augustus: augustus.xml annotate

annotate augustus.xml @ 9:bd0e53f3a891 draft default tip

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4

author	iuc
date	Fri, 04 Oct 2024 11:32:08 +0000
parents	09855551d713
children

rev	line source
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	1 <tool id="augustus" name="Augustus" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	2 <description>gene prediction for prokaryotic and eukaryotic genomes</description>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	3 <macros>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	4 <import>macros.xml</import>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	5 </macros>
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	6 <xrefs>
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	7 <xref type="bio.tools">augustus</xref>
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	8 </xrefs>
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	9 <expand macro="requirements"/>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	10 <command detect_errors="aggressive">
2 a77a4e9921e0 Uploaded bgruening parents: 1 diff changeset	11 <![CDATA[
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	12 #if $model.augustus_mode == 'history'
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	13
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	14 ## Using an augustus model from history, we need to unzip it and let augustus find it
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	15
6 ca6d970d931c "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 211061259f97dfbeb080aaf4713a21f64a1742e1" iuc parents: 5 diff changeset	16 cp -r `command -v augustus \| xargs dirname`/../config/ augustus_dir/ &&
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	17
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	18 mkdir -p 'augustus_dir/species/' &&
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	19
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	20 tar -C 'augustus_dir/species/' -xzvf '${model.custom_model}' > /dev/null &&
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	21
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	22 export AUGUSTUS_CONFIG_PATH=`pwd`/augustus_dir/ &&
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	23 #end if
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	24
3 f5075dee9d6b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 2 diff changeset	25 ## Augustus writes the protein and coding sequences as comment into the gff/gtf file an external
f5075dee9d6b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 2 diff changeset	26 ## script is used to extract the sequences into additional files
0 af307d3285c5 Uploaded bgruening parents: diff changeset	27
af307d3285c5 Uploaded bgruening parents: diff changeset	28 augustus
af307d3285c5 Uploaded bgruening parents: diff changeset	29 --strand=$strand
af307d3285c5 Uploaded bgruening parents: diff changeset	30 $noInFrameStop
af307d3285c5 Uploaded bgruening parents: diff changeset	31 $gff
3 f5075dee9d6b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 2 diff changeset	32 --uniqueGeneId=true
2 a77a4e9921e0 Uploaded bgruening parents: 1 diff changeset	33
1 e2b822d7408f Uploaded bgruening parents: 0 diff changeset	34 #if 'protein' in str($outputs).split(','):
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	35 --protein=on
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	36 #else:
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	37 --protein=off
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	38 #end if
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	39
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	40 #if 'codingseq' in str($outputs).split(','):
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	41 --codingseq=on
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	42 #else:
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	43 --codingseq=off
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	44 #end if
2 a77a4e9921e0 Uploaded bgruening parents: 1 diff changeset	45
1 e2b822d7408f Uploaded bgruening parents: 0 diff changeset	46 #if 'introns' in str($outputs).split(','):
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	47 --introns=on
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	48 #else:
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	49 --introns=off
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	50 #end if
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	51
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	52 #if 'start' in str($outputs).split(','):
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	53 --start=on
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	54 #else:
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	55 --stop=off
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	56 #end if
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	57
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	58 #if 'stop' in str($outputs).split(','):
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	59 --stop=on
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	60 #else:
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	61 --stop=off
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	62 #end if
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	63
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	64 #if 'cds' in str($outputs).split(','):
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	65 --cds=on
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	66 #else:
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	67 --cds=off
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	68 #end if
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	69
0 af307d3285c5 Uploaded bgruening parents: diff changeset	70 $singlestrand
af307d3285c5 Uploaded bgruening parents: diff changeset	71 $input_genome
af307d3285c5 Uploaded bgruening parents: diff changeset	72 $utr
af307d3285c5 Uploaded bgruening parents: diff changeset	73 --genemodel=$genemodel
7 09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	74 --softmasking=$softmasking
5 b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	75 #if $hints.usehints == 'T'
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	76 --hintsfile='$hints.hintsfile' --extrinsicCfgFile='$hints.extrinsiccfg'
