Mercurial > repos > xuebing > sharplabtool
view tools/maf/maf_to_fasta.xml @ 2:c2a356708570
Uploaded
| author | xuebing |
|---|---|
| date | Fri, 09 Mar 2012 19:45:42 -0500 |
| parents | 9071e359b9a3 |
| children |
line wrap: on
line source
<tool id="MAF_To_Fasta1" name="MAF to FASTA" version="1.0.1"> <description>Converts a MAF formatted file to FASTA format</description> <command interpreter="python"> #if $fasta_target_type.fasta_type == "multiple" #maf_to_fasta_multiple_sets.py $input1 $out_file1 $fasta_target_type.species $fasta_target_type.complete_blocks #else #maf_to_fasta_concat.py $fasta_target_type.species $input1 $out_file1 #end if# </command> <inputs> <param format="maf" name="input1" type="data" label="MAF file to convert"/> <conditional name="fasta_target_type"> <param name="fasta_type" type="select" label="Type of FASTA Output"> <option value="multiple" selected="true">Multiple Blocks</option> <option value="concatenated">One Sequence per Species</option> </param> <when value="multiple"> <param name="species" type="select" label="Select species" display="checkboxes" multiple="true" help="checked taxa will be included in the output"> <options> <filter type="data_meta" ref="input1" key="species" /> </options> </param> <param name="complete_blocks" type="select" label="Choose to"> <option value="partial_allowed">include blocks with missing species</option> <option value="partial_disallowed">exclude blocks with missing species</option> </param> </when> <when value="concatenated"> <param name="species" type="select" label="Species to extract" display="checkboxes" multiple="true"> <options> <filter type="data_meta" ref="input1" key="species" /> </options> </param> </when> </conditional> </inputs> <outputs> <data format="fasta" name="out_file1" /> </outputs> <tests> <test> <param name="input1" value="3.maf" ftype="maf"/> <param name="fasta_type" value="concatenated"/> <param name="species" value="canFam1"/> <output name="out_file1" file="cf_maf2fasta_concat.dat" ftype="fasta"/> </test> <test> <param name="input1" value="4.maf" ftype="maf"/> <param name="fasta_type" value="multiple"/> <param name="species" value="hg17,panTro1,rheMac2,rn3,mm7,canFam2,bosTau2,dasNov1"/> <param name="complete_blocks" value="partial_allowed"/> <output name="out_file1" file="cf_maf2fasta_new.dat" ftype="fasta"/> </test> </tests> <help> **Types of MAF to FASTA conversion** * **Multiple Blocks** converts a single MAF block to a single FASTA block. For example, if you have 6 MAF blocks, they will be converted to 6 FASTA blocks. * **One Sequence per Species** converts MAF blocks to a single aggregated FASTA block. For example, if you have 6 MAF blocks, they will be converted and concatenated into a single FASTA block. ------- **What it does** This tool converts MAF blocks to FASTA format and concatenates them into a single FASTA block or outputs multiple FASTA blocks separated by empty lines. The interface for this tool contains two pages (steps): * **Step 1 of 2**. Choose multiple alignments from history to be converted to FASTA format. * **Step 2 of 2**. Choose the type of output as well as the species from the alignment to be included in the output. Multiple Block output has additional options: * **Choose species** - the tool reads the alignment provided during Step 1 and generates a list of species contained within that alignment. Using checkboxes you can specify taxa to be included in the output (all species are selected by default). * **Choose to include/exclude blocks with missing species** - if an alignment block does not contain any one of the species you selected within **Choose species** menu and this option is set to **exclude blocks with missing species**, then such a block **will not** be included in the output (see **Example 2** below). For example, if you want to extract human, mouse, and rat from a series of alignments and one of the blocks does not contain mouse sequence, then this block will not be converted to FASTA and will not be returned. ----- **Example 1**: In the concatenated approach, the following alignment:: ##maf version=1 a score=68686.000000 s hg18.chr20 56827368 75 + 62435964 GACAGGGTGCATCTGGGAGGG---CCTGCCGGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- s panTro2.chr20 56528685 75 + 62293572 GACAGGGTGCATCTGAGAGGG---CCTGCCAGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- s rheMac2.chr10 89144112 69 - 94855758 GACAGGGTGCATCTGAGAGGG---CCTGCTGGGCCTTTG-TTCAAAACTAGATATGCCCCAACTCCAATTCTA------- s mm8.chr2 173910832 61 + 181976762 AGAAGGATCCACCT------------TGCTGGGCCTCTGCTCCAGCAAGACCCACCTCCCAACTCAAATGCCC------- s canFam2.chr24 46551822 67 + 50763139 CG------GCGTCTGTAAGGGGCCACCGCCCGGCCTGTG-CTCAAAGCTACAAATGACTCAACTCCCAACCGA------C a score=10289.000000 s hg18.chr20 56827443 37 + 62435964 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG s panTro2.chr20 56528760 37 + 62293572 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG s rheMac2.chr10 89144181 37 - 94855758 ATGTGCGGAAAATGTGATACAGAAACCTGCAGAGCAG will be converted to (**note** that because