Mercurial > repos > youngkim > ezbamqc
view ezBAMQC/src/htslib/faidx.5 @ 5:0c5c414c3407
Uploaded
author | cshl-bsr |
---|---|
date | Tue, 29 Mar 2016 15:33:54 -0400 |
parents | dfa3745e5fd8 |
children |
line wrap: on
line source
'\" t .TH faidx 5 "August 2013" "htslib" "Bioinformatics formats" .SH NAME faidx \- an index enabling random access to FASTA files .\" .\" Copyright (C) 2013 Genome Research Ltd. .\" .\" Author: John Marshall <jm18@sanger.ac.uk> .\" .\" Permission is hereby granted, free of charge, to any person obtaining a .\" copy of this software and associated documentation files (the "Software"), .\" to deal in the Software without restriction, including without limitation .\" the rights to use, copy, modify, merge, publish, distribute, sublicense, .\" and/or sell copies of the Software, and to permit persons to whom the .\" Software is furnished to do so, subject to the following conditions: .\" .\" The above copyright notice and this permission notice shall be included in .\" all copies or substantial portions of the Software. .\" .\" THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR .\" IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, .\" FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL .\" THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER .\" LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING .\" FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER .\" DEALINGS IN THE SOFTWARE. .\" .SH SYNOPSIS .IR file.fa .fai, .IR file.fasta .fai .SH DESCRIPTION Using an \fBfai index\fP file in conjunction with a FASTA file containing reference sequences enables efficient access to arbitrary regions within those reference sequences. The index file typically has the same filename as the corresponding FASTA file, with \fB.fai\fP appended. .P An \fBfai index\fP file is a text file consisting of lines each with five TAB-delimited columns: .TS lbl. NAME Name of this reference sequence LENGTH Total length of this reference sequence, in bases OFFSET Offset within the FASTA file of this sequence's first base LINEBASES The number of bases on each line LINEWIDTH The number of bytes in each line, including the newline .TE .P The \fBNAME\fP and \fBLENGTH\fP columns contain the same data as would appear in the \fBSN\fP and \fBLN\fP fields of a SAM \fB@SQ\fP header for the same reference sequence. .P The \fBOFFSET\fP column contains the offset within the FASTA file, in bytes starting from zero, of the first base of this reference sequence, i.e., of the character following the newline at the end of the "\fB>\fP" header line. Typically the lines of a \fBfai index\fP file appear in the order in which the reference sequences appear in the FASTA file, so \fB.fai\fP files are typically sorted according to this column. .P The \fBLINEBASES\fP column contains the number of bases in each of the sequence lines that form the body of this reference sequence, apart from the final line which may be shorter. The \fBLINEWIDTH\fP column contains the number of \fIbytes\fP in each of the sequence lines (except perhaps the final line), thus differing from \fBLINEBASES\fP in that it also counts the bytes forming the line terminator. .SS FASTA Files In order to be indexed with \fBsamtools faidx\fP, a FASTA file must be a text file of the form .LP .RS .RI > name .RI [ description ...] .br ATGCATGCATGCATGCATGCATGCATGCAT .br GCATGCATGCATGCATGCATGCATGCATGC .br ATGCAT .br .RI > name .RI [ description ...] .br ATGCATGCATGCAT .br GCATGCATGCATGC .br [...] .RE .LP In particular, each reference sequence must be "well-formatted", i.e., all of its sequence lines must be the same length, apart from the final sequence line which may be shorter. (While this sequence line length must be the same within each sequence, it may vary between different reference sequences in the same FASTA file.) .P This also means that although the FASTA file may have Unix- or Windows-style or other line termination, the newline characters present must be consistent, at least within each reference sequence. .P The \fBsamtools\fP implementation uses the first word of the "\fB>\fP" header line text (i.e., up to the first whitespace character) as the \fBNAME\fP column. At present, there may be no whitespace between the ">" character and the \fIname\fP. .SH EXAMPLE For example, given this FASTA file .LP .RS >one .br ATGCATGCATGCATGCATGCATGCATGCAT .br GCATGCATGCATGCATGCATGCATGCATGC .br ATGCAT .br >two another chromosome .br ATGCATGCATGCAT .br GCATGCATGCATGC .br .RE .LP formatted with Unix-style (LF) line termination, the corresponding fai index would be .RS .TS lnnnn. one 66 5 30 31 two 28 98 14 15 .TE .RE .LP If the FASTA file were formatted with Windows-style (CR-LF) line termination, the fai index would be .RS .TS lnnnn. one 66 6 30 32 two 28 103 14 16 .TE .RE .SH SEE ALSO .IR samtools (1) .TP http://en.wikipedia.org/wiki/FASTA_format Further description of the FASTA format