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	77 #end if
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	78
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	79 #if $range.userange == 'T'
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	80 --predictionStart=$range.start --predictionEnd=$range.stop
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	81 #end if
3 f5075dee9d6b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 2 diff changeset	82
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	83 #if $model.augustus_mode == 'history'
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	84 --species=local
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	85 #else
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	86 --species=$model.organism
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	87 #end if
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	88
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	89 \| tee '$output'
1 e2b822d7408f Uploaded bgruening parents: 0 diff changeset	90 #if 'protein' in str($outputs).split(',') or 'codingseq' in str($outputs).split(','):
2 a77a4e9921e0 Uploaded bgruening parents: 1 diff changeset	91 \| python $__tool_directory__/extract_features.py
1 e2b822d7408f Uploaded bgruening parents: 0 diff changeset	92 #if 'protein' in str($outputs).split(','):
0 af307d3285c5 Uploaded bgruening parents: diff changeset	93 --protein $protein_output
af307d3285c5 Uploaded bgruening parents: diff changeset	94 #end if
1 e2b822d7408f Uploaded bgruening parents: 0 diff changeset	95 #if 'codingseq' in str($outputs).split(','):
0 af307d3285c5 Uploaded bgruening parents: diff changeset	96 --codingseq $codingseq_output
af307d3285c5 Uploaded bgruening parents: diff changeset	97 #end if
af307d3285c5 Uploaded bgruening parents: diff changeset	98 #end if
2 a77a4e9921e0 Uploaded bgruening parents: 1 diff changeset	99 ]]>
0 af307d3285c5 Uploaded bgruening parents: diff changeset	100 </command>
af307d3285c5 Uploaded bgruening parents: diff changeset	101 <inputs>
af307d3285c5 Uploaded bgruening parents: diff changeset	102 <param name="input_genome" type="data" format="fasta" label="Genome Sequence"/>
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	103 <param argument="--noInFrameStop" type="boolean"
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	104 label="Don't report transcripts with in-frame stop codons"
3 f5075dee9d6b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 2 diff changeset	105 truevalue="--noInFrameStop=true" falsevalue="--noInFrameStop=false" checked="false"
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	106 help="Otherwise, intron-spanning stop codons could occur." />
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	107 <param type="boolean" argument="--singlestrand"
3 f5075dee9d6b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 2 diff changeset	108 label="Predict genes independently on each strand"
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	109 help="This allows overlapping genes on opposite strands."
3 f5075dee9d6b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 2 diff changeset	110 truevalue="--singlestrand=true" falsevalue="--singlestrand=false" checked="false" />
f5075dee9d6b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 2 diff changeset	111
f5075dee9d6b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 2 diff changeset	112 <param name="utr" type="boolean" argument="--UTR"
f5075dee9d6b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 2 diff changeset	113 label="Predict the untranslated regions in addition to the coding sequence"
f5075dee9d6b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 2 diff changeset	114 truevalue="--UTR=on" falsevalue="--UTR=off" checked="false"
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	115 help="This currently works only for human, galdieria, toxoplasma and caenorhabditis." />
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	116
0 af307d3285c5 Uploaded bgruening parents: diff changeset	117
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	118 <conditional name="model">
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	119 <param name="augustus_mode" type="select" label="Trainingset">
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	120 <option value="builtin">Run Augustus with a predefined trainingset</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	121 <option value="history">Run Augustus with a custom trainingset</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	122 </param>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	123 <when value="history">
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	124 <param name="custom_model" argument="--species" type="data" format="augustus" label="Augustus model" help="Archive created with the 'Train Augustus' tool"/>
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	125 </when>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	126 <when value="builtin">
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	127 <param name="organism" argument="--species" label="Model Organism" type="select" multiple="false" format="text" help="Choose a specialised trainingset.">
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	128 <!-- If you update this list, please also update it in maker and busco tools (../maker/maker.xml and ../busco/busco.xml) -->
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	129 <option value="human">Homo sapiens</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	130 <option value="fly">Drosophila melanogaster</option>
7 09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	131 <option value="maker2_dmel1">Drosophila melanogaster (maker2_dmel1)</option>
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	132 <option value="arabidopsis">Arabidopsis thaliana</option>
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	133 <option value="brugia">Brugia malayi (brugia)</option>
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	134 <option value="brugia_malayi">Brugia malayi (brugia_malayi)</option>
