diff smart_toolShed/commons/core/coord/test/Test_MatchUtils.py @ 0:e0f8dcca02ed

Uploaded S-MART tool. A toolbox manages RNA-Seq and ChIP-Seq data.
author yufei-luo
date Thu, 17 Jan 2013 10:52:14 -0500
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/smart_toolShed/commons/core/coord/test/Test_MatchUtils.py	Thu Jan 17 10:52:14 2013 -0500
@@ -0,0 +1,439 @@
+# Copyright INRA (Institut National de la Recherche Agronomique)
+# http://www.inra.fr
+# http://urgi.versailles.inra.fr
+#
+# This software is governed by the CeCILL license under French law and
+# abiding by the rules of distribution of free software.  You can  use, 
+# modify and/ or redistribute the software under the terms of the CeCILL
+# license as circulated by CEA, CNRS and INRIA at the following URL
+# "http://www.cecill.info". 
+#
+# As a counterpart to the access to the source code and  rights to copy,
+# modify and redistribute granted by the license, users are provided only
+# with a limited warranty  and the software's author,  the holder of the
+# economic rights,  and the successive licensors  have only  limited
+# liability. 
+#
+# In this respect, the user's attention is drawn to the risks associated
+# with loading,  using,  modifying and/or developing or reproducing the
+# software by the user in light of its specific status of free software,
+# that may mean  that it is complicated to manipulate,  and  that  also
+# therefore means  that it is reserved for developers  and  experienced
+# professionals having in-depth computer knowledge. Users are therefore
+# encouraged to load and test the software's suitability as regards their
+# requirements in conditions enabling the security of their systems and/or 
+# data to be ensured and,  more generally, to use and operate it in the 
+# same conditions as regards security. 
+#
+# The fact that you are presently reading this means that you have had
+# knowledge of the CeCILL license and that you accept its terms.
+
+
+import unittest
+import os
+from commons.core.utils.FileUtils import FileUtils
+from commons.core.coord.MatchUtils import MatchUtils
+from commons.core.coord.Match import Match
+from commons.core.seq.BioseqDB import BioseqDB
+
+
+class Test_MatchUtils( unittest.TestCase ):
+    
+    def test_getMatchListFromFile( self ):
+        inFile = "dummyInFile"
+        inFileHandler = open( inFile, "w" )
+        inFileHandler.write( "query.name\tquery.start\tquery.end\tquery.length\tquery.length.%\tmatch.length.%\tsubject.name\tsubject.start\tsubject.end\tsubject.length\tsubject.length.%\tE.value\tScore\tIdentity\tpath\n" )
+        m1 = Match()
+        m1.setFromTuple( ("QName", 1, 5, 5, 0.1, 0.2, "SName1", 5, 25, 20, 0.15, 1e-20, 15, 87.2, 1) )
+        m1.write( inFileHandler )
+        m2 = Match()
+        m2.setFromTuple( ("QName", 1, 5, 5, 0.1, 0.2, "SName2", 5, 25, 20, 0.15, 1e-20, 15, 87.2, 1) )
+        m2.write( inFileHandler )
+        inFileHandler.close()
+        
+        lExp = [ m1, m2 ]
+        
+        lObs = MatchUtils.getMatchListFromFile( inFile )
+        
+        self.assertEquals( lExp, lObs )
+        
+        os.remove( inFile )
