Mercurial > repos > bgruening > bismark
comparison new/bismark_methylation_extractor @ 7:fcadce4d9a06 draft
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b'e6ee273f75fff61d1e419283fa8088528cf59470\n'
| author | bgruening |
|---|---|
| date | Sat, 06 May 2017 13:18:09 -0400 |
| parents | |
| children |
comparison
equal
deleted
inserted
replaced
| 6:0f8646f22b8d | 7:fcadce4d9a06 |
|---|---|
| 1 #!/usr/bin/perl | |
| 2 use warnings; | |
| 3 use strict; | |
| 4 $|++; | |
| 5 use Getopt::Long; | |
| 6 use Cwd; | |
| 7 use Carp; | |
| 8 use FindBin qw($Bin); | |
| 9 use lib "$Bin/../lib"; | |
| 10 | |
| 11 ## This program is Copyright (C) 2010-15, Felix Krueger (felix.krueger@babraham.ac.uk) | |
| 12 | |
| 13 ## This program is free software: you can redistribute it and/or modify | |
| 14 ## it under the terms of the GNU General Public License as published by | |
| 15 ## the Free Software Foundation, either version 3 of the License, or | |
| 16 ## (at your option) any later version. | |
| 17 | |
| 18 ## This program is distributed in the hope that it will be useful, | |
| 19 ## but WITHOUT ANY WARRANTY; without even the implied warranty of | |
| 20 ## MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the | |
| 21 ## GNU General Public License for more details. | |
| 22 | |
| 23 ## You should have received a copy of the GNU General Public License | |
| 24 ## along with this program. If not, see <http://www.gnu.org/licenses/>. | |
| 25 | |
| 26 my @filenames; # input files | |
| 27 my %counting; | |
| 28 my $parent_dir = getcwd(); | |
| 29 | |
| 30 my %fhs; | |
| 31 | |
| 32 my $version = 'v0.14.3'; | |
| 33 my ($ignore,$genomic_fasta,$single,$paired,$full,$report,$no_overlap,$merge_non_CpG,$vanilla,$output_dir,$no_header,$bedGraph,$remove,$coverage_threshold,$counts,$cytosine_report,$genome_folder,$zero,$CpG_only,$CX_context,$split_by_chromosome,$sort_size,$samtools_path,$gzip,$ignore_r2,$mbias_off,$mbias_only,$gazillion,$ample_mem,$ignore_3prime,$ignore_3prime_r2,$multicore) = process_commandline(); | |
| 34 | |
| 35 | |
| 36 ### only needed for bedGraph output | |
| 37 my @sorting_files; # if files are to be written to bedGraph format, these are the methylation extractor output files | |
| 38 my @methylcalls = qw (0 0 0); # [0] = methylated, [1] = unmethylated, [2] = total | |
| 39 my @bedfiles; | |
| 40 | |
| 41 ### only needed for genome-wide cytosine methylation report | |
| 42 my %chromosomes; | |
| 43 | |
| 44 my %mbias_1; | |
| 45 my %mbias_2; | |
| 46 | |
| 47 | |
| 48 ############################################################################################## | |
| 49 ### Summarising Run Parameters | |
| 50 ############################################################################################## | |
| 51 | |
| 52 ### METHYLATION EXTRACTOR | |
| 53 | |
| 54 warn "Summarising Bismark methylation extractor parameters:\n"; | |
| 55 warn '='x63,"\n"; | |
| 56 | |
| 57 if ($single){ | |
| 58 if ($vanilla){ | |
| 59 warn "Bismark single-end vanilla format specified\n"; | |
| 60 } | |
| 61 else{ | |
| 62 warn "Bismark single-end SAM format specified (default)\n"; # default | |
| 63 } | |
| 64 } | |
| 65 elsif ($paired){ | |
| 66 if ($vanilla){ | |
| 67 warn "Bismark paired-end vanilla format specified\n"; | |
| 68 } | |
| 69 else{ | |
| 70 warn "Bismark paired-end SAM format specified (default)\n"; # default | |
| 71 } | |
| 72 } | |
| 73 | |
| 74 warn "Number of cores to be used: $multicore\n"; | |
| 75 | |
| 76 if ($single){ | |
| 77 if ($ignore){ | |
| 78 warn "First $ignore bp will be disregarded when processing the methylation call string\n"; | |
| 79 } | |
| 80 if ($ignore_3prime){ | |
| 81 warn "Last $ignore_3prime bp will be disregarded when processing the methylation call string\n"; | |
| 82 } | |
| 83 | |
| 84 } | |
| 85 else{ ## paired-end | |
| 86 if ($ignore){ | |
| 87 warn "First $ignore bp will be disregarded when processing the methylation call string of Read 1\n"; | |
| 88 } | |
| 89 if ($ignore_r2){ | |
| 90 warn "First $ignore_r2 bp will be disregarded when processing the methylation call string of Read 2\n"; | |
| 91 } | |
| 92 | |
| 93 if ($ignore_3prime){ | |
| 94 warn "Last $ignore_3prime bp will be disregarded when processing the methylation call string of Read 1\n"; | |
| 95 } | |
| 96 if ($ignore_3prime_r2){ | |
| 97 warn "Last $ignore_3prime_r2 bp will be disregarded when processing the methylation call string of Read 2\n"; | |
| 98 } | |
