Mercurial > repos > abims-sbr > oligator
view test-data/oligator_results.csv @ 0:a811f7256f6e draft default tip
planemo upload for repository https://github.com/abims-sbr/tools-abims/tree/master/tools/oligator commit b7e63a01570e9fc381abb01d5b176fcea024e251
| author | abims-sbr |
|---|---|
| date | Fri, 27 Apr 2018 08:42:52 -0400 |
| parents | |
| children |
line wrap: on
line source
zga_344_GH3 CAAGATAAAGCACGACCTTCCGAC Tm = 72 The oligo length is 24 nucleotide(s) zga_344_Fn3 GAAACGGTGGTCCAACTGTATGTG Tm = 72 The oligo length is 24 nucleotide(s) zga_347_GH3 CAAAGCAAGCAAAAGATATATCACAAA Tm = 70 The oligo length is 27 nucleotide(s) zga_347_Fn3 GAAATCGTTCAGCTTTATTTTTCGGA Tm = 70 The oligo length is 26 nucleotide(s) zga_3720_GH3 AGTAGTACCCTACCCTATATCGAAG Tm = 72 The oligo length is 25 nucleotide(s) zga_3720_UNK AGCCTAAACCTAAAAATAGCCGAAAA Tm = 70 The oligo length is 26 nucleotide(s) zga_3745_GH3 CAACATCCTTTGGTGACCAAAGAC Tm = 70 The oligo length is 24 nucleotide(s) zga_3745_linker GACCTGAATTCGAGAACCGATGAC Tm = 72 The oligo length is 24 nucleotide(s) zga_3745_beta CAGTTGATTTTCGGGGCCATCCC Tm = 72 The oligo length is 23 nucleotide(s) zga_3745_GH3linker CAACATCCTTTGGTGACCAAAGAC Tm = 70 The oligo length is 24 nucleotide(s) zga_3818_GH3 CAAGAAACGATAGAAGCGGTGGAG Tm = 72 The oligo length is 24 nucleotide(s) zga_3818_Fn3 GTGGTACAGTTATATCTACGGGATG Tm = 72 The oligo length is 25 nucleotide(s) zga_42 TGTAAGGAAGAGCGAAAAGAAATTATA Tm = 70 The oligo length is 27 nucleotide(s) zga_369 TGTTCGAGTGATGATGACCAATCG Tm = 70 The oligo length is 24 nucleotide(s) zga_518_CBM48 CCGCAAGTTACCGTTTTCAGTCTT Tm = 70 The oligo length is 24 nucleotide(s) zga_518_GH13 GATAAGGACGGAAATTTTCTCACTTA Tm = 70 The oligo length is 26 nucleotide(s) zga_530 TACGAAAACACCGAACGAAAATGGT Tm = 70 The oligo length is 25 nucleotide(s) zga_1248 GGCGGAAGTAAAAAAAAGGTCGTTT Tm = 70 The oligo length is 25 nucleotide(s) zga_1626 GATTGCGCCATTTTTTATCATATTTATC Tm = 72 The oligo length is 28 nucleotide(s) zga_314 TGCTCCAATTCCGAAATCAAGGTAG Tm = 72 The oligo length is 25 nucleotide(s) zga_316 TGTGGAGCAGTGAAAAAAACGGATA Tm = 70 The oligo length is 25 nucleotide(s) zga_355 TGTTCGGGAGATAAGAACATGGAG Tm = 70 The oligo length is 24 nucleotide(s) zga_368 CAACAATTGAAATCGCCCAACGGT Tm = 70 The oligo length is 24 nucleotide(s) zga_2429 TGTAAAGTGCCTTCCCATACTTATAT Tm = 70 The oligo length is 26 nucleotide(s) zga_3602 TGCAAAAATGCGACCGAGGAAAAAA Tm = 70 The oligo length is 25 nucleotide(s) zga_4653 AAAATATCAGCAATAAAAACATACCCTA Tm = 70 The oligo length is 28 nucleotide(s) zga_4655 TGTGGCCGCGAGCCGTCAAATG Tm = 72 The oligo length is 22 nucleotide(s) zga_4657 AAAACGACACAGACAGATTTCGGTG Tm = 72 The oligo length is 25 nucleotide(s) zga_4658 GGTACAAGTATAAAATCGGTTGACTG Tm = 72 The oligo length is 26 nucleotide(s) zga_4661 AGCATATTGAATCAATTTAGCCTGAAA Tm = 70 The oligo length is 27 nucleotide(s) zga_4662 