+        
+    def test_getDictOfListsWithSubjectAsKey( self ):
+        m1 = Match()
+        m1.setFromTuple( ("QName", 1, 5, 5, 0.1, 0.2, "SName1", 5, 25, 20, 0.15, 1e-20, 15, 87.2, 1) )
+        m2 = Match()
+        m2.setFromTuple( ("QName", 1, 5, 5, 0.1, 0.2, "SName2", 5, 25, 20, 0.15, 1e-20, 15, 87.2, 1) )
+        lMatch = [ m1, m2 ]
+        
+        dExp = { "SName1": [ m1 ], "SName2": [ m2 ] }
+        
+        dObs = MatchUtils.getDictOfListsWithSubjectAsKey( lMatch )
+        
+        self.assertEquals( dExp, dObs )
+        
+    def test_getDictOfListsWithQueryAsKey( self ):
+        m1 = Match()
+        m1.setFromTuple( ("QName1", 1, 5, 5, 0.1, 0.2, "SName1", 5, 25, 20, 0.15, 1e-20, 15, 87.2, 1) )
+        m2 = Match()
+        m2.setFromTuple( ("QName2", 1, 5, 5, 0.1, 0.2, "SName2", 5, 25, 20, 0.15, 1e-20, 15, 87.2, 1) )
+        m3 = Match()
+        m3.setFromTuple( ("QName1", 1, 5, 5, 0.1, 0.2, "SName3", 5, 25, 20, 0.15, 1e-20, 15, 87.2, 1) )
+        lMatch = [ m1, m2, m3 ]
+        
+        dExp = { "QName1": [ m1, m3 ], "QName2": [ m2 ] }
+        
+        dObs = MatchUtils.getDictOfListsWithQueryAsKey( lMatch )
+        
+        self.assertEquals( dExp, dObs )
+    
+    def test_getIdListFromMatchList( self ):
+        m1 = Match()
+        m1.setFromTuple( ("QName", 1, 5, 5, 0.1, 0.2, "SName1", 5, 25, 20, 0.15, 1e-20, 15, 87.2, 1) )
+        m2 = Match()
+        m2.setFromTuple( ("QName", 1, 5, 5, 0.1, 0.2, "SName2", 5, 25, 20, 0.15, 1e-20, 15, 87.2, 10) )
+        lMatch = [ m1, m2 ]  
+        
+        lExp = [1, 10]       
+        
+        lObs = MatchUtils.getIdListFromMatchList( lMatch )
+        
+        self.assertEquals(lExp, lObs)
+        
+    def test_getIdListFromMatchList_empty_list( self ):
+        lMatch = []  
+        lExp = []       
+        
+        lObs = MatchUtils.getIdListFromMatchList( lMatch )
+        
+        self.assertEquals(lExp, lObs)
+        
+    def test_writeListInFile_without_header( self ):
+        m1 = Match()
+        m1.setFromTuple( ("QName", 1, 5, 5, 0.1, 0.2, "SName1", 5, 25, 20, 0.15, 1e-20, 15, 87.2, 1) )
+        m2 = Match()
+        m2.setFromTuple( ("QName", 1, 5, 5, 0.1, 0.2, "SName2", 5, 25, 20, 0.15, 1e-20, 15, 87.2, 10) )
+        lMatch = [ m1, m2 ]  
+        
+        line1 = "QName\t1\t5\t5\t0.100000\t0.200000\tSName1\t5\t25\t20\t0.150000\t1e-20\t15\t87.200000\t1\n"
+        line2 = "QName\t1\t5\t5\t0.100000\t0.200000\tSName2\t5\t25\t20\t0.150000\t1e-20\t15\t87.200000\t10\n"
+        
+        expFileName = "expFileName.match"
+        expFileHandle = open ( expFileName, 'w' )
+        expFileHandle.write(line1)
+        expFileHandle.write(line2)
+        expFileHandle.close()
+        
+        obsFileName = "obsFileName.match"
+        
+        MatchUtils.writeListInFile( lMatch, obsFileName )
+        
+        self.assertTrue( FileUtils.are2FilesIdentical( expFileName, obsFileName ) )
+        
+        os.remove( obsFileName )
+        os.remove( expFileName )
+
+    def test_writeListInFile_with_header( self ):
+        m1 = Match()
