Mercurial > repos > xuebing > sharplabtool
view tools/fastx_toolkit/fasta_nucleotide_changer.xml @ 0:9071e359b9a3
Uploaded
author | xuebing |
---|---|
date | Fri, 09 Mar 2012 19:37:19 -0500 |
parents | |
children |
line wrap: on
line source
<tool id="cshl_fasta_nucleotides_changer" name="RNA/DNA" > <description>converter</description> <requirements><requirement type="package">fastx_toolkit</requirement></requirements> <command>zcat -f '$input' | fasta_nucleotide_changer $mode -v -o $output</command> <inputs> <param format="fasta" name="input" type="data" label="Library to convert" /> <param name="mode" type="select" label="Convert"> <option value="-d">RNA to DNA (U to T)</option> <option value="-r">DNA to RNA (T to U)</option> </param> </inputs> <!-- Functional tests with param value starting with - fail. <tests> <test> <param name="input" value="fasta_nuc_changer1.fasta" /> <param name="mode" value="-r" /> <output name="output" file="fasta_nuc_change1.out" /> </test> <test> <param name="input" value="fasta_nuc_changer2.fasta" /> <param name="mode" value="-d" /> <output name="output" file="fasta_nuc_change2.out" /> </test> </tests> --> <outputs> <data format="input" name="output" metadata_source="input" /> </outputs> <help> **What it does** This tool converts RNA FASTA files to DNA (and vice-versa). In **RNA-to-DNA** mode, U's are changed into T's. In **DNA-to-RNA** mode, T's are changed into U's. -------- **Example** Input RNA FASTA file ( from Sanger's mirBase ):: >cel-let-7 MIMAT0000001 Caenorhabditis elegans let-7 UGAGGUAGUAGGUUGUAUAGUU >cel-lin-4 MIMAT0000002 Caenorhabditis elegans lin-4 UCCCUGAGACCUCAAGUGUGA >cel-miR-1 MIMAT0000003 Caenorhabditis elegans miR-1 UGGAAUGUAAAGAAGUAUGUA Output DNA FASTA file (with RNA-to-DNA mode):: >cel-let-7 MIMAT0000001 Caenorhabditis elegans let-7 TGAGGTAGTAGGTTGTATAGTT >cel-lin-4 MIMAT0000002 Caenorhabditis elegans lin-4 TCCCTGAGACCTCAAGTGTGA >cel-miR-1 MIMAT0000003 Caenorhabditis elegans miR-1 TGGAATGTAAAGAAGTATGTA </help> </tool>