| 99 | |
| 100 | |
| 101 } | |
| 102 | |
| 103 | |
| 104 if ($full){ | |
| 105 warn "Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated\n"; | |
| 106 } | |
| 107 if ($merge_non_CpG){ | |
| 108 warn "Merge CHG and CHH context to non-CpG context specified\n"; | |
| 109 } | |
| 110 ### output directory | |
| 111 if ($output_dir eq ''){ | |
| 112 warn "Output will be written to the current directory ('$parent_dir')\n"; | |
| 113 } | |
| 114 else{ | |
| 115 warn "Output path specified as: $output_dir\n"; | |
| 116 } | |
| 117 | |
| 118 | |
| 119 sleep (1); | |
| 120 | |
| 121 ### BEDGRAPH | |
| 122 | |
| 123 if ($bedGraph){ | |
| 124 warn "\n\nSummarising bedGraph parameters:\n"; | |
| 125 warn '='x63,"\n"; | |
| 126 | |
| 127 if ($counts){ | |
| 128 warn "Generating additional output in bedGraph and coverage format\nbedGraph format:\t<Chromosome> <Start Position> <End Position> <Methylation Percentage>\ncoverage format:\t<Chromosome> <Start Position> <End Position> <Methylation Percentage> <count methylated> <count non-methylated>\n\n"; | |
| 129 } | |
| 130 else{ | |
| 131 warn "Generating additional sorted output in bedGraph format (output format: <Chromosome> <Start Position> <End Position> <Methylation Percentage>)\n"; | |
| 132 } | |
| 133 | |
| 134 ### Zero-based coordinates | |
| 135 if ($zero){ | |
| 136 warn "Writing out an additional coverage file (ending in zero.cov) with 0-based start and 1-based end genomic coordinates (zero-based, half-open; user-defined)\n"; | |
| 137 } | |
| 138 | |
| 139 warn "Using a cutoff of $coverage_threshold read(s) to report cytosine positions\n"; | |
| 140 | |
| 141 if ($CX_context){ | |
| 142 warn "Reporting and sorting methylation information for all cytosine context (sorting may take a long time, you have been warned ...)\n"; | |
| 143 } | |
| 144 else{ # default | |
| 145 $CpG_only = 1; | |
| 146 warn "Reporting and sorting cytosine methylation information in CpG context only (default)\n"; | |
| 147 } | |
| 148 | |
| 149 if ($remove){ | |
| 150 warn "White spaces in read ID names will be removed prior to sorting\n"; | |
| 151 } | |
| 152 | |
| 153 if ($ample_mem){ | |
| 154 warn "Sorting chromosomal postions for the bedGraph step using arrays instead of using UNIX sort\n"; | |
| 155 } | |
| 156 elsif (defined $sort_size){ | |
| 157 warn "The bedGraph UNIX sort command will use the following memory setting:\t'$sort_size'. Temporary directory used for sorting is the output directory\n"; | |
| 158 } | |
| 159 else{ | |
| 160 warn "Setting a default memory usage for the bedGraph UNIX sort command to 2GB\n"; | |
| 161 } | |
| 162 | |
| 163 | |
| 164 | |
| 165 sleep (1); | |
| 166 | |
| 167 if ($cytosine_report){ | |
| 168 warn "\n\nSummarising genome-wide cytosine methylation report parameters:\n"; | |
| 169 warn '='x63,"\n"; | |
| 170 warn "Generating comprehensive genome-wide cytosine report\n(output format: <Chromosome> <Position> <Strand> <count methylated> <count non-methylated> <C-context> <trinucleotide context> )\n"; | |
| 171 | |
| 172 | |
| 173 if ($CX_context){ | |
| 174 warn "Reporting methylation for all cytosine contexts. Be aware that this will generate enormous files\n"; | |
| 175 } | |
| 176 else{ # default | |
| 177 $CpG_only = 1; | |
| 178 warn "Reporting cytosine methylation in CpG context only (default)\n"; | |
| 179 } | |
| 180 | |
| 181 if ($split_by_chromosome){ | |
| 182 warn "Splitting the cytosine report output up into individual files for each chromosome\n"; | |
| 183 } | |
| 184 | |
| 185 ### Zero-based coordinates | |
| 186 if ($zero){ | |
| 187 warn "Using zero-based start and 1-based end genomic coordinates (zero-based, half-open; user-defined)\n"; | |
| 188 } | |
| 189 else{ # default, 1-based coords | |
| 190 warn "Using 1-based genomic coordinates (default)\n"; | |
| 191 } | |
| 192 | |
| 193 ### GENOME folder | |
| 194 if ($genome_folder){ | |
| 195 unless ($genome_folder =~/\/$/){ | |
| 196 $genome_folder =~ s/$/\//; | |
| 197 } | |
| 198 warn "Genome folder was specified as $genome_folder\n"; | |
| 199 } | |
| 200 else{ | |
| 201 $genome_folder = '/data/public/Genomes/Mouse/NCBIM37/'; | |
| 202 warn "Using the default genome folder /data/public/Genomes/Mouse/NCBIM37/\n"; | |
| 203 } | |
| 204 sleep (1); | |
| 205 } | |
| 206 } | |
| 207 | |
| 208 warn "\n"; | |
| 209 sleep (1); | |
| 210 | |
| 211 ###################################################### | |
| 212 ### PROCESSING FILES | |