AAAGCAACTGTTTACAAAGGAAACAAA Tm = 70 The oligo length is 27 nucleotide(s) zga_4668 TGTAGTGATGATTTTCTTAATGAGGAG Tm = 72 The oligo length is 27 nucleotide(s) zga_3523 AAATTTAAGCCAGTGGTAAAACATGTA Tm = 70 The oligo length is 27 nucleotide(s) zga_3572 GAATATGAGGCGCCCTTCCCCT Tm = 70 The oligo length is 22 nucleotide(s) zga_3629 CAAGAAAAACCGAACATCATCCTTTT Tm = 70 The oligo length is 26 nucleotide(s) zga_517 ATAACCAATACTGAGCTAGAATATAAAG Tm = 72 The oligo length is 28 nucleotide(s) RB12343 GAATTGTGGGATCATCGCGACGT Tm = 70 The oligo length is 23 nucleotide(s) RB548 AGTTTTGCGATGGTTGATTCGCTG Tm = 70 The oligo length is 24 nucleotide(s) RB2638 AATTCGCAGCTTTCATTATCGACCA Tm = 70 The oligo length is 25 nucleotide(s) RB2986 CATGGGCGGAACATGGCGACTG Tm = 72 The oligo length is 22 nucleotide(s) RB4894 GATTTGAATTCGCAACGTCGTGTTT Tm = 70 The oligo length is 25 nucleotide(s) RB5196 ACCATGAACGCAATGCTCACCAAC Tm = 72 The oligo length is 24 nucleotide(s) RB5200_S6PP AATTCCACGATCGCATCCAACCC Tm = 70 The oligo length is 23 nucleotide(s) RB5200_GH13 ACGTCGCCCCTCAATGCGACC Tm = 70 The oligo length is 21 nucleotide(s) RB9292 GATCTTCAGTTCGCCTACTCCCC Tm = 72 The oligo length is 23 nucleotide(s) RB2160 TCGCCTCACGTTCACCTTTGCTT Tm = 70 The oligo length is 23 nucleotide(s) zga_4659 TCAGGAATTAAAGAATACCAACTATTTA Tm = 70 The oligo length is 28 nucleotide(s) RB10507 GCAGAAGAGACGACGATCGTGTC Tm = 72 The oligo length is 23 nucleotide(s) zga_314_antisens TTTGGCGTCAGTCTTGTAGGTAATA Tm = 70 The oligo length is 25 nucleotide(s) zga_42_antisens TTCTTTGTGTTCTAAAAGTGCGATGT Tm = 70 The oligo length is 26 nucleotide(s) zga_316_antisens TTGCCCACTTCCTTCTAGCACAAG Tm = 72 The oligo length is 24 nucleotide(s) RB2638_antisens GGATTCCAAACGCAGGATCGTCG Tm = 72 The oligo length is 23 nucleotide(s) zga_4661_antisens TCTTCCCATCCAGCCACCGTCT Tm = 70 The oligo length is 22 nucleotide(s) RB5196_antisens GACGCGGTGCAGCCACATGAAT Tm = 70 The oligo length is 22 nucleotide(s) zga_4662_antisens TTGTTGACAATCCATAAGTACTTTCAT Tm = 70 The oligo length is 27 nucleotide(s) zga_3720_GH3_antisens GGATGGCAAATGAAAGTCAATTCTTT Tm = 70 The oligo length is 26 nucleotide(s) zga_518_GH13_antisens TTGAAAAATAACAATCCCCAATGGCG Tm = 72 The oligo length is 26 nucleotide(s) zga_355_antisens TAATGCCCTAATATGGACCGCCAA Tm = 70 The oligo length is 24 nucleotide(s) RB5200_GH13_antisens CGCGGTTGGCTCGTCATGTTCG Tm = 72 The oligo length is 22 nucleotide(s) zga_4668_antisens CAGTGATGAATTTTGTGTCAAAACTC Tm = 70 The oligo length is 26 nucleotide(s) zga_3745_beta_antisens ATTTACAATAGCGTCGTAAATTACTTTT Tm = 70 The oligo length is 28 nucleotide(s) RB4894_antisens CCGTTCGACAAGCACGCAAATGG Tm = 72 The oligo length is 23 nucleotide(s) zga_4659_antisens TGCCTTGTGTCTAATATAAAACGTCT Tm = 70 The oligo length is 26 nucleotide(s) zga_3629_antisens TTTTTTTAAGATTAGCGGAGTTACGG Tm = 70 The oligo length is 26 nucleotide(s) zga_3572_antisens