+        m1.setFromTuple( ("QName", 1, 5, 5, 0.1, 0.2, "SName1", 5, 25, 20, 0.15, 1e-20, 15, 87.2, 1) )
+        m2 = Match()
+        m2.setFromTuple( ("QName", 1, 5, 5, 0.1, 0.2, "SName2", 5, 25, 20, 0.15, 1e-20, 15, 87.2, 10) )
+        lMatch = [ m1, m2 ]  
+        
+        headerLine = "query.name\tquery.start\tquery.end\tquery.length\tquery.length.%\tmatch.length.%\tsubject.name\tsubject.start\tsubject.end\tsubject.length\tsubject.length.%\tE.value\tScore\tIdentity\tpath\n"
+        
+        line1 = headerLine
+        line2 = "QName\t1\t5\t5\t0.100000\t0.200000\tSName1\t5\t25\t20\t0.150000\t1e-20\t15\t87.200000\t1\n"
+        line3 = "QName\t1\t5\t5\t0.100000\t0.200000\tSName2\t5\t25\t20\t0.150000\t1e-20\t15\t87.200000\t10\n"
+        
+        expFileName = "expFileName.match"
+        expFileHandle = open ( expFileName, 'w' )
+        expFileHandle.write(line1)
+        expFileHandle.write(line2)
+        expFileHandle.write(line3)
+        expFileHandle.close()
+        
+        obsFileName = "obsFileName.match"
+        
+        MatchUtils.writeListInFile( lMatch, obsFileName, header=headerLine )
+        
+        self.assertTrue( FileUtils.are2FilesIdentical( expFileName, obsFileName ) )
+        
+        os.remove( obsFileName )
+        os.remove( expFileName )
+        
+    def test_writeListInFile_with_append_mode( self ):
+        m1 = Match()
+        m1.setFromTuple( ("QName", 1, 5, 5, 0.1, 0.2, "SName1", 5, 25, 20, 0.15, 1e-20, 15, 87.2, 1) )
+        m2 = Match()
+        m2.setFromTuple( ("QName", 1, 5, 5, 0.1, 0.2, "SName2", 5, 25, 20, 0.15, 1e-20, 15, 87.2, 10) )
+        lMatch = [ m1, m2 ]  
+        
+        line1 = "QName\t1\t5\t5\t0.100000\t0.200000\tSName1\t5\t25\t20\t0.150000\t1e-20\t15\t87.200000\t1\n"
+        line2 = "QName\t1\t5\t5\t0.100000\t0.200000\tSName2\t5\t25\t20\t0.150000\t1e-20\t15\t87.200000\t10\n"
+        
+        expFileName = "expFileName.match"
+        expFileHandle = open ( expFileName, 'w' )
+        expFileHandle.write(line1)
+        expFileHandle.write(line1)
+        expFileHandle.write(line2)
+        expFileHandle.close()
+        
+        obsFileName = "obsFileName.match"
+        obsFileHandle = open ( obsFileName, 'w' )
+        obsFileHandle.write(line1)
+        obsFileHandle.close()
+        
+        MatchUtils.writeListInFile( lMatch, obsFileName, 'a' )
+        
+        self.assertTrue( FileUtils.are2FilesIdentical( expFileName, obsFileName ) )
+        
+        os.remove( obsFileName )
+        os.remove( expFileName )       
+
+    def test_rmvDuplicateMatches(self):
+        m1 = Match()
+        m1.setFromTuple( ("QName", 1, 5, 5, 0.1, 0.2, "SName", 5, 25, 20, 0.15, 1e-20, 15, 87.2, 1) )
+        m2 = Match()
+        m2.setFromTuple( ("QName", 1, 5, 5, 0.1, 0.2, "SName2", 5, 25, 20, 0.15, 1e-20, 15, 86.2, 1) )
+        m3 = Match()
+        m3.setFromTuple( ("QName", 1, 5, 5, 0.1, 0.2, "SName", 5, 25, 20, 0.15, 1e-20, 15, 87.2, 1) )
+        lMatch = [ m1, m3, m2 ]  
+        
+        lExp = [m1, m2]
+        lObs = MatchUtils.rmvDuplicateMatches(lMatch)
+        
+        self.assertEquals(lExp, lObs)
+        
+    def test_filterDiffQrySbj_same_seq(self):