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	135 <option value="aedes">Aedes aegypti</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	136 <option value="tribolium2012">Tribolium castaneum</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	137 <option value="schistosoma">Schistosoma mansoni</option>
7 09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	138 <option value="schistosoma2">Schistosoma mansoni (schistosoma2)</option>
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	139 <option value="tetrahymena">Tetrahymena thermophila</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	140 <option value="galdieria">Galdieria sulphuraria</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	141 <option value="maize">Zea mays</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	142 <option value="toxoplasma">Toxoplasma gondii</option>
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	143 <option value="caenorhabditis">Caenorhabditis elegans</option>
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	144 <option value="aspergillus_fumigatus">Aspergillus fumigatus</option>
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	145 <option value="anidulans">Aspergillus nidulans (anidulans)</option>
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	146 <option value="aspergillus_nidulans">Aspergillus nidulans (aspergillus_nidulans)</option>
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	147 <option value="aspergillus_oryzae">Aspergillus oryzae</option>
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	148 <option value="aspergillus_terreus">Aspergillus terreus</option>
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	149 <option value="botrytis_cinerea">Botrytis cinerea</option>
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	150 <option value="candida_albicans">Candida albicans</option>
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	151 <option value="candida_guilliermondii">Candida guilliermondii</option>
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	152 <option value="candida_tropicalis">Candida tropicalis</option>
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	153 <option value="chaetomium_globosum">Chaetomium globosum</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	154 <option value="coccidioides_immitis">Coccidioides immitis</option>
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	155 <option value="coprinus">Coprinus cinereus (coprinus)</option>
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	156 <option value="coprinus_cinereus">Coprinus cinereus (coprinus_cinereus)</option>
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	157 <option value="cryptococcus_neoformans_gattii">Cryptococcus neoformans gattii</option>
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	158 <option value="cryptococcus_neoformans_neoformans_B">Cryptococcus neoformans neoformans B</option>
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	159 <option value="cryptococcus_neoformans_neoformans_JEC21">Cryptococcus neoformans neoformans JEC21</option>
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	160 <option value="cryptococcus">Cryptococcus neoformans (cryptococcus)</option>
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	161 <option value="cryptococcus_neoformans">Cryptococcus neoformans (cryptococcus_neoformans)</option>
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	162 <option value="debaryomyces_hansenii">Debaryomyces hansenii</option>
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	163 <option value="Encephalitozoon_cuniculi">Encephalitozoon cuniculi</option>
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	164 <option value="encephalitozoon_cuniculi_GB">Encephalitozoon cuniculi GB</option>
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	165 <option value="eremothecium_gossypii">Eremothecium gossypii</option>
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	166 <option value="fusarium_graminearum">Fusarium graminearum</option>
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	167 <option value="histoplasma_capsulatum">Histoplasma capsulatum (histoplasma_capsulatum)</option>
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	168 <option value="histoplasma">Histoplasma capsulatum (histoplasma)</option>
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	169 <option value="kluyveromyces_lactis">Kluyveromyces lactis</option>
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	170 <option value="laccaria_bicolor">Laccaria bicolor</option>
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	171 <option value="lamprey">Petromyzon marinus</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	172 <option value="leishmania_tarentolae">Leishmania tarentolae</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	173 <option value="lodderomyces_elongisporus">Lodderomyces elongisporus</option>
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	174 <option value="magnaporthe_grisea">Magnaporthe grisea</option>
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	175 <option value="neurospora_crassa">Neurospora crassa</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	176 <option value="phanerochaete_chrysosporium">Phanerochaete chrysosporium</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	177 <option value="pichia_stipitis">Pichia stipitis</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	178 <option value="rhizopus_oryzae">Rhizopus oryzae</option>
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	179 <option value="saccharomyces_cerevisiae_S288C">Saccharomyces cerevisiae saccharomyces_cerevisiae_S288C</option>
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	180 <option value="saccharomyces_cerevisiae_rm11-1a_1">Saccharomyces cerevisiae RM11-1a-1</option>
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	181 <option value="saccharomyces">Saccharomyces cerevisiae (saccharomyces)</option>