| 213 ###################################################### | |
| 214 | |
| 215 foreach my $filename (@filenames){ | |
| 216 # resetting counters and filehandles | |
| 217 %fhs = (); | |
| 218 %counting =( | |
| 219 total_meCHG_count => 0, | |
| 220 total_meCHH_count => 0, | |
| 221 total_meCpG_count => 0, | |
| 222 total_unmethylated_CHG_count => 0, | |
| 223 total_unmethylated_CHH_count => 0, | |
| 224 total_unmethylated_CpG_count => 0, | |
| 225 sequences_count => 0, | |
| 226 methylation_call_strings => 0, | |
| 227 ); | |
| 228 | |
| 229 @sorting_files = (); | |
| 230 @bedfiles = (); | |
| 231 | |
| 232 %mbias_1 = (); | |
| 233 %mbias_2 = (); | |
| 234 | |
| 235 | |
| 236 ### performing a quick check to see if a paired-end SAM file has been sorted by positions which does interfere with the logic used by the extractor | |
| 237 unless ($vanilla){ | |
| 238 if ($paired){ | |
| 239 test_positional_sorting($filename); | |
| 240 } | |
| 241 } | |
| 242 | |
| 243 my ($pid,$pids,$report_basename) = process_Bismark_results_file($filename); | |
| 244 | |
| 245 if ($pid == 0){ | |
| 246 warn "Finished processing child process. Exiting..\n"; | |
| 247 | |
| 248 # ### Closing all filehandles of the child process so that the Bismark methylation extractor output doesn't get truncated due to buffering issues | |
| 249 # foreach my $fh (keys %fhs) { | |
| 250 # if ($fh =~ /^[1230]$/) { | |
| 251 # foreach my $context (keys %{$fhs{$fh}}) { | |
| 252 # $fhs{$fh}->{$context}->flush; | |
| 253 # } | |
| 254 # } | |
| 255 # else{ | |
| 256 # $fhs{$fh}->flush; | |
| 257 # } | |
| 258 # } | |
| 259 exit 0; | |
| 260 } | |
| 261 | |
| 262 ### | |
| 263 if ($pid and $multicore > 1){ | |
| 264 warn "Now waiting for all child processes to complete\n"; | |
| 265 sleep(1); | |
| 266 | |
| 267 ### we need to ensure that we wait for all child processes to be finished before continuing | |
| 268 # warn "here are the child IDs: @$pids\n"; | |
| 269 # warn "Looping through the child process IDs:\n"; | |
| 270 | |
| 271 foreach my $id (@$pids){ | |
| 272 # print "$id\t"; | |
| 273 my $kid = waitpid ($id,0); | |
| 274 # print "Returned: $kid\nExit status: $?\n"; | |
| 275 unless ($? == 0){ | |
| 276 warn "\nChild process terminated with exit signal: '$?'\n\n"; | |
| 277 } | |
| 278 } | |
| 279 } | |
| 280 | |
| 281 ### Closing all filehandles so that the Bismark methylation extractor output doesn't get truncated due to buffering issues | |
| 282 foreach my $fh (keys %fhs) { | |
| 283 if ($fh =~ /^[1230]$/) { | |
| 284 foreach my $context (keys %{$fhs{$fh}}) { | |
| 285 close $fhs{$fh}->{$context} or die $!; | |
| 286 } | |
| 287 } | |
| 288 else{ | |
| 289 close $fhs{$fh} or die $!; | |
| 290 } | |
| 291 } | |
| 292 | |
| 293 ### We need to stitch together a main splitting report from all individual parent/child processes | |
| 294 if ($multicore > 1){ | |
| 295 merge_individual_splitting_reports($report_basename); | |
| 296 print_splitting_report(); | |
| 297 | |
| 298 merge_individual_mbias_reports($report_basename); # this updates the main %mbias_1 and %mbias_2 data structures so we can proceed normally | |
| 299 | |
| 300 } | |
| 301 | |
| 302 unless ($mbias_off){ | |
| 303 ### printing out all M-Bias data | |
| 304 produce_mbias_plots ($filename); produce_mbias_plots ($filename); | |
| 305 | |
| 306 } | |
| 307 | |
| 308 unless ($mbias_only){ | |
| 309 delete_unused_files(); | |
| 310 } | |
| 311 | |
| 312 if ($bedGraph){ | |
| 313 | |
| 314 my $out = (split (/\//,$filename))[-1]; # extracting the filename if a full path was specified | |
| 315 $out =~ s/gz$//; | |
| 316 $out =~ s/sam$//; | |
| 317 $out =~ s/bam$//; | |
| 318 $out =~ s/txt$//; | |
| 319 $out =~ s/$/bedGraph/; | |
| 320 | |
| 321 my $bedGraph_output = $out; | |
| 322 my @args; | |
| 323 | |
| 324 if ($remove){ | |
| 325 push @args, '--remove'; | |
| 326 } | |
| 327 if ($CX_context){ | |
| 328 push @args, '--CX_context'; | |
| 329 } | |
| 330 if ($no_header){ | |
| 331 push @args, '--no_header'; | |
| 332 } | |
| 333 if ($gazillion){ | |
| 334 push @args, '--gazillion'; | |
| 335 } | |
| 336 if ($ample_mem){ | |
| 337 push @args, '--ample_memory'; | |
| 338 } | |
| 339 if ($zero){ | |
| 340 push @args, "--zero"; | |
| 341 } | |
| 342 | |
| 343 # if ($counts){ | |
| 344 # push @args, "--counts"; | |
| 345 # } | |
| 346 | |
| 347 push @args, "--buffer_size $sort_size"; | |
| 348 push @args, "--cutoff $coverage_threshold"; | |
| 349 push @args, "--output $bedGraph_output"; | |