CTCCAAACCTGATATTGCCTCGG Tm = 70 The oligo length is 23 nucleotide(s) RB2160_antisens CGCGTTCACATGATCGTGGGATT Tm = 70 The oligo length is 23 nucleotide(s) RB12343_antisens GGCGGTGGAAGATGACTTCAACC Tm = 72 The oligo length is 23 nucleotide(s) zga_3818_Fn3_antisens TTTTAATCTAAAGGATGTTTTTAAATCTG Tm = 70 The oligo length is 29 nucleotide(s) zga_3602_antisens TTTTTTGGTAAACTTTATGGTGGCAC Tm = 70 The oligo length is 26 nucleotide(s) RB10507_antisens CTCGTTCAGCATCGGCGAAATCA Tm = 70 The oligo length is 23 nucleotide(s) zga_3720_UNK_antisens TGACGATATGCTTACGGGCAAGG Tm = 70 The oligo length is 23 nucleotide(s) zga_347_Fn3_antisens TATTTTCAAGTTTCCACTGACATGAAT Tm = 70 The oligo length is 27 nucleotide(s) zga_530_antisens AAAGACCTTATAAATCGAAGCTTGATA Tm = 70 The oligo length is 27 nucleotide(s) zga_369_antisens ATTTACTTTGGCAATAGACCAAATACT Tm = 70 The oligo length is 27 nucleotide(s) zga_344_Fn3_antisens ATTTTTGACAGTTAAGGCTACTTTTTTG Tm = 72 The oligo length is 28 nucleotide(s) RB9292_antisens CTTTGGCGGCGCGTTACAGACA Tm = 70 The oligo length is 22 nucleotide(s) zga_344_GH3_antisens ATTGGTTATAGGAATATTTACCGTTGT Tm = 70 The oligo length is 27 nucleotide(s) zga_4658_antisens TTTCGATTGAAAAGCTGCCAGTTTTT Tm = 70 The oligo length is 26 nucleotide(s) zga_347_GH3_antisens ATTAGTAATATCCACGGAAACCACTA Tm = 70 The oligo length is 26 nucleotide(s) zga_4655_antisens GTCCACTGCCTTGAGCTTCAACA Tm = 70 The oligo length is 23 nucleotide(s) zga_4657_antisens CCAGTTGAATTTAAAAATCGTCGTAC Tm = 70 The oligo length is 26 nucleotide(s) zga_4653_antisens CCAGTTGGTAAACGAGCCATCTTT Tm = 70 The oligo length is 24 nucleotide(s) RB548_antisens CTTCCGCGTGTACACCAGAACC Tm = 70 The oligo length is 22 nucleotide(s) zga_518_CBM48_antisens GCCTTTTCCGTAACGGCCCCAT Tm = 70 The oligo length is 22 nucleotide(s) RB2986_antisens TGAAACTTGCCCGGATTGATCTTC Tm = 70 The oligo length is 24 nucleotide(s) zga_2429_antisens CTTCTTACTTGGTCTGATCCACATA Tm = 70 The oligo length is 25 nucleotide(s) zga_517_antisens TTTGAACGGGAGTCCGTGTAACTT Tm = 70 The oligo length is 24 nucleotide(s) zga_3523_antisens CTTGCTTCCGATTTTTAGTAGCACA Tm = 70 The oligo length is 25 nucleotide(s) RB5200_S6PP_antisens TTCGATCGAGTTTTCAAACAGACCA Tm = 70 The oligo length is 25 nucleotide(s) zga_3745_GH3_antisens GTCCTCATAAAGGTTTTTGAGCTCC Tm = 72 The oligo length is 25 nucleotide(s) zga_1248_antisens TTTTACAATGAAAATAAAGGATTCCAAC Tm = 70 The oligo length is 28 nucleotide(s) zga_3745_linker_antisens CTGTGCCAACTCGCTGTTTTGATA Tm = 70 The oligo length is 24 nucleotide(s) zga_368_antisens TTTTTCAATTATACTTATGGCATACCC Tm = 70 The oligo length is 27 nucleotide(s) zga_3745_GH3linker_antisens CTGTGCCAACTCGCTGTTTTGATA Tm = 70 The oligo length is 24 nucleotide(s) zga_1626_antisens ATGGCACAAGATGCGGCCCCAA Tm = 70 The oligo length is 22 nucleotide(s) zga_3818_GH3_antisens GCTCACCTCTACAGAAACCGAAAT Tm = 70 The oligo length is 24 nucleotide(s)