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	182 <option value="schizosaccharomyces_pombe">Schizosaccharomyces pombe</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	183 <option value="trichinella">Trichinella spiralis</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	184 <option value="yarrowia_lipolytica">Yarrowia lipolytica</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	185 <option value="nasonia">Nasonia vitripennis</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	186 <option value="tomato">Solanum lycopersicum</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	187 <option value="chlamydomonas">Chlamydomonas reinhardtii</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	188 <option value="amphimedon">Amphimedon queenslandica</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	189 <option value="pneumocystis">Pneumocystis jirovecii</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	190 <option value="chicken">Gallus gallus domesticus (chicken)</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	191 <option value="cacao">Theobroma cacao (cacao)</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	192 <option value="heliconius_melpomene1">Heliconius melpomene</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	193 <option value="xenoturbella">Xenoturbella</option>
7 09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	194 <option value="E_coli_K12">Escherichia coli K12</option>
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	195 <option value="c_elegans_trsk">c elegans trsk</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	196 <option value="camponotus_floridanus">Camponotus floridanus</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	197 <option value="coyote_tobacco">Coyote tobacco</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	198 <option value="s_aureus">Staphylococcus aureus</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	199 <option value="thermoanaerobacter_tengcongensis">Thermoanaerobacter tengcongensis</option>
7 09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	200 <option value="wheat">Triticum aestivum</option>
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	201 <option value="zebrafish">Danio rerio</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	202 <option value="bombus_impatiens1">Bombus impatiens1</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	203 <option value="bombus_terrestris2">Bombus terrestris2</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	204 <option value="conidiobolus_coronatus">Conidiobolus coronatus</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	205 <option value="culex_pipiens">Culex pipiens</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	206 <option value="elephant_shark">Callorhinchus milii</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	207 <option value="honeybee1">Apis mellifera</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	208 <option value="pea_aphid">Acyrthosiphon pisum</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	209 <option value="rhodnius_prolixus">Rhodnius prolixus</option>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	210 <option value="ustilago_maydis">Ustilago maydis</option>
7 09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	211 <option value="verticillium_albo_atrum1">Verticillium albo-atrum</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	212 <option value="verticillium_longisporum1">Verticillium longisporum</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	213 <option value="Xipophorus_maculatus">Xipophorus maculatus</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	214 <option value="adorsata">Apis dorsata</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	215 <option value="ancylostoma_ceylanicum">Ancylostoma ceylanicum</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	216 <option value="maker2_athal1">Arabidopsis thaliana (maker2_athal1)</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	217 <option value="maker2_c_elegans1">Caenorhabditis elegans (maker2_c_elegans1)</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	218 <option value="maker2_spomb1">Saccharomyces cerevisiae (maker2_spomb1)</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	219 <option value="parasteatoda">Parasteatoda SP.</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	220 <option value="rice">Oryza sp.</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	221 <option value="Cassiopea_xamachana">Cassiopea xamachana</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	222 <option value="Ptychodera_flava">Ptychodera flava</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	223 <option value="Argopecten_irridians">Argopecten irridians</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	224 <option value="Nemopilema_nomurai">Nemopilema nomurai</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	225 <option value="Notospermus_geniculatus">Notospermus geniculatus</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	226 <option value="Chrysaora_chesapeakeij">Chrysaora chesapeakeij</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	227 <option value="Ectocarpus_siliculosus">Ectocarpus siliculosus</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	228 <option value="Trichoplax_adhaerens">Trichoplax adhaerens</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	229 <option value="Aurelia_aurita">Aurelia aurita</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	230 <option value="Rhopilema_esculentum">Rhopilema esculentum</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	231 <option value="Gonapodya_prolifera">Dunaliella salina</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	232 <option value="Sordaria_macrospora">Sordaria macrospora</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	233 <option value="Sphaceloma_murrayae">Sphaceloma murrayae</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	234 <option value="Vitrella_brassicaformis">Vitrella brassicaformis</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	235 <option value="Monoraphidium_neglectum">Monoraphidium_neglectum</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	236 <option value="Raphidocelis_subcapita">Raphidocelis subcapita</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	237 <option value="Ostreococcus_tauri">Ostreococcus tauri</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	238 <option value="Ostreococcus_sp_lucimarinus">Ostreococcus sp. lucimarinus</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	239 <option value="Micromonas_pusilla">Micromonas pusilla</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	240 <option value="Micromonas_commoda">Micromonas commoda</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	