Mercurial > repos > xuebing > sharplabtool
view tools/maf/maf_to_interval.xml @ 2:c2a356708570
Uploaded
author | xuebing |
---|---|
date | Fri, 09 Mar 2012 19:45:42 -0500 |
parents | 9071e359b9a3 |
children |
line wrap: on
line source
<tool id="MAF_To_Interval1" name="MAF to Interval" force_history_refresh="True"> <description>Converts a MAF formatted file to the Interval format</description> <command interpreter="python">maf_to_interval.py $input1 $out_file1 $out_file1.id $__new_file_path__ $input1.dbkey $species $input1.metadata.species $complete_blocks $remove_gaps</command> <inputs> <param format="maf" name="input1" type="data" label="MAF file to convert"/> <param name="species" type="select" label="Select additional species" display="checkboxes" multiple="true" help="The species matching the dbkey of the alignment is always included. A separate history item will be created for each species."> <options> <filter type="data_meta" ref="input1" key="species" /> <filter type="remove_value" meta_ref="input1" key="dbkey" /> </options> </param> <param name="complete_blocks" type="select" label="Exclude blocks which have a species missing"> <option value="partial_allowed">include blocks with missing species</option> <option value="partial_disallowed">exclude blocks with missing species</option> </param> <param name="remove_gaps" type="select" label="Remove Gap characters from sequences"> <option value="keep_gaps">keep gaps</option> <option value="remove_gaps">remove gaps</option> </param> </inputs> <outputs> <data format="interval" name="out_file1" /> </outputs> <tests> <test> <param name="input1" value="4.maf" dbkey="hg17"/> <param name="complete_blocks" value="partial_disallowed"/> <param name="remove_gaps" value="keep_gaps"/> <param name="species" value="panTro1" /> <output name="out_file1" file="maf_to_interval_out_hg17.interval"/> <output name="out_file1" file="maf_to_interval_out_panTro1.interval"/> </test> </tests> <help> **What it does** This tool converts every MAF block to a set of genomic intervals describing the position of that alignment block within a corresponding genome. Sequences from aligning species are also included in the output. The interface for this tool contains several options: * **MAF file to convert**. Choose multiple alignments from history to be converted to BED format. * **Choose species**. Choose additional species from the alignment to be included in the output * **Exclude blocks which have a species missing**. if an alignment block does not contain any one of the species found in the alignment set and this option is set to **exclude blocks with missing species**, then coordinates of such a block **will not** be included in the output (see **Example 2** below). * **Remove Gap characters from sequences**. Gaps can be removed from sequences before they are output. ----- **Example 1**: **Include only reference genome** (hg18 in this case) and **include blocks with missing species**: For the following alignment:: ##maf version=1 a score=68686.000000 s hg18.chr20 56827368 75 + 62435964 GACAGGGTGCATCTGGGAGGG---CCTGCCGGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- s panTro2.chr20 56528685 75 + 62293572 GACAGGGTGCATCTGAGAGGG---CCTGCCAGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- s rheMac2.chr10 89144112 69 - 94855758 GACAGGGTGCATCTGAGAGGG---CCTGCTGGGCCTTTG-TTCAAAACTAGATATGCCCCAACTCCAATTCTA------- s mm8.chr2 173910832 61 + 181976762 AGAAGGATCCACCT------------TGCTGGGCCTCTGCTCCAGCAAGACCCACCTCCCAACTCAAATGCCC------- s canFam2.chr24 46551822 67 + 50763139 CG------GCGTCTGTAAGGGGCCACCGCCCGGCCTGTG-CTCAAAGCTACAAATGACTCAACTCCCAACCGA------C a score=10289.000000 s hg18.chr20 56827443 37 + 62435964 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG s panTro2.chr20 56528760 37 + 62293572 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG s rheMac2.chr10 89144181 37 - 94855758 ATGTGCGGAAAATGTGATACAGAAACCTGCAGAGCAG the tool will create **a single** history item containing the following (**note** the name field is numbered iteratively: hg18_0_0, hg18_1_0 etc. where the first number is the block number and the second number is the iteration through the block (if a