Mercurial > repos > artbio > yac_clipper
view yac.xml @ 2:da08e89abd18 draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/yac_clipper commit 4767dcb09e8bb26a38ea458b2cf4f9d98a4afb95
author | artbio |
---|---|
date | Sat, 13 Oct 2018 17:09:16 -0400 |
parents | 7c913274e22a |
children | 94d67b195acd |
line wrap: on
line source
<tool id="yac" name="Clip adapter" version="2.1.1"> <description /> <command detect_errors="exit_code"><![CDATA[ python $__tool_directory__/yac.py --input $input --output $output --output_format "$out_format" --adapter_to_clip $clip_source.clip_sequence --min $min --max $max --Nmode $Nmode ]]></command> <inputs> <param format="fastq" label="Source file" name="input" type="data" /> <param label="min size" name="min" size="4" type="integer" value="15" /> <param label="max size" name="max" size="4" type="integer" value="36" /> <param label="Select output format" name="out_format" type="select"> <option selected="true" value="fasta">Fasta format</option> <option value="fastq">Fastq (Sanger) format</option> </param> <param label="Accept reads containing N?" name="Nmode" type="select"> <option selected="True" value="accept">accept</option> <option value="reject">reject</option> </param> <conditional name="clip_source"> <param help="Built-in adapters or User-provided" label="Source" name="clip_source_list" type="select"> <option selected="True" value="prebuilt">Use a built-in adapter (select from the list below)</option> <option value="user">Use custom sequence</option> </param> <when value="prebuilt"> <param help="if your adapter is not listed, input your own sequence" label="Select Adapter to clip" name="clip_sequence" type="select"> <option value="TCGTATGCCGTCTTCTGCTTG">Solexa TCGTATGCCGTCTTCTGCTTG</option> <option value="ATCTCGTATGCCGTCTTCTGCTT">Illumina ATCTCGTATGCCGTCTTCTGCTT</option> <option selected="True" value="TGGAATTCTCGGGTGCCAAG">Illumina TruSeq TGGAATTCTCGGGTGCCAAG</option> <option value="CTGTAGGCACCATCAATCGT">IdT CTGTAGGCACCATCAATCGT</option> </param> </when> <when value="user"> <param label="Enter your Sequence" name="clip_sequence" size="35" type="text" value="GAATCC" /> </when> </conditional> </inputs> <outputs> <data format_source="input" metadata_source="input" name="output" label="Clipping of ${input.name}"> <change_format> <when input="out_format" value="fasta" format="fasta" /> </change_format> </data> </outputs> <tests> <test> <param ftype="fastqsanger" name="input" value="yac.fastq" /> <param name="min" value="18" /> <param name="max" value="29" /> <param name="clip_source_list" value="prebuilt" /> <param name="clip_sequence" value="ATCTCGTATGCCGTCTTCTGCTT" /> <param name="Nmode" value="accept" /> <output file="yac.out" name="output" /> </test> <test> <param ftype="fastqsanger" name="input" value="yac.fastq" /> <param name="min" value="18" /> <param name="max" value="29" /> <param name="clip_source_list" value="prebuilt" /> <param name="clip_sequence" value="ATCTCGTATGCCGTCTTCTGCTT" /> <param name="Nmode" value="accept" /> <param name="out_format" value="fastq" /> <output file="yac_fastq.out" name="output" /> </test> </tests> <help> **What it does** + Clips adapter sequences + Renumbers sequence headers + Filters sequences on their size + Filters sequences containing unknown nucleotides (optional) ------- **Inputs** 1. A fastq file of reads to be clipped 2. Select the size of the reads to be kept 3. Select an output format when input is a fastq file (this may be fastq or fastq) 4. Select whether you wish or do not wish to keep clipped sequences with unknown nucleotides (N) 5. Select a pre-built adapter sequence or enter your own sequence (at least 7 nucleotides long) ------- **Output** A fastq or fasta file containing clipped sequences satisfying the selected criteria. </help> <citations /> </tool>