241 <option value="Chlamydomonas_eustigma">Chlamydomonas eustigma</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	242 <option value="Thalassiosira_pseudonana">Thalassiosira pseudonana</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	243 <option value="Pseudo-nitzschia_multistriata">Pseudo-nitzschia multistriata</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	244 <option value="Phaeodactylum_tricornutum">Phaeodactylum tricornutum</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	245 <option value="Fragilariopsis_cylindrus">Fragilariopsis cylindrus</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	246 <option value="Fistulifera_solaris">Fistulifera solaris</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	247 <option value="Bathycoccus_prasinos">Bathycoccus prasinos</option>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	248 <option value="Chloropicon_primus">Chloropicon primus</option>
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	249 </param>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	250 </when>
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	251 </conditional>
0 af307d3285c5 Uploaded bgruening parents: diff changeset	252
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	253 <param type="boolean" argument="--softmasking"
7 09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	254 label="Softmasking"
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	255 truevalue="1" falsevalue="0" checked="true"
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	256 help="If this option is enabled, lowercase letters are considered as repeated regions." />
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	257
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	258
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	259 <param type="select" argument="--strand"
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	260 label="Predict genes on specific strands">
0 af307d3285c5 Uploaded bgruening parents: diff changeset	261 <option value="both">both</option>
af307d3285c5 Uploaded bgruening parents: diff changeset	262 <option value="forward">forward</option>
af307d3285c5 Uploaded bgruening parents: diff changeset	263 <option value="backward">backward</option>
2 a77a4e9921e0 Uploaded bgruening parents: 1 diff changeset	264 </param>
0 af307d3285c5 Uploaded bgruening parents: diff changeset	265
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	266 <param argument="--genemodel" label="Gene Model" type="select"
5 b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	267 help="Gene Model to predict, for more information please refer to the help.">
0 af307d3285c5 Uploaded bgruening parents: diff changeset	268 <option value="complete">complete</option>
af307d3285c5 Uploaded bgruening parents: diff changeset	269 <option value="partial">partial</option>
af307d3285c5 Uploaded bgruening parents: diff changeset	270 <option value="intronless">intronless</option>
af307d3285c5 Uploaded bgruening parents: diff changeset	271 <option value="atleastone">atleastone</option>
af307d3285c5 Uploaded bgruening parents: diff changeset	272 <option value="exactlyone">exactlyone</option>
af307d3285c5 Uploaded bgruening parents: diff changeset	273 </param>
af307d3285c5 Uploaded bgruening parents: diff changeset	274
5 b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	275 <conditional name="hints">
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	276 <param name="usehints" label="Use hints (extrinsic information)?" type="select" display="radio">
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	277 <option value="F">No</option>
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	278 <option value="T">Yes</option>
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	279 </param>
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	280 <when value="T">
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	281 <param argument="--hintsfile" label="Select hints file from history" type="data" format="gff"
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	282 help="A file containing hints in gff format"/>
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	283 <param name="extrinsiccfg" argument="--extrinsicCfgFile" label="Select extrinsic configuration file from history" type="data" format="txt"
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	284 help="A .cfg file listing hint sources and their boni and mali"/>
5 b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	285 </when>
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	286 <when value="F">
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	287 </when>
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	288 </conditional>
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	289
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	290 <conditional name="range">
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	291 <param name="userange" label="Specify prediction sequence range?" type="select" display="radio">
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	292 <option value="F">No</option>
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	293 <option value="T">Yes</option>
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	294 </param>
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	295 <when value="T">
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	296 <param name="start" argument="--predictionStart" label="Starting position" type="integer" value=""
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	297 help="The beginning of the search range"/>
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	298 <param name="stop" argument="--predictionEnd" label="Ending position" type="integer" value=""
bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	299 help="The end of the search range; must be greater than starting position"/>
5 b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	300 </when>
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	301 <when value="F">
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	302 </when>
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	303 </conditional>
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	304