species appears twice in a block, that interval will be repeated) and sequences for each species are included in the order specified in the header: the field is left empty when no sequence is available for that species):: #chrom start end strand score name canFam2 hg18 mm8 panTro2 rheMac2 chr20 56827368 56827443 + 68686.0 hg18_0_0 CG------GCGTCTGTAAGGGGCCACCGCCCGGCCTGTG-CTCAAAGCTACAAATGACTCAACTCCCAACCGA------C GACAGGGTGCATCTGGGAGGG---CCTGCCGGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- AGAAGGATCCACCT------------TGCTGGGCCTCTGCTCCAGCAAGACCCACCTCCCAACTCAAATGCCC------- GACAGGGTGCATCTGAGAGGG---CCTGCCAGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- GACAGGGTGCATCTGAGAGGG---CCTGCTGGGCCTTTG-TTCAAAACTAGATATGCCCCAACTCCAATTCTA------- chr20 56827443 56827480 + 10289.0 hg18_1_0 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG ATGTGCGGAAAATGTGATACAGAAACCTGCAGAGCAG ----- **Example 2**: **Include hg18 and mm8** and **exclude blocks with missing species**: For the following alignment:: ##maf version=1 a score=68686.000000 s hg18.chr20 56827368 75 + 62435964 GACAGGGTGCATCTGGGAGGG---CCTGCCGGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- s panTro2.chr20 56528685 75 + 62293572 GACAGGGTGCATCTGAGAGGG---CCTGCCAGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- s rheMac2.chr10 89144112 69 - 94855758 GACAGGGTGCATCTGAGAGGG---CCTGCTGGGCCTTTG-TTCAAAACTAGATATGCCCCAACTCCAATTCTA------- s mm8.chr2 173910832 61 + 181976762 AGAAGGATCCACCT------------TGCTGGGCCTCTGCTCCAGCAAGACCCACCTCCCAACTCAAATGCCC------- s canFam2.chr24 46551822 67 + 50763139 CG------GCGTCTGTAAGGGGCCACCGCCCGGCCTGTG-CTCAAAGCTACAAATGACTCAACTCCCAACCGA------C a score=10289.000000 s hg18.chr20 56827443 37 + 62435964 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG s panTro2.chr20 56528760 37 + 62293572 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG s rheMac2.chr10 89144181 37 - 94855758 ATGTGCGGAAAATGTGATACAGAAACCTGCAGAGCAG the tool will create **two** history items (one for hg18 and one for mm8) containing the following (**note** that both history items contain only one line describing the first alignment block. The second MAF block is not included in the output because it does not contain mm8): History item **1** (for hg18):: #chrom start end strand score name canFam2 hg18 mm8 panTro2 rheMac2 chr20 56827368 56827443 + 68686.0 hg18_0_0 CG------GCGTCTGTAAGGGGCCACCGCCCGGCCTGTG-CTCAAAGCTACAAATGACTCAACTCCCAACCGA------C GACAGGGTGCATCTGGGAGGG---CCTGCCGGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- AGAAGGATCCACCT------------TGCTGGGCCTCTGCTCCAGCAAGACCCACCTCCCAACTCAAATGCCC------- GACAGGGTGCATCTGAGAGGG---CCTGCCAGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- GACAGGGTGCATCTGAGAGGG---CCTGCTGGGCCTTTG-TTCAAAACTAGATATGCCCCAACTCCAATTCTA------- History item **2** (for mm8):: #chrom start end strand score name canFam2 hg18 mm8 panTro2 rheMac2 chr2 173910832 173910893 + 68686.0 mm8_0_0 CG------GCGTCTGTAAGGGGCCACCGCCCGGCCTGTG-CTCAAAGCTACAAATGACTCAACTCCCAACCGA------C GACAGGGTGCATCTGGGAGGG---CCTGCCGGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- AGAAGGATCCACCT------------TGCTGGGCCTCTGCTCCAGCAAGACCCACCTCCCAACTCAAATGCCC------- GACAGGGTGCATCTGAGAGGG---CCTGCCAGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- GACAGGGTGCATCTGAGAGGG---CCTGCTGGGCCTTTG-TTCAAAACTAGATATGCCCCAACTCCAATTCTA------- ------- .. class:: infomark **About formats** **MAF format** multiple alignment format file. This format stores multiple alignments at the DNA level between entire genomes. - The .maf format is line-oriented. Each multiple alignment ends with a blank line. - Each sequence in an alignment is on a single line. - Lines starting with # are considered to be comments. - Each multiple alignment is in a separate paragraph that begins with an "a" line and contains an "s" line for each sequence in the multiple alignment. - Some MAF files may contain two optional line types: - An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line; - An "e" line containing information about the size of the gap between the alignments that span the current block. ------ **Citation** If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ </help> </tool>