+        fastaFileName = "file.fa"
+        self._writeFastaFile(fastaFileName)
+        qryDB = BioseqDB(fastaFileName)
+        tabFileName = "file.tab"
+        self._writeMatchFile(tabFileName)
+        
+        expListToKeep = ["HELITRON2"]
+        obsListToKeep = MatchUtils.filterDiffQrySbj(qryDB,tabFileName, 0.95, 0.98, 2)
+        self.assertEquals(expListToKeep, obsListToKeep)
+        os.remove(fastaFileName)
+        os.remove(tabFileName)
+
+    def test_filterDiffQrySbj_TE_included_in_67percent_in_other_TE(self):
+        fastaFileName = "file.fa"
+        self._writeFastaFile2(fastaFileName)
+        qryDB = BioseqDB(fastaFileName)
+        tabFileName = "file.tab"
+        self._writeMatchFile2(tabFileName)
+        expListToKeep = []
+        obsListToKeep = MatchUtils.filterDiffQrySbj(qryDB, tabFileName, 0.95, 0.98, 2)
+        self.assertEquals(expListToKeep, obsListToKeep)
+        os.remove(fastaFileName)
+        os.remove(tabFileName)
+        
+    def test_getNbDistinctSequencesInsideMatchesWithThresh_query(self):
+        tabFileName = "file.tab"
+        self._writeMatchFile3(tabFileName)
+        lMatches = MatchUtils.getMatchListFromFile(tabFileName)
+        expNbDistinctMatches = 1
+        obsNbDistinctMatches = MatchUtils.getNbDistinctSequencesInsideMatchesWithThresh(lMatches,0.95, 0.98,"query")
+        self.assertEquals(expNbDistinctMatches, obsNbDistinctMatches)
+        os.remove(tabFileName)
+        
+    def test_getNbDistinctSequencesInsideMatchesWithThresh_subject(self):
+        tabFileName = "file.tab"
+        self._writeMatchFile3(tabFileName)
+        lMatches = MatchUtils.getMatchListFromFile(tabFileName)
+        expNbDistinctMatches = 1
+        obsNbDistinctMatches = MatchUtils.getNbDistinctSequencesInsideMatchesWithThresh(lMatches,0.95, 0.98,"subject")
+        self.assertEquals(expNbDistinctMatches, obsNbDistinctMatches)
+        os.remove(tabFileName)
+        
+    def test_convertMatchFileToAlignFile(self):
+        inputMatchFileName = "file.tab"
+        expAlignFileName = "expected.align"
+        obsAlignFileName = "file.align"
+        
+        self._writeExpAlignFile(expAlignFileName)
+        self._writeMatchFile4(inputMatchFileName)
+        MatchUtils.convertMatchFileToAlignFile(inputMatchFileName)
+        
+        self.assertTrue(FileUtils.are2FilesIdentical(expAlignFileName, obsAlignFileName))
+        
+        os.remove(inputMatchFileName)
+        os.remove(expAlignFileName)
+        os.remove(obsAlignFileName)
+    
+    def test_convertMatchFileToAlignFile_empty_file(self):
+        inputMatchFileName = "file.tab"
+        expAlignFileName = "expected.align"
+        obsAlignFileName = "file.align"
+        
+        f = open(expAlignFileName, "w")
+        f.close()
+        f = open(inputMatchFileName, "w")
+        f.close()
+        MatchUtils.convertMatchFileToAlignFile(inputMatchFileName)
+        
+        self.assertTrue(FileUtils.are2FilesIdentical(expAlignFileName, obsAlignFileName))
+        
+        os.remove(inputMatchFileName)
+        os.remove(expAlignFileName)
+        os.remove(obsAlignFileName)