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	305 <param name="gff" argument="--gff3" type="boolean" label="GFF formated output"
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	306 help="Standard output is GTF."
3 f5075dee9d6b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 2 diff changeset	307 truevalue="--gff3=on" falsevalue="--gff3=off" checked="false" />
0 af307d3285c5 Uploaded bgruening parents: diff changeset	308
1 e2b822d7408f Uploaded bgruening parents: 0 diff changeset	309 <param name="outputs" type="select" display="checkboxes" multiple="True" label="Output options">
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	310 <option value="protein" selected="True">predicted protein sequences (--protein)</option>
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	311 <option value="codingseq" selected="True">coding sequence as comment in the output file (--codingseq)</option>
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	312 <option value="introns">predicted intron sequences (--introns)</option>
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	313 <option value="start">predicted start codons (--start)</option>
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	314 <option value="stop">predicted stop codons (--stop)</option>
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	315 <option value="cds" selected="true">CDS region (--cds)</option>
e2b822d7408f Uploaded bgruening parents: 0 diff changeset	316 </param>
0 af307d3285c5 Uploaded bgruening parents: diff changeset	317 </inputs>
af307d3285c5 Uploaded bgruening parents: diff changeset	318 <outputs>
af307d3285c5 Uploaded bgruening parents: diff changeset	319 <data format="gtf" name="output" label="${tool.name} on ${on_string}: GTF/GFF">
af307d3285c5 Uploaded bgruening parents: diff changeset	320 <change_format>
3 f5075dee9d6b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 2 diff changeset	321 <when input="gff" value="--gff3=on" format="gff3" />
0 af307d3285c5 Uploaded bgruening parents: diff changeset	322 </change_format>
af307d3285c5 Uploaded bgruening parents: diff changeset	323 </data>
af307d3285c5 Uploaded bgruening parents: diff changeset	324 <data format="fasta" name="protein_output" label="${tool.name} on ${on_string}: Protein sequence">
1 e2b822d7408f Uploaded bgruening parents: 0 diff changeset	325 <filter>'protein' in outputs</filter>
0 af307d3285c5 Uploaded bgruening parents: diff changeset	326 </data>
af307d3285c5 Uploaded bgruening parents: diff changeset	327 <data format="fasta" name="codingseq_output" label="${tool.name} on ${on_string}: Coding sequence">
1 e2b822d7408f Uploaded bgruening parents: 0 diff changeset	328 <filter>'codingseq' in outputs</filter>
0 af307d3285c5 Uploaded bgruening parents: diff changeset	329 </data>
af307d3285c5 Uploaded bgruening parents: diff changeset	330 </outputs>
af307d3285c5 Uploaded bgruening parents: diff changeset	331 <tests>
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	332 <test expect_num_outputs="3">
0 af307d3285c5 Uploaded bgruening parents: diff changeset	333 <param name="input_genome" value="human_augustus.fa" ftype="fasta" />
af307d3285c5 Uploaded bgruening parents: diff changeset	334 <param name="organism" value="human" />
3 f5075dee9d6b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 2 diff changeset	335 <param name="utr" value="True" />
7 09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	336 <param name="softmasking" value="False"/>
3 f5075dee9d6b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 2 diff changeset	337 <output name="output" file="human_augustus_utr-on.gtf" ftype="gtf" lines_diff="6"/>
0 af307d3285c5 Uploaded bgruening parents: diff changeset	338 </test>
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	339 <test expect_num_outputs="3">
0 af307d3285c5 Uploaded bgruening parents: diff changeset	340 <param name="input_genome" value="human_augustus.fa" ftype="fasta" />
af307d3285c5 Uploaded bgruening parents: diff changeset	341 <param name="organism" value="human" />
3 f5075dee9d6b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 2 diff changeset	342 <param name="utr" value="True" />
f5075dee9d6b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 2 diff changeset	343 <param name="gff" value="True" />
7 09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	344 <param name="softmasking" value="False"/>
3 f5075dee9d6b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 2 diff changeset	345 <output name="output" file="human_augustus_utr-on.gff" ftype="gff3" lines_diff="6"/>
0 af307d3285c5 Uploaded bgruening parents: diff changeset	346 </test>
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	347 <test expect_num_outputs="3">
0 af307d3285c5 Uploaded bgruening parents: diff changeset	348 <param name="input_genome" value="human_augustus.fa" ftype="fasta" />
af307d3285c5 Uploaded bgruening parents: diff changeset	349 <param name="organism" value="human" />
3 f5075dee9d6b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 2 diff changeset	350 <param name="outputs" value="protein,codingseq,introns,cds,start,stop" />
7 09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	351 <param name="softmasking" value="False"/>
3 f5075dee9d6b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 2 diff changeset	352 <output name="output" file="human_augustus_protein_codingseq_introns_cds_main.gtf" ftype="gtf" lines_diff="6"/>
0 af307d3285c5 Uploaded bgruening parents: diff changeset	353 <output name="codingseq_output" file="human_augustus_protein_codingseq_introns_cds_codingseq.fasta" ftype="fasta" />
af307d3285c5 Uploaded bgruening parents: diff changeset	354 <output name="protein_output" file="human_augustus_protein_codingseq_introns_cds_protein.fasta" ftype="fasta" />
af307d3285c5 Uploaded bgruening parents: diff changeset	355 </test>
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	356 <test expect_num_outputs="1">
5 b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	357 <param name="input_genome" value="chr2R.truncated.fa" ftype="fasta" />
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	358 <param name="organism" value="fly" />
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	359 <param name="usehints" value="T" />
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	360 <param name="hintsfile" value="hints.truncated.adjusted.gff" />
