|
0
|
1 <tool id="augustus" name="Augustus" version="0.3">
|
|
|
2 <description>gene prediction for eukaryotic genomes</description>
|
|
|
3 <requirements>
|
|
|
4 <requirement type="package" version="2.7">augustus</requirement>
|
|
|
5 <requirement type="set_environment">AUGUSTUS_SCRIPT_PATH</requirement>
|
|
|
6 </requirements>
|
|
|
7 <command>
|
|
|
8 ## please set export AUGUSTUS_CONFIG_PATH=/path_to_augustus/augustus/config
|
|
|
9 ## or use the --AUGUSTUS_CONFIG_PATH=path if you are not installing through the toolshed
|
|
|
10 ## Augustus writes the protein and coding sequences as comment into the gff/gtf file an external script is used to extract the sequences into additional files
|
|
|
11
|
|
|
12 augustus
|
|
|
13 --strand=$strand
|
|
|
14 $noInFrameStop
|
|
|
15 $gff
|
|
|
16 $protein
|
|
|
17 $introns
|
|
|
18 $start
|
|
|
19 $stop
|
|
|
20 $cds
|
|
|
21 $codingseq
|
|
|
22 $singlestrand
|
|
|
23 $input_genome
|
|
|
24 $mea
|
|
|
25 $utr
|
|
|
26 --genemodel=$genemodel
|
|
|
27 --species=$organism
|
|
|
28 ##--outfile=$output
|
|
|
29 | tee $output
|
|
|
30 #if $protein or $codingseq:
|
|
|
31 | python \$AUGUSTUS_SCRIPT_PATH/extract_features.py
|
|
|
32 #if $protein:
|
|
|
33 --protein $protein_output
|
|
|
34 #end if
|
|
|
35 #if $codingseq:
|
|
|
36 --codingseq $codingseq_output
|
|
|
37 #end if
|
|
|
38 #end if
|
|
|
39 </command>
|
|
|
40 <inputs>
|
|
|
41 <param name="input_genome" type="data" format="fasta" label="Genome Sequence"/>
|
|
|
42 <param name="noInFrameStop" type="boolean" label="Don't report transcripts with in-frame stop codons (--noInFrameStop)" truevalue="--noInFrameStop=true" falsevalue="--noInFrameStop=false" checked="false" help="Otherwise, intron-spanning stop codons could occur" />
|
|
|
43 <param name="singlestrand" type="boolean" label="Predict genes independently on each strand, allow overlapping genes on opposite strands (--singlestrand)" truevalue="--singlestrand=true" falsevalue="--singlestrand=false" checked="false" />
|
|
|
44 <param name="mea" type="boolean" label="Using the maximum expected accuracy approach (--mea)" truevalue="--mea=1" falsevalue="" checked="false" help="MEA is an alternative decoding approach." />
|
|
|
45 <param name="utr" type="boolean" label="Predict the untranslated regions in addition to the coding sequence (--UTR)" truevalue="--UTR=on" falsevalue="--UTR=off" checked="false" help="This currently works only for human, galdieria, toxoplasma and caenorhabditis." />
|
|
|
46
|
|
|
47 <param name="organism" label="Model Organism" type="select" multiple="false" format="text" help="Choose a specialised trainingset.">
|
|
|
48 <option value="human">Homo sapiens</option>
|
|
|
49 <option value="fly">Drosophila melanogaster</option>
|
|
|
50 <option value="arabidopsis">Arabidopsis thaliana</option>
|
|
|
51 <option value="brugia ">Brugia malayi</option>
|
|
|
52 <option value="aedes">Aedes aegypti</option>
|
|
|
53 <option value="tribolium2012">Tribolium castaneum</option>
|
|
|
54 <option value="schistosoma">Schistosoma mansoni</option>
|
|
|
55 <option value="tetrahymena">Tetrahymena thermophila</option>
|
|
|
56 <option value="galdieria">Galdieria sulphuraria</option>
|
|
|
57 <option value="maize">Zea mays</option>
|
|
|
58 <option value="toxoplasma ">Toxoplasma gondii</option>
|
|
|
59 <option value="caenorhabditis ">Caenorhabditis elegans</option>
|
|
|
60 <option value="aspergillus_fumigatus">Aspergillus fumigatus</option>
|
|
|
61 <option value="aspergillus_nidulans ">Aspergillus nidulans</option>
|
|
|
62 <option value="aspergillus_oryzae ">Aspergillus oryzae</option>
|
|
|
63 <option value="aspergillus_terreus">Aspergillus terreus</option>
|
|
|
64 <option value="botrytis_cinerea ">Botrytis cinerea</option>
|
|
|
65 <option value="candida_albicans ">Candida albicans</option>
|
|
|
66 <option value="candida_guilliermondii ">Candida guilliermondii</option>
|
|
|
67 <option value="candida_tropicalis ">Candida tropicalis</option>
|
|
|