| 350 push @args, "--dir '$output_dir'"; | |
| 351 | |
| 352 ### adding all files to be sorted to @args | |
| 353 foreach my $f (@sorting_files){ | |
| 354 push @args, $f; | |
| 355 } | |
| 356 | |
| 357 # print join "\t",@args,"\n"; | |
| 358 | |
| 359 system ("$Bin/bismark2bedGraph @args"); | |
| 360 | |
| 361 warn "Finished BedGraph conversion ...\n\n"; | |
| 362 sleep(1); | |
| 363 | |
| 364 # open (OUT,'>',$output_dir.$bedGraph_output) or die "Problems with the bedGraph output filename detected: file path: '$output_dir'\tfile name: '$bedGraph_output' $!"; | |
| 365 # warn "Writing bedGraph to file: $bedGraph_output\n"; | |
| 366 # process_bedGraph_output(); | |
| 367 # close OUT or die $!; | |
| 368 | |
| 369 ### genome-wide cytosine methylation report requires bedGraph processing anyway | |
| 370 if ($cytosine_report){ | |
| 371 | |
| 372 @args = (); # resetting @args | |
| 373 my $cytosine_out = $out; | |
| 374 $cytosine_out =~ s/bedGraph$//; | |
| 375 | |
| 376 if ($CX_context){ | |
| 377 $cytosine_out =~ s/$/CX_report.txt/; | |
| 378 } | |
| 379 else{ | |
| 380 $cytosine_out =~ s/$/CpG_report.txt/; | |
| 381 } | |
| 382 | |
| 383 push @args, "--output $cytosine_out"; | |
| 384 push @args, "--dir '$output_dir'"; | |
| 385 push @args, "--genome '$genome_folder'"; | |
| 386 push @args, "--parent_dir '$parent_dir'"; | |
| 387 | |
| 388 if ($zero){ | |
| 389 push @args, "--zero"; | |
| 390 } | |
| 391 if ($CX_context){ | |
| 392 push @args, '--CX_context'; | |
| 393 } | |
| 394 if ($split_by_chromosome){ | |
| 395 push @args, '--split_by_chromosome'; | |
| 396 } | |
| 397 | |
| 398 my $coverage_output = $bedGraph_output; | |
| 399 $coverage_output =~ s/bedGraph$/bismark.cov/; | |
| 400 | |
| 401 push @args, $output_dir . $coverage_output; # this will be the infile | |
| 402 | |
| 403 system ("$Bin/coverage2cytosine @args"); | |
| 404 # generate_genome_wide_cytosine_report($bedGraph_output,$cytosine_out); | |
| 405 warn "\n\nFinished generating genome-wide cytosine report\n\n"; | |
| 406 } | |
| 407 } | |
| 408 } | |
| 409 | |
| 410 sub merge_individual_splitting_reports{ | |
| 411 | |
| 412 my $report_basename = shift; | |
| 413 | |
| 414 my @splitting_reports; # only needed in multi-core mode to generate an overall report | |
| 415 foreach my $ext (1..$multicore){ | |
| 416 push @splitting_reports, "$report_basename.$ext"; | |
| 417 } | |
| 418 warn "\nMerging individual splitting reports into overall report: '$report_basename'\n"; | |
| 419 warn "Merging from these individual files:\n"; | |
| 420 print join ("\n",@splitting_reports),"\n\n"; | |
| 421 sleep(1); | |
| 422 | |
| 423 ########## | |
| 424 # resetting the counter first | |
| 425 %counting =( | |
| 426 total_meCHG_count => 0, | |
| 427 total_meCHH_count => 0, | |
| 428 total_meCpG_count => 0, | |
| 429 total_unmethylated_CHG_count => 0, | |
| 430 total_unmethylated_CHH_count => 0, | |
| 431 total_unmethylated_CpG_count => 0, | |
| 432 sequences_count => 0, | |
| 433 methylation_call_strings => 0, | |
| 434 ); | |
| 435 | |
| 436 # repopulating the merged counter | |
| 437 foreach my $file (@splitting_reports){ | |
| 438 open (IR,$file) or die $!; | |
| 439 while (<IR>){ | |
| 440 chomp; | |
| 441 my ($context,$count) = (split /\t/); | |
| 442 if ($context){ | |
| 443 if ($context =~ /^Total C to T conversions in CpG context/){ | |
| 444 # warn "context: $context\ncount: $count\n"; | |
| 445 $counting{total_unmethylated_CpG_count} += $count; | |
| 446 } | |
| 447 elsif ($context =~ /^Total C to T conversions in CHG context/){ | |
| 448 # warn "context: $context\ncount: $count\n"; | |
| 449 $counting{total_unmethylated_CHG_count} += $count; | |
| 450 } | |
| 451 elsif ($context =~ /^Total C to T conversions in CHH context/){ | |
| 452 # warn "context: $context\ncount: $count\n"; | |
| 453 $counting{total_unmethylated_CHH_count} += $count; | |
| 454 } | |
| 455 elsif ($context =~ /^Total methylated C\'s in CpG context/){ | |
| 456 # warn "context: $context\ncount: $count\n"; | |
| 457 $counting{total_meCpG_count} += $count; | |
| 458 } | |
| 459 elsif ($context =~ /^Total methylated C\'s in CHG context/){ | |
| 460 # warn "context: $context\ncount: $count\n"; | |
| 461 $counting{total_meCHG_count} += $count; | |
| 462 } | |
| 463 elsif ($context =~ /^Total methylated C\'s in CHH context/){ | |
| 464 # warn "context: $context\ncount: $count\n"; | |
| 465 $counting{total_meCHH_count} += $count; | |
