Mercurial > repos > xuebing > sharplabtool
view tools/fasta_tools/tabular_to_fasta.xml @ 2:c2a356708570
Uploaded
author | xuebing |
---|---|
date | Fri, 09 Mar 2012 19:45:42 -0500 |
parents | 9071e359b9a3 |
children |
line wrap: on
line source
<tool id="tab2fasta" name="Tabular-to-FASTA" version="1.1.0"> <description>converts tabular file to FASTA format</description> <command interpreter="python">tabular_to_fasta.py $input $title_col $seq_col $output </command> <inputs> <param name="input" type="data" format="tabular" label="Tab-delimited file"/> <param name="title_col" type="data_column" data_ref="input" multiple="True" numerical="False" label="Title column(s)" help="Multi-select list - hold the appropriate key while clicking to select multiple columns"/> <param name="seq_col" type="data_column" data_ref="input" numerical="False" label="Sequence column" /> </inputs> <outputs> <data name="output" format="fasta"/> </outputs> <tests> <test> <param name="input" value="solexa.tabular" /> <param name="title_col" value="1,2,3,4" /> <param name="seq_col" value="5" /> <output name="output" file="tabular_to_fasta_out1.fasta" /> </test> </tests> <help> **What it does** Converts tab delimited data into FASTA formatted sequences. ----------- **Example** Suppose this is a sequence file produced by Illumina (Solexa) sequencer:: 5 300 902 419 GACTCATGATTTCTTACCTATTAGTGGTTGAACATC 5 300 880 431 GTGATATGTATGTTGACGGCCATAAGGCTGCTTCTT Selecting **c3** and **c4** as the **Title column(s)** and **c5** as the **Sequence column** will result in:: >902_419 GACTCATGATTTCTTACCTATTAGTGGTTGAACATC >880_431 GTGATATGTATGTTGACGGCCATAAGGCTGCTTCTT </help> </tool>