68 <option value="chaetomium_globosum">Chaetomium globosum</option>
|
|
|
69 <option value="coccidioides_immitis ">Coccidioides immitis</option>
|
|
|
70 <option value="coprinus ">Coprinus cinereus</option>
|
|
|
71 <option value="coprinus_cinereus">Coprinus cinereus</option>
|
|
|
72 <option value="cryptococcus_neoformans_gattii ">Cryptococcus neoformans gattii</option>
|
|
|
73 <option value="cryptococcus_neoformans_neoformans_B ">Cryptococcus neoformans neoformans</option>
|
|
|
74 <option value="cryptococcus_neoformans_neoformans_JEC21 ">Cryptococcus neoformans neoformans</option>
|
|
|
75 <option value="debaryomyces_hansenii">Debaryomyces hansenii</option>
|
|
|
76 <option value="encephalitozoon_cuniculi_GB">Encephalitozoon cuniculi</option>
|
|
|
77 <option value="eremothecium_gossypii">Eremothecium gossypii</option>
|
|
|
78 <option value="fusarium_graminearum ">Fusarium graminearum</option>
|
|
|
79 <option value="histoplasma_capsulatum ">Histoplasma capsulatum</option>
|
|
|
80 <option value="(histoplasma)">Histoplasma capsulatum</option>
|
|
|
81 <option value="kluyveromyces_lactis ">Kluyveromyces lactis</option>
|
|
|
82 <option value="laccaria_bicolor ">Laccaria bicolor</option>
|
|
|
83 <option value="lamprey">Petromyzon marinus</option>
|
|
|
84 <option value="leishmania_tarentolae">Leishmania tarentolae</option>
|
|
|
85 <option value="lodderomyces_elongisporus">Lodderomyces elongisporus</option>
|
|
|
86 <option value="magnaporthe_grisea ">Magnaporthe grisea</option>
|
|
|
87 <option value="neurospora_crassa">Neurospora crassa</option>
|
|
|
88 <option value="phanerochaete_chrysosporium">Phanerochaete chrysosporium</option>
|
|
|
89 <option value="pichia_stipitis">Pichia stipitis</option>
|
|
|
90 <option value="rhizopus_oryzae">Rhizopus oryzae</option>
|
|
|
91 <option value="saccharomyces_cerevisiae_S288C ">Saccharomyces cerevisiae</option>
|
|
|
92 <option value="saccharomyces_cerevisiae_rm11-1a_1 ">Saccharomyces cerevisiae</option>
|
|
|
93 <option value="(saccharomyces)">Saccharomyces cerevisiae</option>
|
|
|
94 <option value="schizosaccharomyces_pombe">Schizosaccharomyces pombe</option>
|
|
|
95 <option value="trichinella">Trichinella spiralis</option>
|
|
|
96 <option value="ustilago_maydis">Ustilago maydis</option>
|
|
|
97 <option value="yarrowia_lipolytica">Yarrowia lipolytica</option>
|
|
|
98 <option value="nasonia">Nasonia vitripennis</option>
|
|
|
99 <option value="tomato">Solanum lycopersicum</option>
|
|
|
100 <option value="chlamydomonas">Chlamydomonas reinhardtii</option>
|
|
|
101 <option value="amphimedon">Amphimedon queenslandica</option>
|
|
|
102 <option value="pneumocystis">Pneumocystis jirovecii</option>
|
|
|
103 <option value="chicken">Gallus gallus domesticus (chicken)</option>
|
|
|
104 <option value="cacao">Theobroma cacao (cacao)</option>
|
|
|
105 <option value="heliconius_melpomene1">Heliconius melpomene</option>
|
|
|
106 <option value="xenoturbella">Xenoturbella</option>
|
|
|
107 </param>
|
|
|
108
|
|
|
109 <param name="strand" type="select" multiple="false" format="text" help="Report predicted genes on both strands, just the forward or just the backward strand.">
|
|
|
110 <option value="both">both</option>
|
|
|
111 <option value="forward">forward</option>
|
|
|
112 <option value="backward">backward</option>
|
|
|
113 </param>
|
|
|
114
|
|
|
115 <param name="genemodel" label="Gene Model" type="select" multiple="false" format="text" help="Gene Model to predict, for more information please refere to the help.">
|
|
|
116 <option value="complete">complete</option>
|
|
|
117 <option value="partial">partial</option>
|
|
|
118 <option value="intronless">intronless</option>
|
|
|
119 <option value="atleastone">atleastone</option>
|
|
|
120 <option value="exactlyone">exactlyone</option>
|
|
|
121 <option value="bacterium">bacterium (beta version)</option>
|
|
|
122 </param>
|
|
|
123
|
|
|
124 <param name="protein" type="boolean" label="Output predicted protein sequences (--protein)" truevalue="--protein=on" falsevalue="--protein=off" checked="true" />