| 466 } | |
| 467 elsif ($context =~ /^line count/){ | |
| 468 # warn "Line count\ncount: $count\n"; | |
| 469 $counting{sequences_count} = $count; # always the same | |
| 470 } | |
| 471 elsif ($context =~ /^meth call strings/){ | |
| 472 # warn "Meth call strings\ncount: $count\n"; | |
| 473 $counting{methylation_call_strings} += $count; | |
| 474 } | |
| 475 } | |
| 476 } | |
| 477 } | |
| 478 | |
| 479 # deleting the individual reports afterwards | |
| 480 foreach my $file (@splitting_reports){ | |
| 481 unlink $file; | |
| 482 } | |
| 483 } | |
| 484 | |
| 485 | |
| 486 sub merge_individual_mbias_reports{ | |
| 487 | |
| 488 my $report_basename = shift; | |
| 489 | |
| 490 my @mbias_reports; # only needed in multi-core mode to generate an overall report | |
| 491 foreach my $ext (1..$multicore){ | |
| 492 push @mbias_reports, "$report_basename.${ext}.mbias"; | |
| 493 } | |
| 494 warn "\nMerging individual M-bias reports into overall M-bias statistics from these $multicore individual files:\n"; | |
| 495 print join ("\n",@mbias_reports),"\n\n"; | |
| 496 | |
| 497 | |
| 498 ########## | |
| 499 # resetting the counters first, then repopulating them | |
| 500 %mbias_1 = (); | |
| 501 %mbias_2 = (); | |
| 502 | |
| 503 # repopulating the merged counter | |
| 504 foreach my $file (@mbias_reports){ | |
| 505 open (IR,$file) or die $!; | |
| 506 | |
| 507 my $context; | |
| 508 my $read; | |
| 509 | |
| 510 while (<IR>){ | |
| 511 chomp; | |
| 512 # warn "$_\n"; sleep(1); | |
| 513 if ($_ =~ /context/){ | |
| 514 $context = $1 if ($_ =~ /(\D{3}) context/); | |
| 515 # warn "Context set as $context\n"; | |
| 516 | |
| 517 if ($_ =~ /R2/){ | |
| 518 $read = 'R2'; | |
| 519 } | |
| 520 else{ | |
| 521 $read = 'R1'; | |
| 522 } | |
| 523 # warn "Setting read identity to '$read'\n"; | |
| 524 | |
| 525 # reading in 2 additional lines (===========, and header line) | |
| 526 $_ = <IR>; | |
| 527 #warn "discarding line $_\n"; | |
| 528 $_ = <IR>; | |
| 529 #warn "discarding line $_\n"; | |
| 530 next; | |
| 531 } | |
| 532 else{ | |
| 533 | |
| 534 if ($_ eq ''){ | |
| 535 # empty line, only occurs after a context has finished and before a new context starts | |
| 536 next; | |
| 537 } | |
| 538 | |
| 539 my ($pos,$meth,$unmeth) = (split /\t/); | |
| 540 # warn "$pos\t$meth\t$unmeth\n"; sleep(1); | |
| 541 if ($read eq 'R1'){ | |
| 542 $mbias_1{$context}->{$pos}->{meth} += $meth; | |
| 543 $mbias_1{$context}->{$pos}->{un} += $unmeth; | |
| 544 } | |
| 545 elsif ($read eq 'R2'){ | |
| 546 $mbias_2{$context}->{$pos}->{meth} += $meth; | |
| 547 $mbias_2{$context}->{$pos}->{un} += $unmeth; | |
| 548 } | |
| 549 } | |
| 550 } | |
| 551 close IR or warn "Had trouble closing filehandle for $file: $!\n"; | |
| 552 } | |
| 553 | |
| 554 # deleting the individual reports afterwards | |
| 555 foreach my $file (@mbias_reports){ | |
| 556 unlink $file; | |
| 557 } | |
| 558 } | |
| 559 | |
| 560 | |
| 561 sub delete_unused_files{ | |
| 562 | |
| 563 warn "Deleting unused files ...\n\n"; sleep(1); | |
| 564 | |
| 565 my $index = 0; | |
| 566 | |
| 567 while ($index <= $#sorting_files){ | |
| 568 if ($sorting_files[$index] =~ /gz$/){ | |
| 569 open (USED,"zcat $sorting_files[$index] |") or die "Failed to read from methylation extractor output file $sorting_files[$index]: $!\n"; | |
| 570 } | |
| 571 else{ | |
| 572 open (USED,$sorting_files[$index]) or die "Failed to read from methylation extractor output file $sorting_files[$index]: $!\n"; | |
| 573 } | |
| 574 | |
| 575 my $used = 0; | |
| 576 | |
| 577 while (<USED>){ | |
| 578 next if (/^Bismark/); | |
| 579 if ($_){ | |
| 580 $used = 1; | |
| 581 last; | |
| 582 } | |
| 583 } | |
| 584 | |
| 585 if ($used){ | |
| 586 warn "$sorting_files[$index] contains data ->\tkept\n"; | |
| 587 ++$index; | |
| 588 } | |
| 589 else{ | |
| 590 | |
| 591 my $delete = unlink $sorting_files[$index]; | |
| 592 | |
| 593 if ($delete){ | |
| 594 warn "$sorting_files[$index] was empty ->\tdeleted\n"; | |
| 595 } | |
| 596 else{ | |
| 597 warn "$sorting_files[$index] was empty, however deletion was unsuccessful: $!\n" | |
| 598 } | |
| 599 | |
| 600 ### we also need to remove the element from @sorting_files | |
| 601 splice @sorting_files, $index, 1; | |
| 602 } | |
| 603 } | |
| 604 warn "\n\n"; ## can't close the piped filehandles at this point because it will die (unfortunately) | |
| 605 } | |
| 606 | |
| 607 sub produce_mbias_plots{ | |
| 608 | |
| 609 my $filename = shift; | |
