)** + +If the sequence identifier (the text after the '>') contains a dash and a number, it is treated as a multiplicity count value (i.e. how many times that individual sequence repeated in the original FASTA file, before collapsing). + +Example 1 - The following FASTA file *does not* have multiplicity counts:: + + >seq1 + GGATCC + >seq2 + GGTCATGGGTTTAAA + >seq3 + GGGATATATCCCCACACACACACAC + +Each sequence is counts as one, to produce the following chart: + +.. image:: ./static/fastx_icons/fasta_clipping_histogram_3.png + + +Example 2 - The following FASTA file have multiplicity counts:: + + >seq1-2 + GGATCC + >seq2-10 + GGTCATGGGTTTAAA + >seq3-3 + GGGATATATCCCCACACACACACAC + +The first sequence counts as 2, the second as 10, the third as 3, to produce the following chart: + +.. image:: ./static/fastx_icons/fasta_clipping_histogram_4.png + +Use the **FASTA Collapser** tool to create FASTA files with multiplicity counts. + +</help> +</tool> +<!-- FASTA-Clipping-Histogram is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
