Mercurial > repos > xuebing > sharplabtool
view tools/fastx_toolkit/fastx_renamer.xml @ 1:cdcb0ce84a1b
Uploaded
author | xuebing |
---|---|
date | Fri, 09 Mar 2012 19:45:15 -0500 |
parents | 9071e359b9a3 |
children |
line wrap: on
line source
<tool id="cshl_fastx_renamer" name="Rename sequences" version="0.0.11" > <description></description> <requirements><requirement type="package">fastx_toolkit</requirement></requirements> <command>zcat -f $input | fastx_renamer -n $TYPE -o $output -v #if $input.ext == "fastqsanger": -Q 33 #end if </command> <inputs> <param format="fastqsolexa,fasta,fastqsanger" name="input" type="data" label="FASTQ/A Library to rename" /> <param name="TYPE" type="select" label="Rename sequence identifiers to"> <option value="SEQ">Nucleotides sequence</option> <option value="COUNT">Numeric Counter</option> </param> </inputs> <outputs> <data format="input" name="output" metadata_source="input" /> </outputs> <help> **What it does** This tool renames the sequence identifiers in a FASTQ/A file. .. class:: infomark Use this tool at the beginning of your workflow, as a way to keep the original sequence (before trimming, clipping, barcode-removal, etc). -------- **Example** The following Solexa-FASTQ file:: @CSHL_4_FC042GAMMII_2_1_517_596 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT +CSHL_4_FC042GAMMII_2_1_517_596 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 Renamed to **nucleotides sequence**:: @GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT +GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 Renamed to **numeric counter**:: @1 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT +1 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 ------ This tool is based on `FASTX-toolkit`__ by Assaf Gordon. .. __: http://hannonlab.cshl.edu/fastx_toolkit/ </help> </tool> <!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->