| 610 | |
| 611 my $mbias = (split (/\//,$filename))[-1]; # extracting the filename if a full path was specified | |
| 612 $mbias =~ s/gz$//; | |
| 613 $mbias =~ s/sam$//; | |
| 614 $mbias =~ s/bam$//; | |
| 615 $mbias =~ s/txt$//; | |
| 616 my $mbias_graph_1 = my $mbias_graph_2 = $mbias; | |
| 617 $mbias_graph_1 = $output_dir . $mbias_graph_1 . 'M-bias_R1.png'; | |
| 618 $mbias_graph_2 = $output_dir . $mbias_graph_2 . 'M-bias_R2.png'; | |
| 619 | |
| 620 $mbias =~ s/$/M-bias.txt/; | |
| 621 | |
| 622 open (MBIAS,'>',"$output_dir$mbias") or die "Failed to open file for the M-bias data\n\n"; | |
| 623 | |
| 624 # determining maximum read length | |
| 625 my $max_length_1 = 0; | |
| 626 my $max_length_2 = 0; | |
| 627 | |
| 628 foreach my $context (keys %mbias_1){ | |
| 629 foreach my $pos (sort {$a<=>$b} keys %{$mbias_1{$context}}){ | |
| 630 $max_length_1 = $pos unless ($max_length_1 >= $pos); | |
| 631 } | |
| 632 } | |
| 633 if ($paired){ | |
| 634 foreach my $context (keys %mbias_2){ | |
| 635 foreach my $pos (sort {$a<=>$b} keys %{$mbias_2{$context}}){ | |
| 636 $max_length_2 = $pos unless ($max_length_2 >= $pos); | |
| 637 } | |
| 638 } | |
| 639 } | |
| 640 | |
| 641 if ($single){ | |
| 642 warn "Determining maximum read length for M-Bias plot\n"; | |
| 643 warn "Maximum read length of Read 1: $max_length_1\n\n"; | |
| 644 } | |
| 645 else{ | |
| 646 warn "Determining maximum read lengths for M-Bias plots\n"; | |
| 647 warn "Maximum read length of Read 1: $max_length_1\n"; | |
| 648 warn "Maximum read length of Read 2: $max_length_2\n\n"; | |
| 649 } | |
| 650 # sleep(3); | |
| 651 | |
| 652 my @mbias_read1; | |
| 653 my @mbias_read2; | |
| 654 | |
| 655 #Check whether the module GD::Graph:lines is installed | |
| 656 my $gd_graph_installed = 0; | |
| 657 eval{ | |
| 658 require GD::Graph::lines; | |
| 659 GD::Graph::lines->import(); | |
| 660 }; | |
| 661 | |
| 662 unless($@) { # syntax or routine error variable, set if something goes wrong in the last eval{ require ...} | |
| 663 $gd_graph_installed = 1; | |
| 664 | |
| 665 #Check whether the module GD::Graph::colour is installed | |
| 666 eval{ | |
| 667 require GD::Graph::colour; | |
| 668 GD::Graph::colour->import(qw(:colours :lists :files :convert)); | |
| 669 }; | |
| 670 | |
| 671 if ($@) { | |
| 672 warn "Perl module GD::Graph::colour not found, skipping drawing M-bias plots (only writing out M-bias plot table)\n"; | |
| 673 sleep(2); | |
| 674 $gd_graph_installed = 0; | |
| 675 } | |
| 676 | |
| 677 | |
| 678 } | |
| 679 else{ | |
| 680 warn "Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table)\n"; | |
| 681 sleep(2); | |
| 682 } | |
| 683 | |
| 684 | |
| 685 my $graph_title; | |
| 686 my $graph1; | |
| 687 my $graph2; | |
| 688 | |
| 689 if ( $gd_graph_installed){ | |
| 690 $graph1 = GD::Graph::lines->new(800,600); | |
| 691 if ($paired){ | |
| 692 $graph2 = GD::Graph::lines->new(800,600); | |
| 693 } | |
| 694 } | |
| 695 | |
| 696 foreach my $context (qw(CpG CHG CHH)){ | |
| 697 @{$mbias_read1[0]} = (); | |
| 698 | |
| 699 if ($paired){ | |
| 700 print MBIAS "$context context (R1)\n================\n"; | |
| 701 $graph_title = 'M-bias (Read 1)'; | |
| 702 } | |
| 703 else{ | |
| 704 print MBIAS "$context context\n===========\n"; | |
| 705 $graph_title = 'M-bias'; | |
| 706 } | |
| 707 print MBIAS "position\tcount methylated\tcount unmethylated\t% methylation\tcoverage\n"; | |
| 708 | |
| 709 foreach my $pos (1..$max_length_1){ | |
| 710 | |
| 711 unless (defined $mbias_1{$context}->{$pos}->{meth}){ | |
| 712 $mbias_1{$context}->{$pos}->{meth} = 0; | |
| 713 } | |
| 714 unless (defined $mbias_1{$context}->{$pos}->{un}){ | |
| 715 $mbias_1{$context}->{$pos}->{un} = 0; | |
| 716 } | |
| 717 | |
| 718 my $percent = ''; | |
| 719 if (($mbias_1{$context}->{$pos}->{meth} + $mbias_1{$context}->{$pos}->{un}) > 0){ | |
| 720 $percent = sprintf("%.2f",$mbias_1{$context}->{$pos}->{meth} * 100/ ( $mbias_1{$context}->{$pos}->{meth} + $mbias_1{$context}->{$pos}->{un}) ); | |
| 721 } | |
| 722 my $coverage = $mbias_1{$context}->{$pos}->{un} + $mbias_1{$context}->{$pos}->{meth}; | |
| 723 | |
| 724 print MBIAS "$pos\t$mbias_1{$context}->{$pos}->{meth}\t$mbias_1{$context}->{$pos}->{un}\t$percent\t$coverage\n"; | |
| 725 push @{$mbias_read1[0]},$pos; | |
| 726 | |
| 727 if ($context eq 'CpG'){ | |
| 728 push @{$mbias_read1[1]},$percent; | |
| 729 push @{$mbias_read1[4]},$coverage; | |
| 730 } | |