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	361 <param name="extrinsiccfg" value="extrinsic.truncated.cfg" />
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	362 <param name="outputs" value="" />
7 09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	363 <param name="softmasking" value="False"/>
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	364 <param name="outputs" value=""/>
5 b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	365 <output name="output" file="augustus.hints.output.gtf" ftype="gtf" lines_diff="12">
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	366 <assert_contents>
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	367 <has_text_matching expression="chr2R\tAUGUSTUS\tgene\t7560\t9303\t0\.(7[8-9]\|8[0-5])\t-\t.\tchr2R.g1" />
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	368 <has_text_matching expression="chr2R\tAUGUSTUS\ttranscript\t7560\t9303\t0\.(7[8-9]\|8[0-5])\t-\t.\tchr2R.g1.t1" />
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	369 </assert_contents>
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	370 </output>
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	371
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	372 </test>
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	373 <test expect_num_outputs="1">
5 b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	374 <param name="input_genome" value="chr2R.truncated.fa" ftype="fasta" />
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	375 <param name="organism" value="fly" />
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	376 <param name="usehints" value="T" />
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	377 <param name="hintsfile" value="hints.truncated.adjusted.gff" />
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	378 <param name="extrinsiccfg" value="extrinsic.truncated.cfg" />
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	379 <param name="userange" value="T" />
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	380 <param name="start" value="7000" />
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	381 <param name="stop" value="9000" />
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	382 <param name="outputs" value="" />
7 09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	383 <param name="softmasking" value="False"/>
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	384 <param name="outputs" value=""/>
5 b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	385 <output name="output" file="augustus.hints_and_range.output.gtf" ftype="gtf" lines_diff="12">
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	386 <assert_contents>
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	387 <has_text_matching expression="chr2R\tAUGUSTUS\tgene\t7560\t8931\t0.8[2-5]\t-\t.\tchr2R.g1" />
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	388 <has_text_matching expression="chr2R\tAUGUSTUS\ttranscript\t7560\t8931\t0.8[2-5]\t-\t.\tchr2R.g1.t1" />
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	389 </assert_contents>
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	390 </output>
b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	391 </test>
7 09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	392 <!-- Test softmasking parameter-->
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	393 <test expect_num_outputs="1">
7 09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	394 <param name="input_genome" value="human_augustus.fa" ftype="fasta" />
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	395 <param name="organism" value="human" />
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	396 <param name="utr" value="True" />
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	397 <param name="softmasking" value="True"/>
9 bd0e53f3a891 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit fbd55928544683a7f7e6e10dadabe698bc71b0e4 iuc parents: 7 diff changeset	398 <param name="outputs" value=""/>
7 09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	399 <output name="output" file="human_augustus_utr-on_softmasking.gtf" ftype="gtf" lines_diff="6"/>
09855551d713 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit bba7f5df059fcbeb06e89cf689e9a04d4f22cb76" iuc parents: 6 diff changeset	400 </test>
5 b3f5d0879dab planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 4 diff changeset	401
0 af307d3285c5 Uploaded bgruening parents: diff changeset	402 </tests>
af307d3285c5 Uploaded bgruening parents: diff changeset	403 <help>
2 a77a4e9921e0 Uploaded bgruening parents: 1 diff changeset	404 <![CDATA[
0 af307d3285c5 Uploaded bgruening parents: diff changeset	405
af307d3285c5 Uploaded bgruening parents: diff changeset	406 What it does
af307d3285c5 Uploaded bgruening parents: diff changeset	407
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	408 AUGUSTUS is a gene prediction program for prokaryotes and eukaryotes written by Mario Stanke and Oliver Keller.
0 af307d3285c5 Uploaded bgruening parents: diff changeset	409 It can be used as an ab initio program, which means it bases its prediction purely on the
af307d3285c5 Uploaded bgruening parents: diff changeset	410 sequence. AUGUSTUS may also incorporate hints on the gene structure coming from extrinsic sources
af307d3285c5 Uploaded bgruening parents: diff changeset	411 such as EST, MS/MS, protein alignments and synthenic genomic alignments.
af307d3285c5 Uploaded bgruening parents: diff changeset	412
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	413
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	414 Input
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	415
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	416 Input data for the gene prediction tool Augustus is a FASTA file with a genomic nucleotide sequence.
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	417
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	418
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	419 Output
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	420
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	421 Augustus produces three output files: a FASTA file with predicted coding sequences, a FASTA file with predicted protein sequences and a gtf/GFF output file if selected.