|
|
|
125 <param name="codingseq" type="boolean" label="Output coding sequence as comment in the output file (codingseq)" truevalue="--codingseq=on" falsevalue="--codingseq=off" checked="true" />
|
|
|
126 <param name="introns" type="boolean" label="Output predicted intron sequences (--introns)" truevalue="--introns=on" falsevalue="--introns=off" checked="false" />
|
|
|
127 <param name="start" type="boolean" label="Output predicted start codons (--start)" truevalue="--start=on" falsevalue="--start=off" checked="false" />
|
|
|
128 <param name="stop" type="boolean" label="Output predicted stop codons (--stop)" truevalue="--stop=on" falsevalue="--stop=off" checked="false" />
|
|
|
129 <param name="cds" type="boolean" label="Output CDS region (--cds)" truevalue="--cds=on" falsevalue="--cds=off" checked="true" />
|
|
|
130 <param name="gff" type="boolean" label="GFF formated output, standard is GTF (--gff3)" truevalue="--gff3=on" falsevalue="--gff3=off" checked="false" />
|
|
|
131
|
|
|
132 </inputs>
|
|
|
133 <outputs>
|
|
|
134 <data format="gtf" name="output" label="${tool.name} on ${on_string}: GTF/GFF">
|
|
|
135 <change_format>
|
|
|
136 <when input="gff" value="--gff3=on" format="gff" />
|
|
|
137 </change_format>
|
|
|
138 </data>
|
|
|
139 <data format="fasta" name="protein_output" label="${tool.name} on ${on_string}: Protein sequence">
|
|
|
140 <filter>protein == True</filter>
|
|
|
141 </data>
|
|
|
142 <data format="fasta" name="codingseq_output" label="${tool.name} on ${on_string}: Coding sequence">
|
|
|
143 <filter>codingseq == True</filter>
|
|
|
144 </data>
|
|
|
145 </outputs>
|
|
|
146 <tests>
|
|
|
147 <test>
|
|
|
148 <param name="input_genome" value="human_augustus.fa" ftype="fasta" />
|
|
|
149 <param name="organism" value="human" />
|
|
|
150 <param name="utr" value="--UTR=on" />
|
|
|
151 <output name="output" file="human_augustus_utr-on.gtf" ftype="gtf" lines_diff="2"/>
|
|
|
152 </test>
|
|
|
153 <test>
|
|
|
154 <param name="input_genome" value="human_augustus.fa" ftype="fasta" />
|
|
|
155 <param name="organism" value="human" />
|
|
|
156 <param name="utr" value="--UTR=on" />
|
|
|
157 <param name="gff" value="--gff3=on" />
|
|
|
158 <output name="output" file="human_augustus_utr-on.gff" ftype="gff3" lines_diff="2"/>
|
|
|
159 </test>
|
|
|
160 <test>
|
|
|
161 <param name="input_genome" value="arabidopsis_augustus.fa" ftype="fasta" />
|
|
|
162 <param name="organism" value="arabidopsis" />
|
|
|
163 <param name="singlestrand" value="--singlestrand=true" />
|
|
|
164 <param name="mea" value="--mea=1" />
|
|
|
165 <output name="output" file="arabidopsis_augustus_utr-off_singlestrand-on_mea-on.gtf" ftype="gtf" lines_diff="2"/>
|
|
|
166 </test>
|
|
|
167 <test>
|
|
|
168 <param name="input_genome" value="human_augustus.fa" ftype="fasta" />
|
|
|
169 <param name="organism" value="human" />
|
|
|
170 <param name="protein" value="--protein=on" />
|
|
|
171 <param name="codingseq" value="--codingseq=on" />
|
|
|
172 <param name="introns" value="--introns=on" />
|
|
|
173 <param name="cds" value="--cds=on" />
|
|
|
174 <output name="output" file="human_augustus_protein_codingseq_introns_cds_main.gtf" ftype="gff" lines_diff="2"/>
|
|
|
175 <output name="codingseq_output" file="human_augustus_protein_codingseq_introns_cds_codingseq.fasta" ftype="fasta" />
|
|
|
176 <output name="protein_output" file="human_augustus_protein_codingseq_introns_cds_protein.fasta" ftype="fasta" />
|
|
|
177 </test>
|
|
|
178 </tests>
|
|
|
179 <help>
|
|
|
180
|
|
|
181 **What it does**
|
|
|
182
|
|
|
183 AUGUSTUS is a gene prediction program for eukaryotes written by Mario Stanke and Oliver Keller.
|
|
|
184 It can be used as an ab initio program, which means it bases its prediction purely on the
|
|
|
185 sequence. AUGUSTUS may also incorporate hints on the gene structure coming from extrinsic sources
|
|
|
186 such as EST, MS/MS, protein alignments and synthenic genomic alignments.