| 731 elsif ($context eq 'CHG'){ | |
| 732 push @{$mbias_read1[2]},$percent; | |
| 733 push @{$mbias_read1[5]},$coverage; | |
| 734 } | |
| 735 elsif ($context eq 'CHH'){ | |
| 736 push @{$mbias_read1[3]},$percent; | |
| 737 push @{$mbias_read1[6]},$coverage; | |
| 738 } | |
| 739 } | |
| 740 print MBIAS "\n"; | |
| 741 } | |
| 742 | |
| 743 if ( $gd_graph_installed){ | |
| 744 | |
| 745 add_colour(nice_blue => [31,120,180]); | |
| 746 add_colour(nice_orange => [255,127,0]); | |
| 747 add_colour(nice_green => [51,160,44]); | |
| 748 add_colour(pale_blue => [153,206,227]); | |
| 749 add_colour(pale_orange => [253,204,138]); | |
| 750 add_colour(pale_green => [191,230,207]); | |
| 751 | |
| 752 $graph1->set( | |
| 753 x_label => 'position (bp)', | |
| 754 y1_label => '% methylation', | |
| 755 y2_label => '# methylation calls', | |
| 756 title => $graph_title, | |
| 757 line_width => 2, | |
| 758 x_max_value => $max_length_1, | |
| 759 x_min_value => 0, | |
| 760 y_tick_number => 10, | |
| 761 y_label_skip => 2, | |
| 762 y1_max_value => 100, | |
| 763 y1_min_value => 0, | |
| 764 y_label_skip => 2, | |
| 765 y2_min_value => 0, | |
| 766 x_label_skip => 5, | |
| 767 x_label_position => 0.5, | |
| 768 x_tick_offset => -1, | |
| 769 bgclr => 'white', | |
| 770 transparent => 0, | |
| 771 two_axes => 1, | |
| 772 use_axis => [1,1,1,2,2,2], | |
| 773 legend_placement => 'RC', | |
| 774 legend_spacing => 6, | |
| 775 legend_marker_width => 24, | |
| 776 legend_marker_height => 18, | |
| 777 dclrs => [ qw(nice_blue nice_orange nice_green pale_blue pale_orange pale_green)], | |
| 778 ) or die $graph1->error; | |
| 779 | |
| 780 $graph1->set_legend('CpG methylation','CHG methylation','CHH methylation','CpG total calls','CHG total calls','CHH total calls'); | |
| 781 | |
| 782 ### Failure to plot the MBIAS graph will now generate a warning instead of dieing (previous version below. Suggested by Andrew DeiRossi, 05 June 2014) | |
| 783 if (my $gd1 = $graph1->plot(\@mbias_read1)) { | |
| 784 open (MBIAS_G1,'>',$mbias_graph_1) or die "Failed to write to file for M-bias plot 1: $!\n\n"; | |
| 785 binmode MBIAS_G1; | |
| 786 print MBIAS_G1 $gd1->png; | |
| 787 } | |
| 788 else { | |
| 789 warn "WARNING: Cannot generate read 1 M-bias plot: " , $graph1->error , "\n\n"; | |
| 790 } | |
| 791 | |
| 792 # my $gd1 = $graph1->plot(\@mbias_read1) or die $graph1->error; | |
| 793 # open (MBIAS_G1,'>',$mbias_graph_1) or die "Failed to write to file for M-bias plot 1: $!\n\n"; | |
| 794 # binmode MBIAS_G1; | |
| 795 # print MBIAS_G1 $gd1->png; | |
| 796 } | |
| 797 | |
| 798 if ($paired){ | |
| 799 | |
| 800 foreach my $context (qw(CpG CHG CHH)){ | |
| 801 @{$mbias_read2[0]} = (); | |
| 802 | |
| 803 print MBIAS "$context context (R2)\n================\n"; | |
| 804 print MBIAS "position\tcount methylated\tcount unmethylated\t% methylation\tcoverage\n"; | |
| 805 foreach my $pos (1..$max_length_2){ | |
| 806 | |
| 807 unless (defined $mbias_2{$context}->{$pos}->{meth}){ | |
| 808 $mbias_2{$context}->{$pos}->{meth} = 0; | |
| 809 } | |
| 810 unless (defined $mbias_2{$context}->{$pos}->{un}){ | |
| 811 $mbias_2{$context}->{$pos}->{un} = 0; | |
| 812 } | |
| 813 | |
| 814 my $percent = ''; | |
| 815 if (($mbias_2{$context}->{$pos}->{meth} + $mbias_2{$context}->{$pos}->{un}) > 0){ | |
| 816 $percent = sprintf("%.2f",$mbias_2{$context}->{$pos}->{meth} * 100/ ($mbias_2{$context}->{$pos}->{meth} + $mbias_2{$context}->{$pos}->{un}) ); | |
| 817 } | |
| 818 my $coverage = $mbias_2{$context}->{$pos}->{un} + $mbias_2{$context}->{$pos}->{meth}; | |
| 819 | |
| 820 print MBIAS "$pos\t$mbias_2{$context}->{$pos}->{meth}\t$mbias_2{$context}->{$pos}->{un}\t$percent\t$coverage\n"; | |
| 821 | |
| 822 push @{$mbias_read2[0]},$pos; | |
| 823 | |
| 824 if ($context eq 'CpG'){ | |
| 825 push @{$mbias_read2[1]},$percent; | |
| 826 push @{$mbias_read2[4]},$coverage; | |
| 827 } | |
| 828 elsif ($context eq 'CHG'){ | |
| 829 push @{$mbias_read2[2]},$percent; | |
| 830 push @{$mbias_read2[5]},$coverage; | |
| 831 } | |
| 832 elsif ($context eq 'CHH'){ | |
| 833 push @{$mbias_read2[3]},$percent; | |
| 834 push @{$mbias_read2[6]},$coverage; | |
| 835 } | |
| 836 } | |
| 837 print MBIAS "\n"; | |
| 838 } | |
| 839 | |
| 840 if ( $gd_graph_installed){ | |
| 841 | |
| 842 add_colour(nice_blue => [31,120,180]); | |
| 843 add_colour(nice_orange => [255,127,0]); | |
| 844 add_colour(nice_green => [51,160,44]); | |
| 845 add_colour(pale_blue => [153,206,227]); | |
