Mercurial > repos > xuebing > sharplabtool
diff tools/next_gen_conversion/fastq_conversions.xml @ 0:9071e359b9a3
Uploaded
author | xuebing |
---|---|
date | Fri, 09 Mar 2012 19:37:19 -0500 |
parents | |
children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/next_gen_conversion/fastq_conversions.xml Fri Mar 09 19:37:19 2012 -0500 @@ -0,0 +1,133 @@ +<tool id="fastq_conversions" name="FASTQ Conversions" version="1.0.0"> + <description>converts between FASTQ data and other data formats</description> + <command interpreter="python"> + fastq_conversions.py + --command=$conversionType.type + --input=$input + #if $conversionType.type == "sol2std": + --outputFastqsanger=$outputFastqsanger + #else: + --outputFastqsanger="None" + #end if + #if $conversionType.type == "std2sol": + --outputFastqsolexa=$outputFastqsolexa + #else: + --outputFastqsolexa="None" + #end if + #if $conversionType.type == "fq2fa": + --outputFasta=$outputFasta + #else: + --outputFasta="None" + #end if + </command> + <inputs> + <conditional name="conversionType"> + <param name="type" type="select" label="What type of conversion do you want to do?"> + <option value="sol2std">Solexa/Illumina FASTQ to standard Sanger FASTQ</option> + <option value="std2sol">Standard Sanger FASTQ to Solexa/Illumina FASTQ</option> + <option value="fq2fa">Various FASTQ to FASTA</option> + </param> + <when value="sol2std"> + <param name="input" type="data" format="fastqsolexa" label="File to convert" /> + </when> + <when value="std2sol"> + <param name="input" type="data" format="fastqsanger" label="File to convert" /> + </when> + <when value="fq2fa"> + <param name="input" type="data" format="fastqsolexa, fastqsanger" label="File to convert" /> + </when> + </conditional> + </inputs> + <outputs> + <data name="outputFastqsanger" format="fastqsanger"> + <filter>conversionType['type'] == 'sol2std'</filter> + </data> + <data name="outputFastqsolexa" format="fastqsolexa"> + <filter>conversionType['type'] == 'std2sol'</filter> + </data> + <data name="outputFasta" format="fasta"> + <filter>conversionType['type'] == 'fq2fa'</filter> + </data> + </outputs> + <tests> + <test> + <param name="type" value="sol2std" /> + <param name="input" value="fastq_conv_in1.fastq" ftype="fastqsolexa" /> + <output name="outputFastqsanger" file="fastq_conv_out1.fastqsanger" /> + </test> + <test> + <param name="type" value="std2sol" /> + <param name="input" value="1.fastqsanger" ftype="fastqsanger" /> + <output name="outputFastqsolexa" file="fastq_conv_out2.fastqsolexa" /> + </test> + <test> + <param name="type" value="fq2fa" /> + <param name="input" value="1.fastqsanger" ftype="fastqsanger" /> + <output name="outputFasta" file="fastq_conv_out4.fasta" /> + </test> + </tests> + <help> +**What it does** + +This tool offers several conversions options relating to the FASTQ format. + +----- + +**Examples** + +- Converting the Solexa/Illumina FASTQ data:: + + @081017-and-081020:1:1:1715:1759 + GGACTCAGATAGTAATCCACGCTCCTTTAAAATATC + + + II#IIIIIII$5+.(9IIIIIII$%*$G$A31I&&B + +- will produce the following Sanger FASTQ data:: + + @081017-and-081020:1:1:1715:1759 + GGACTCAGATAGTAATCCACGCTCCTTTAAAATATC + + + ++!+++++++!!!!!"+++++++!!!!)!%!!+!!%! + +- Converting standard Sanger FASTQ:: + + @1831_573_1004/1 + AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG + + + ><C&&9952+C>5<.?<79,=42<292:<(9/-7 + @1831_573_1050/1 + TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT + + + ;@@17?@=>7??@A8?==@4A?A4)&+.'&+'1, + +- will produce the following Solexa/Illumina FASTQ data:: + + @1831_573_1004/1 + AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG + + + ][bEEXXTQJb]T[M^[VXK\SQ[QXQY[GXNLV + @1831_573_1050/1 + TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT + + + Z__PV^_\]V^^_`W^\\_S`^`SHEJMFEJFPK + +- Converting the Sanger FASTQ data:: + + @1831_573_1004/1 + AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG + + + ><C&&9952+C>5<.?<79,=42<292:<(9/-7 + @1831_573_1050/1 + TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT + + + ;@@17?@=>7??@A8?==@4A?A4)&+.'&+'1, + +- will produce the following FASTA data:: + + >1831_573_1004/1 + AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG + >1831_573_1050/1 + TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT + + </help> +</tool>