+            
+    def test_generateMatchFileWithNewPathId(self):
+        inputMatchFileName = "file.tab"
+        expMatchFileName = "expected.tab"
+        obsMatchFileName = "obsFile.tab"
+        
+        self._writeMatchFile5(inputMatchFileName)
+        self._writeExpMatchFile(expMatchFileName)        
+        MatchUtils.generateMatchFileWithNewPathId(inputMatchFileName, obsMatchFileName)
+        
+        self.assertTrue(FileUtils.are2FilesIdentical(expMatchFileName, obsMatchFileName))
+        
+        os.remove(inputMatchFileName)
+        os.remove(expMatchFileName)
+        os.remove(obsMatchFileName)
+        
+    def test_generateMatchFileWithNewPathId_empty_file(self):
+        inputMatchFileName = "file.tab"
+        expMatchFileName = "expected.tab"
+        obsMatchFileName = "obsFile.tab"
+        
+        f = open(expMatchFileName, "w")
+        f.write("query.name\tquery.start\tquery.end\tquery.length\tquery.length.%\tmatch.length.%\tsubject.name\tsubject.start\tsubject.end\tsubject.length\tsubject.length.%\tE.value\tScore\tIdentity\tpath\n")
+        f.close()
+        f = open(inputMatchFileName, "w")
+        f.close()
+        MatchUtils.generateMatchFileWithNewPathId(inputMatchFileName, obsMatchFileName)
+        
+        self.assertTrue(FileUtils.are2FilesIdentical(expMatchFileName, obsMatchFileName))
+        
+        os.remove(inputMatchFileName)
+        os.remove(expMatchFileName)
+        os.remove(obsMatchFileName)
+        
+    def test_convertMatchFileIntoABCFileOnQueryCoverage(self):
+        matchFileName = "dummy.tab"
+        with open(matchFileName, "w") as f:
+            f.write("query.name\tquery.start\tquery.end\tquery.length\tquery.length.%\tmatch.length.%\tsubject.name\tsubject.start\tsubject.end\tsubject.length\tsubject.length.%\tE.value\tScore\tIdentity\tpath\n")
+            f.write("chr3\t1\t100\t100\t0.98\t0.95\tchr5\t11\t110\t100\t0.95\t1e-52\t133\t87.200000\n")
+            f.write("chr7\t1\t200\t200\t0.98\t0.95\tchr2\t11\t210\t200\t0.95\t1e-78\t235\t98.900000\n")
+            f.write("chr5\t1\t100\t100\t0.95\t0.95\tchr3\t11\t110\t100\t0.98\t1e-52\t133\t87.200000\n")
+            f.write("chr2\t1\t200\t200\t0.95\t0.95\tchr7\t11\t210\t200\t0.98\t1e-78\t235\t98.900000\n")
+        expFileName = "exp.abc"
+        with open(expFileName, "w") as f:
+            f.write("chr3\tchr5\t0.98\n")
+            f.write("chr7\tchr2\t0.98\n")
+            f.write("chr5\tchr3\t0.95\n")
+            f.write("chr2\tchr7\t0.95\n")
+        obsFileName = "obs.abc"
+        
+        MatchUtils.convertMatchFileIntoABCFileOnQueryCoverage(matchFileName, obsFileName)
+        
+        self.assertTrue(FileUtils.are2FilesIdentical(expFileName, obsFileName))
+        
+        os.remove(matchFileName)
+        os.remove(expFileName)
+        os.remove(obsFileName)
+        
+    def test_convertMatchFileIntoABCFileOnQueryCoverage_coverage_threshold_85(self):
+        matchFileName = "dummy.tab"
+        with open(matchFileName, "w") as f:
