--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/SMART/Java/Python/structure/test/Test_Sequence.py	Fri Jan 18 04:54:14 2013 -0500
@@ -0,0 +1,90 @@
+# Copyright INRA (Institut National de la Recherche Agronomique)
+# http://www.inra.fr
+# http://urgi.versailles.inra.fr
+#
+# This software is governed by the CeCILL license under French law and
+# abiding by the rules of distribution of free software.  You can  use, 
+# modify and/ or redistribute the software under the terms of the CeCILL
+# license as circulated by CEA, CNRS and INRIA at the following URL
+# "http://www.cecill.info". 
+#
+# As a counterpart to the access to the source code and  rights to copy,
+# modify and redistribute granted by the license, users are provided only
+# with a limited warranty  and the software's author,  the holder of the
+# economic rights,  and the successive licensors  have only  limited
+# liability. 
+#
+# In this respect, the user's attention is drawn to the risks associated
+# with loading,  using,  modifying and/or developing or reproducing the
+# software by the user in light of its specific status of free software,
+# that may mean  that it is complicated to manipulate,  and  that  also
+# therefore means  that it is reserved for developers  and  experienced
+# professionals having in-depth computer knowledge. Users are therefore
+# encouraged to load and test the software's suitability as regards their
+# requirements in conditions enabling the security of their systems and/or 
+# data to be ensured and,  more generally, to use and operate it in the 
+# same conditions as regards security. 
+#
+# The fact that you are presently reading this means that you have had
+# knowledge of the CeCILL license and that you accept its terms.
+
+
+import unittest
+from SMART.Java.Python.structure.Sequence import Sequence
+
+
+class Test_Sequence(unittest.TestCase):
+    
+    def setUp(self):
+        self._bs = Sequence()
+        self._bs1 = Sequence()
+    
+    def test_getSize(self):
+        self._bs.setName("sequence1")
+        self._bs.setSequence("AGCGGACGATGCAGCATGCGAATGACGATA")
+        obsSize = self._bs.getSize()
+        expSize = 30
+        self.assertEquals( expSize, obsSize )   
+    
+    def test_concatenate(self):
+        self._bs.setName("sequence")
+        self._bs.setSequence("GATGTGCAGACTTTTCACGCAGGACTACATCACTGT")
+        self._bs.setQuality("WWWVVVWPWWWVWWWWVVVVKVPWWVVWVWUUQUTQ")
+        self._bs1.setName("sequence1")
+        self._bs1.setSequence("GGAAACATATGCACATAAACGTTGAAATCATGCTTA")
+        self._bs1.setQuality("WWWWWWWWWWWWWWWWWVWWVWWVWWWWWWUUUUUU")
+        self._bs.concatenate(self._bs1)
+        expSeq = "GATGTGCAGACTTTTCACGCAGGACTACATCACTGTGGAAACATATGCACATAAACGTTGAAATCATGCTTA"
+        expQal = "WWWVVVWPWWWVWWWWVVVVKVPWWVVWVWUUQUTQWWWWWWWWWWWWWWWWWVWWVWWVWWWWWWUUUUUU"
+        self.assertEquals(expSeq, self._bs.getSequence())
+        self.assertEquals(expQal, self._bs.getQuality())
+
+    def test_reverseComplement(self):
+        self._bs.setName("seq1")
+        self._bs.setSequence("TACGGC")
+        exp = "GCCGTA"
+        self._bs.reverseComplement()
+        obs = self._bs.getSequence()
+        self.assertEquals(exp, obs)
+
+    def test_containsAmbiguousNucleotides(self):
+        self._bs.setName("seq1")
+        self._bs.setSequence("WCGTUacgtu")
+        self.assertTrue (self._bs.containsAmbiguousNucleotides())
+
+    def test_shrinkToFirstNucleotides(self):
+        self._bs.setName("seq1")
+        self._bs.setSequence("WCGTUacgtu")
+        self._bs.shrinkToFirstNucleotides(3)
+        expSeq = "WCG"
+        self.assertEquals(expSeq, self._bs.getSequence())
+        
+    def test_shrinkToLastNucleotides(self):
+        self._bs.setName("seq1")
+        self._bs.setSequence("WCGTUacgtu")
+        self._bs.shrinkToLastNucleotides(5)
+        expSeq = "acgtu"
+        self.assertEquals(expSeq, self._bs.getSequence())
+        
+if __name__ == "__main__":
+    unittest.main()