|
|
|
187
|
|
|
188 -----
|
|
|
189
|
|
|
190 **Parameters**
|
|
|
191
|
|
|
192 Gene Model::
|
|
|
193
|
|
|
194 partial : allow prediction of incomplete genes at the sequence boundaries (default)
|
|
|
195 intronless : only predict single-exon genes like in prokaryotes and some eukaryotes
|
|
|
196 complete : only predict complete genes
|
|
|
197 atleastone : predict at least one complete gene
|
|
|
198 exactlyone : predict exactly one complete gene
|
|
|
199
|
|
|
200
|
|
|
201
|
|
|
202 **Example**
|
|
|
203
|
|
|
204 Suppose you have the following DNA formatted sequences::
|
|
|
205
|
|
|
206 >Seq1
|
|
|
207 cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg
|
|
|
208 ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag
|
|
|
209 cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc
|
|
|
210 cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc
|
|
|
211 ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg
|
|
|
212
|
|
|
213 Running this tool will produce this::
|
|
|
214
|
|
|
215 # ----- prediction on sequence number 1 (length = 1992969, name = scaffold1|size1992969) -----
|
|
|
216 #
|
|
|
217 # Constraints/Hints:
|
|
|
218 # (none)
|
|
|
219 # Predicted genes for sequence number 1 on both strands
|
|
|
220 # start gene g1
|
|
|
221 scaffold1|size1992969 AUGUSTUS gene 17453 19382 0.11 + . g6
|
|
|
222 scaffold1|size1992969 AUGUSTUS transcript 17453 19382 0.11 + . g6.t1
|
|
|
223 scaffold1|size1992969 AUGUSTUS start_codon 17453 17455 . + 0 transcript_id "g6.t1"; gene_id "g6";
|
|
|
224 scaffold1|size1992969 AUGUSTUS intron 17615 17660 0.38 + . transcript_id "g6.t1"; gene_id "g6";
|
|
|
225 scaffold1|size1992969 AUGUSTUS intron 17708 17772 0.54 + . transcript_id "g6.t1"; gene_id "g6";
|
|
|
226 scaffold1|size1992969 AUGUSTUS intron 17902 18035 0.58 + . transcript_id "g6.t1"; gene_id "g6";
|
|
|
227 scaffold1|size1992969 AUGUSTUS intron 18313 18367 0.99 + . transcript_id "g6.t1"; gene_id "g6";
|
|
|
228 scaffold1|size1992969 AUGUSTUS intron 19014 19080 0.44 + . transcript_id "g6.t1"; gene_id "g6";
|
|
|
229 scaffold1|size1992969 AUGUSTUS CDS 17453 17614 0.55 + 0 transcript_id "g6.t1"; gene_id "g6";
|
|
|
230 scaffold1|size1992969 AUGUSTUS CDS 17661 17707 0.38 + 0 transcript_id "g6.t1"; gene_id "g6";
|
|
|
231 scaffold1|size1992969 AUGUSTUS CDS 17773 17901 0.54 + 1 transcript_id "g6.t1"; gene_id "g6";
|
|
|
232 scaffold1|size1992969 AUGUSTUS CDS 18036 18312 0.52 + 1 transcript_id "g6.t1"; gene_id "g6";
|
|
|
233 scaffold1|size1992969 AUGUSTUS CDS 18368 19013 0.99 + 0 transcript_id "g6.t1"; gene_id "g6";
|
|
|
234 scaffold1|size1992969 AUGUSTUS CDS 19081 19379 0.31 + 2 transcript_id "g6.t1"; gene_id "g6";
|
|
|
235 scaffold1|size1992969 AUGUSTUS stop_codon 19380 19382 . + 0 transcript_id "g6.t1"; gene_id "g6";
|
|
|
236
|
|
|
237
|
|
|
238 **References**
|
|
|
239
|
|
|
240 Mario Stanke and Stephan Waack (2003)
|
|
|
241 Gene Prediction with a Hidden-Markov Model and a new Intron Submodel.
|
|
|
242 Bioinformatics, Vol. 19, Suppl. 2, pages ii215-ii225
|
|
|
243
|
|
|
244
|
|
|
245 </help>
|
|
|
246 </tool>
|