+            f.write("query.name\tquery.start\tquery.end\tquery.length\tquery.length.%\tmatch.length.%\tsubject.name\tsubject.start\tsubject.end\tsubject.length\tsubject.length.%\tE.value\tScore\tIdentity\tpath\n")
+            f.write("chr3\t1\t100\t100\t0.98\t0.95\tchr5\t11\t110\t100\t0.95\t1e-52\t133\t87.200000\n")
+            f.write("chr7\t1\t200\t200\t0.98\t0.95\tchr2\t11\t210\t200\t0.95\t1e-78\t235\t98.900000\n")
+            f.write("chr5\t1\t100\t100\t0.85\t0.95\tchr3\t11\t110\t100\t0.98\t1e-52\t133\t87.200000\n")
+            f.write("chr2\t1\t200\t200\t0.80\t0.95\tchr7\t11\t210\t200\t0.98\t1e-78\t235\t98.900000\n")
+        expFileName = "exp.abc"
+        with open(expFileName, "w") as f:
+            f.write("chr3\tchr5\t0.98\n")
+            f.write("chr7\tchr2\t0.98\n")
+            f.write("chr5\tchr3\t0.85\n")
+        obsFileName = "obs.abc"
+        
+        MatchUtils.convertMatchFileIntoABCFileOnQueryCoverage(matchFileName, obsFileName, coverage = 0.85)
+        
+        self.assertTrue(FileUtils.are2FilesIdentical(expFileName, obsFileName))
+        
+        os.remove(matchFileName)
+        os.remove(expFileName)
+        os.remove(obsFileName)
+        
+    def _writeFastaFile(self, fileName):
+        f = open(fileName, "w")
+        f.write(">HELITRON3\n")
+        f.write("GGCCAGTCACAATGGGGGTTTCACTGGTGTGTCATGCACATTTAATAGGGGTAAGACTGA\n")
+        f.write("ATAAAAAATGATTATTTGCATGAAATGGGGATGAGAGAGAAGGAAAGAGTTTCATCCTGG\n")
+        f.write("GATTCGTTTCATTCACCGGATCTCTTGCGTCCGCCTCCGCCGTGCGACCTCCGCATTCTC\n")
+        f.write(">HELITRON2\n")
+        f.write("GGCCAGTCACAATGGGGGTTTCACTGGTGTGTCATGCACATTTAATAGGGGTAAGACTGA\n")
+        f.write("ATAAAAAATGATTATTTGCATGAAATGGGGATGAGAGAGAAGGAAAGAGTTTCATCCTGG\n")
+        f.write("GATTCGTTTCATTCACCGGATCTCTTGCGTCCGCCTCCGCCGTGCGACCTCCGCATTCTC\n")
+        f.close()
+
+    def _writeMatchFile(self, fileName):
+        f = open(fileName, "w")
+        f.write("query.name\tquery.start\tquery.end\tquery.length\tquery.length.%\tmatch.length.%\tsubject.name\tsubject.start\tsubject.end\tsubject.length\tsubject.length.%\tE.value\tScore\tIdentity\tpath\n")
+        f.write("HELITRON3\t1\t180\t180\t1\t1\tHELITRON2\t1\t180\t180\t1\t2e-103\t357\t100\t1\n")
+        f.close()
+        
+    def _writeFastaFile2(self, fileName):
+        f = open(fileName, "w")
+        f.write(">header2\n")
+        f.write("TTTCACTGGTGTGTCATGCACATTTAATAGGGGTAAGACTGAATAAAAAATGATTATTTG\n")
+        f.write("CATGAAATGGGGATGAGAGAGAAGGAAAGAGTTTCATCCTGGGATTCGTTTCATTCACCG\n")
+        f.close()
+
+    def _writeMatchFile2(self, fileName):
+        f = open(fileName, "w")
+        f.write("query.name\tquery.start\tquery.end\tquery.length\tquery.length.%\tmatch.length.%\tsubject.name\tsubject.start\tsubject.end\tsubject.length\tsubject.length.%\tE.value\tScore\tIdentity\tpath\n")
+        f.write("header2\t1\t120\t120\t1\t0.674157\tBS31790\t19\t138\t120\t0.674157\t3e-68\t238\t100\t1\n")
+        f.close()
+        
+    def _writeMatchFile3(self, fileName):
+        f = open(fileName, "w")
+        f.write("query.name\tquery.start\tquery.end\tquery.length\tquery.length.%\tmatch.length.%\tsubject.name\tsubject.start\tsubject.end\tsubject.length\tsubject.length.%\tE.value\tScore\tIdentity\tpath\n")