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	422
0 af307d3285c5 Uploaded bgruening parents: diff changeset	423
af307d3285c5 Uploaded bgruening parents: diff changeset	424 Parameters
af307d3285c5 Uploaded bgruening parents: diff changeset	425
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	426 Gene Model:
0 af307d3285c5 Uploaded bgruening parents: diff changeset	427
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	428 partial: allow prediction of incomplete genes at the sequence boundaries (default)
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	429 intronless: only predict single-exon genes like in prokaryotes and some eukaryotes
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	430 complete: only predict complete genes
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	431 atleastone: predict at least one complete gene
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	432 exactlyone: predict exactly one complete gene
0 af307d3285c5 Uploaded bgruening parents: diff changeset	433
af307d3285c5 Uploaded bgruening parents: diff changeset	434
af307d3285c5 Uploaded bgruening parents: diff changeset	435
af307d3285c5 Uploaded bgruening parents: diff changeset	436 Example
af307d3285c5 Uploaded bgruening parents: diff changeset	437
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	438 Suppose you have the following DNA FASTA sequence:
0 af307d3285c5 Uploaded bgruening parents: diff changeset	439
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	440 >Seq1
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	441 cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	442 ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	443 cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	444 cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	445 ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg
0 af307d3285c5 Uploaded bgruening parents: diff changeset	446
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	447
4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	448 Running this tool will produce this:
0 af307d3285c5 Uploaded bgruening parents: diff changeset	449
af307d3285c5 Uploaded bgruening parents: diff changeset	450 # ----- prediction on sequence number 1 (length = 1992969, name = scaffold1\|size1992969) -----
af307d3285c5 Uploaded bgruening parents: diff changeset	451 #
af307d3285c5 Uploaded bgruening parents: diff changeset	452 # Constraints/Hints:
af307d3285c5 Uploaded bgruening parents: diff changeset	453 # (none)
af307d3285c5 Uploaded bgruening parents: diff changeset	454 # Predicted genes for sequence number 1 on both strands
af307d3285c5 Uploaded bgruening parents: diff changeset	455 # start gene g1
af307d3285c5 Uploaded bgruening parents: diff changeset	456 scaffold1\|size1992969 AUGUSTUS gene 17453 19382 0.11 + . g6
af307d3285c5 Uploaded bgruening parents: diff changeset	457 scaffold1\|size1992969 AUGUSTUS transcript 17453 19382 0.11 + . g6.t1
af307d3285c5 Uploaded bgruening parents: diff changeset	458 scaffold1\|size1992969 AUGUSTUS start_codon 17453 17455 . + 0 transcript_id "g6.t1"; gene_id "g6";
af307d3285c5 Uploaded bgruening parents: diff changeset	459 scaffold1\|size1992969 AUGUSTUS intron 17615 17660 0.38 + . transcript_id "g6.t1"; gene_id "g6";
af307d3285c5 Uploaded bgruening parents: diff changeset	460 scaffold1\|size1992969 AUGUSTUS intron 17708 17772 0.54 + . transcript_id "g6.t1"; gene_id "g6";
af307d3285c5 Uploaded bgruening parents: diff changeset	461 scaffold1\|size1992969 AUGUSTUS intron 17902 18035 0.58 + . transcript_id "g6.t1"; gene_id "g6";
af307d3285c5 Uploaded bgruening parents: diff changeset	462 scaffold1\|size1992969 AUGUSTUS intron 18313 18367 0.99 + . transcript_id "g6.t1"; gene_id "g6";
af307d3285c5 Uploaded bgruening parents: diff changeset	463 scaffold1\|size1992969 AUGUSTUS intron 19014 19080 0.44 + . transcript_id "g6.t1"; gene_id "g6";
af307d3285c5 Uploaded bgruening parents: diff changeset	464 scaffold1\|size1992969 AUGUSTUS CDS 17453 17614 0.55 + 0 transcript_id "g6.t1"; gene_id "g6";
af307d3285c5 Uploaded bgruening parents: diff changeset	465 scaffold1\|size1992969 AUGUSTUS CDS 17661 17707 0.38 + 0 transcript_id "g6.t1"; gene_id "g6";
af307d3285c5 Uploaded bgruening parents: diff changeset	466 scaffold1\|size1992969 AUGUSTUS CDS 17773 17901 0.54 + 1 transcript_id "g6.t1"; gene_id "g6";
af307d3285c5 Uploaded bgruening parents: diff changeset	467 scaffold1\|size1992969 AUGUSTUS CDS 18036 18312 0.52 + 1 transcript_id "g6.t1"; gene_id "g6";
af307d3285c5 Uploaded bgruening parents: diff changeset	468 scaffold1\|size1992969 AUGUSTUS CDS 18368 19013 0.99 + 0 transcript_id "g6.t1"; gene_id "g6";
af307d3285c5 Uploaded bgruening parents: diff changeset	469 scaffold1\|size1992969 AUGUSTUS CDS 19081 19379 0.31 + 2 transcript_id "g6.t1"; gene_id "g6";
af307d3285c5 Uploaded bgruening parents: diff changeset	470 scaffold1\|size1992969 AUGUSTUS stop_codon 19380 19382 . + 0 transcript_id "g6.t1"; gene_id "g6";
af307d3285c5 Uploaded bgruening parents: diff changeset	471
af307d3285c5 Uploaded bgruening parents: diff changeset	472
2 a77a4e9921e0 Uploaded bgruening parents: 1 diff changeset	473 ]]>
0 af307d3285c5 Uploaded bgruening parents: diff changeset	474 </help>
4 4de31938431b planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e iuc parents: 3 diff changeset	475 <expand macro="citations"/>
0 af307d3285c5 Uploaded bgruening parents: diff changeset	476 </tool>

Mercurial > repos > bgruening > augustus

annotate augustus.xml @ 9:bd0e53f3a891 draft default tip