mm8 (mouse) and canFam2 (dog) are absent from the second block, they are replaced with gaps after concatenation):: >canFam2 CG------GCGTCTGTAAGGGGCCACCGCCCGGCCTGTG-CTCAAAGCTACAAATGACTCAACTCCCAACCGA------C------------------------------------- >hg18 GACAGGGTGCATCTGGGAGGG---CCTGCCGGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC-ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG >mm8 AGAAGGATCCACCT------------TGCTGGGCCTCTGCTCCAGCAAGACCCACCTCCCAACTCAAATGCCC-------------------------------------------- >panTro2 GACAGGGTGCATCTGAGAGGG---CCTGCCAGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC-ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG >rheMac2 GACAGGGTGCATCTGAGAGGG---CCTGCTGGGCCTTTG-TTCAAAACTAGATATGCCCCAACTCCAATTCTA-------ATGTGCGGAAAATGTGATACAGAAACCTGCAGAGCAG ------ **Example 2a**: Multiple Block Approach **Include all species** and **include blocks with missing species**: The following alignment:: ##maf version=1 a score=68686.000000 s hg18.chr20 56827368 75 + 62435964 GACAGGGTGCATCTGGGAGGG---CCTGCCGGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- s panTro2.chr20 56528685 75 + 62293572 GACAGGGTGCATCTGAGAGGG---CCTGCCAGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- s rheMac2.chr10 89144112 69 - 94855758 GACAGGGTGCATCTGAGAGGG---CCTGCTGGGCCTTTG-TTCAAAACTAGATATGCCCCAACTCCAATTCTA------- s mm8.chr2 173910832 61 + 181976762 AGAAGGATCCACCT------------TGCTGGGCCTCTGCTCCAGCAAGACCCACCTCCCAACTCAAATGCCC------- s canFam2.chr24 46551822 67 + 50763139 CG------GCGTCTGTAAGGGGCCACCGCCCGGCCTGTG-CTCAAAGCTACAAATGACTCAACTCCCAACCGA------C a score=10289.000000 s hg18.chr20 56827443 37 + 62435964 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG s panTro2.chr20 56528760 37 + 62293572 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG s rheMac2.chr10 89144181 37 - 94855758 ATGTGCGGAAAATGTGATACAGAAACCTGCAGAGCAG will be converted to:: >hg18.chr20(+):56827368-56827443|hg18_0 GACAGGGTGCATCTGGGAGGG---CCTGCCGGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- >panTro2.chr20(+):56528685-56528760|panTro2_0 GACAGGGTGCATCTGAGAGGG---CCTGCCAGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- >rheMac2.chr10(-):89144112-89144181|rheMac2_0 GACAGGGTGCATCTGAGAGGG---CCTGCTGGGCCTTTG-TTCAAAACTAGATATGCCCCAACTCCAATTCTA------- >mm8.chr2(+):173910832-173910893|mm8_0 AGAAGGATCCACCT------------TGCTGGGCCTCTGCTCCAGCAAGACCCACCTCCCAACTCAAATGCCC------- >canFam2.chr24(+):46551822-46551889|canFam2_0 CG------GCGTCTGTAAGGGGCCACCGCCCGGCCTGTG-CTCAAAGCTACAAATGACTCAACTCCCAACCGA------C >hg18.chr20(+):56827443-56827480|hg18_1 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG >panTro2.chr20(+):56528760-56528797|panTro2_1 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG >rheMac2.chr10(-):89144181-89144218|rheMac2_1 ATGTGCGGAAAATGTGATACAGAAACCTGCAGAGCAG ----- **Example 2b**: Multiple Block Approach **Include hg18 and mm8** and **exclude blocks with missing species**: The following alignment:: ##maf version=1 a score=68686.000000 s hg18.chr20 56827368 75 + 62435964 GACAGGGTGCATCTGGGAGGG---CCTGCCGGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- s panTro2.chr20 56528685 75 + 62293572 GACAGGGTGCATCTGAGAGGG---CCTGCCAGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- s rheMac2.chr10 89144112 69 - 94855758 GACAGGGTGCATCTGAGAGGG---CCTGCTGGGCCTTTG-TTCAAAACTAGATATGCCCCAACTCCAATTCTA------- s mm8.chr2 173910832 61 + 181976762 AGAAGGATCCACCT------------TGCTGGGCCTCTGCTCCAGCAAGACCCACCTCCCAACTCAAATGCCC------- s canFam2.chr24 46551822 67 + 50763139 CG------GCGTCTGTAAGGGGCCACCGCCCGGCCTGTG-CTCAAAGCTACAAATGACTCAACTCCCAACCGA------C a score=10289.000000 s hg18.chr20 56827443 37 + 62435964 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG s panTro2.chr20 56528760 37 + 62293572 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG s rheMac2.chr10 89144181 37 - 94855758 ATGTGCGGAAAATGTGATACAGAAACCTGCAGAGCAG will be converted to (**note** that the second MAF block, which does not have mm8, is not included in the output):: >hg18.chr20(+):56827368-56827443|hg18_0 GACAGGGTGCATCTGGGAGGGCCTGCCGGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC >mm8.chr2(+):173910832-173910893|mm8_0 AGAAGGATCCACCT---------TGCTGGGCCTCTGCTCCAGCAAGACCCACCTCCCAACTCAAATGCCC------ ------ .. class:: infomark **About formats** **MAF format** multiple alignment format file. This format stores multiple alignments at the DNA level between entire genomes. - The .maf format is line-oriented. Each multiple alignment ends with a blank line. - Each sequence in an alignment is on a single line. - Lines starting with # are considered to be comments. - Each multiple alignment is in a separate paragraph that begins with an "a" line and contains an "s" line for each sequence in the multiple alignment. - Some MAF files may contain two optional line types: - An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line; - An "e" line containing information about the size of the gap between the alignments that span the current block. ------ **Citation** If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ </help> </tool>