+        f.write("header2\t1\t120\t120\t0.674157\t0.674157\tBS31790\t19\t138\t120\t0.674157\t3e-68\t238\t100\t1\n")
+        f.write("header3\t1\t120\t120\t0.99\t0.994157\tBS31790\t19\t138\t120\t0.994157\t3e-68\t238\t100\t1\n")
+        f.write("header4\t1\t120\t120\t1\t0.94157\tBS31790\t19\t138\t120\t0.674157\t3e-68\t238\t67\t1\n")
+        f.close()
+        
+    def _writeMatchFile4(self, fileName):
+        f = open(fileName, "w")
+        f.write("query.name\tquery.start\tquery.end\tquery.length\tquery.length.%\tmatch.length.%\tsubject.name\tsubject.start\tsubject.end\tsubject.length\tsubject.length.%\tE.value\tScore\tIdentity\tpath\n")
+        f.write("header2\t1\t120\t120\t0.674157\t0.674157\tBS31790\t19\t138\t120\t0.674157\t3e-68\t238\t100\t1\n")
+        f.write("header3\t120\t220\t120\t0.99\t0.994157\tBS31790\t19\t138\t120\t0.994157\t3e-65\t238\t100\t1\n")
+        f.write("header4\t1\t120\t120\t1\t0.94157\tBS31790\t19\t138\t120\t0.674157\t3e-67\t244\t90\t1\n")
+        f.close()
+        
+    def _writeExpAlignFile(self,fileName):
+        f = open(fileName, "w")
+        f.write("header2\t1\t120\tBS31790\t19\t138\t3e-68\t238.0\t100.0\n")
+        f.write("header3\t120\t220\tBS31790\t19\t138\t3e-65\t238.0\t100.0\n")
+        f.write("header4\t1\t120\tBS31790\t19\t138\t3e-67\t244.0\t90.0\n")
+        f.close()
+        
+    def _writeMatchFile5(self,fileName):
+        f = open(fileName, "w")
+        f.write("query.name\tquery.start\tquery.end\tquery.length\tquery.length.%\tmatch.length.%\tsubject.name\tsubject.start\tsubject.end\tsubject.length\tsubject.length.%\tE.value\tScore\tIdentity\tpath\n")
+        f.write("header2\t1\t120\t120\t0.674157\t0.674157\tBS31790\t19\t138\t120\t0.674157\t3e-68\t238\t100\t1\n")
+        f.write("header2\t124\t144\t120\t0.674157\t0.674157\tBS31790\t19\t138\t120\t0.674157\t3e-68\t238\t100\t1\n")
+        f.write("header3\t120\t220\t120\t0.99\t0.994157\tBS31790\t19\t138\t120\t0.994157\t3e-65\t238\t100\t1\n")
+        f.write("header4\t1\t120\t120\t1\t0.94157\tBS31790\t19\t138\t120\t0.674157\t3e-67\t244\t90\t1\n")
+        f.close()
+        
+    def _writeExpMatchFile(self,fileName):
+        f = open(fileName, "w")
+        f.write("query.name\tquery.start\tquery.end\tquery.length\tquery.length.%\tmatch.length.%\tsubject.name\tsubject.start\tsubject.end\tsubject.length\tsubject.length.%\tE.value\tScore\tIdentity\tpath\n")
+        f.write("header2\t1\t120\t120\t0.674157\t0.674157\tBS31790\t19\t138\t120\t0.674157\t3e-68\t238\t100.000000\t1\n")
+        f.write("header2\t124\t144\t120\t0.674157\t0.674157\tBS31790\t19\t138\t120\t0.674157\t3e-68\t238\t100.000000\t1\n")
+        f.write("header3\t120\t220\t120\t0.990000\t0.994157\tBS31790\t19\t138\t120\t0.994157\t3e-65\t238\t100.000000\t2\n")
+        f.write("header4\t1\t120\t120\t1.000000\t0.941570\tBS31790\t19\t138\t120\t0.674157\t3e-67\t244\t90.000000\t3\n")
+        f.close()
+    
+
+test_suite = unittest.TestSuite()
+test_suite.addTest( unittest.makeSuite( Test_MatchUtils ) )
+if __name__ == "__main__":
+    unittest.TextTestRunner(verbosity=2).run( test_suite )