| 846 add_colour(pale_orange => [253,204,138]); | |
| 847 add_colour(pale_green => [191,230,207]); | |
| 848 | |
| 849 $graph2->set( | |
| 850 x_label => 'position (bp)', | |
| 851 line_width => 2, | |
| 852 x_max_value => $max_length_1, | |
| 853 x_min_value => 0, | |
| 854 y_tick_number => 10, | |
| 855 y_label_skip => 2, | |
| 856 y1_max_value => 100, | |
| 857 y1_min_value => 0, | |
| 858 y_label_skip => 2, | |
| 859 y2_min_value => 0, | |
| 860 x_label_skip => 5, | |
| 861 x_label_position => 0.5, | |
| 862 x_tick_offset => -1, | |
| 863 bgclr => 'white', | |
| 864 transparent => 0, | |
| 865 two_axes => 1, | |
| 866 use_axis => [1,1,1,2,2,2], | |
| 867 legend_placement => 'RC', | |
| 868 legend_spacing => 6, | |
| 869 legend_marker_width => 24, | |
| 870 legend_marker_height => 18, | |
| 871 dclrs => [ qw(nice_blue nice_orange nice_green pale_blue pale_orange pale_green)], | |
| 872 x_label => 'position (bp)', | |
| 873 y1_label => '% methylation', | |
| 874 y2_label => '# calls', | |
| 875 title => 'M-bias (Read 2)', | |
| 876 ) or die $graph2->error; | |
| 877 | |
| 878 $graph2->set_legend('CpG methylation','CHG methylation','CHH methylation','CpG total calls','CHG total calls','CHH total calls'); | |
| 879 | |
| 880 ### Failure to plot the MBIAS graph will now generate a warning instead of dieing (previous version below. Suggested by Andrew DeiRossi, 05 June 2014) | |
| 881 if (my $gd2 = $graph2->plot(\@mbias_read2)) { | |
| 882 open (MBIAS_G2,'>',$mbias_graph_2) or die "Failed to write to file for M-bias plot 2: $!\n\n"; | |
| 883 binmode MBIAS_G2; | |
| 884 print MBIAS_G2 $gd2->png; | |
| 885 } | |
| 886 else { | |
| 887 warn "WARNING: Cannot generate Read 2 M-bias plot: " , $graph2->error , "\n\n"; | |
| 888 } | |
| 889 | |
| 890 # my $gd2 = $graph2->plot(\@mbias_read2) or die $graph2->error; | |
| 891 # open (MBIAS_G2,'>',$mbias_graph_2) or die "Failed to write to file for M-bias plot 2: $!\n\n"; | |
| 892 # binmode MBIAS_G2; | |
| 893 # print MBIAS_G2 $gd2->png; | |
| 894 | |
| 895 } | |
| 896 } | |
| 897 } | |
| 898 | |
| 899 sub process_commandline{ | |
| 900 my $help; | |
| 901 my $single_end; | |
| 902 my $paired_end; | |
| 903 my $ignore; | |
| 904 my $ignore_r2; | |
| 905 my $genomic_fasta; | |
| 906 my $full; | |
| 907 my $report; | |
| 908 my $extractor_version; | |
| 909 my $no_overlap; | |
| 910 my $merge_non_CpG; | |
| 911 my $vanilla; | |
| 912 my $output_dir; | |
| 913 my $no_header; | |
| 914 my $bedGraph; | |
| 915 my $coverage_threshold = 1; # Minimum number of reads covering before calling methylation status | |
| 916 my $remove; | |
| 917 my $counts; | |
| 918 my $cytosine_report; | |
| 919 my $genome_folder; | |
| 920 my $zero; | |
| 921 my $CpG_only; | |
| 922 my $CX_context; | |
| 923 my $split_by_chromosome; | |
| 924 my $sort_size; | |
| 925 my $samtools_path; | |
| 926 my $gzip; | |
| 927 my $mbias_only; | |
| 928 my $mbias_off; | |
| 929 my $gazillion; | |
| 930 my $ample_mem; | |
| 931 my $include_overlap; | |
| 932 my $ignore_3prime; | |
| 933 my $ignore_3prime_r2; | |
| 934 my $multicore; | |
| 935 | |
| 936 my $command_line = GetOptions ('help|man' => \$help, | |
| 937 'p|paired-end' => \$paired_end, | |
| 938 's|single-end' => \$single_end, | |
| 939 'fasta' => \$genomic_fasta, | |
| 940 'ignore=i' => \$ignore, | |
| 941 'ignore_r2=i' => \$ignore_r2, | |
| 942 'comprehensive' => \$full, | |
| 943 'report' => \$report, | |
| 944 'version' => \$extractor_version, | |
| 945 'no_overlap' => \$no_overlap, | |
| 946 'merge_non_CpG' => \$merge_non_CpG, | |
| 947 'vanilla' => \$vanilla, | |
| 948 'o|output=s' => \$output_dir, | |
| 949 'no_header' => \$no_header, | |
| 950 'bedGraph' => \$bedGraph, | |
| 951 "cutoff=i" => \$coverage_threshold, | |
| 952 "remove_spaces" => \$remove, | |
| 953 "counts" => \$counts, | |
| 954 "cytosine_report" => \$cytosine_report, | |
| 955 'g|genome_folder=s' => \$genome_folder, | |
| 956 "zero_based" => \$zero, | |
| 957 "CX|CX_context" => \$CX_context, | |
| 958 "split_by_chromosome" => \$split_by_chromosome, | |
| 959 "buffer_size=s" => \$sort_size, | |
| 960 'samtools_path=s' => \$samtools_path, | |
| 961 'gzip' => \$gzip, | |
| 962 'mbias_only' => \$mbias_only, | |
| 963 'mbias_off' => \$mbias_off, | |
| 964 'gazillion|scaffolds' => \$gazillion, | |
| 965 'ample_memory' => \$ample_mem, | |
| 966 'include_overlap' => \$include_overlap, | |
| 967 'ignore_3prime=i' => \$ignore_3prime, | |
| 968 'ignore_3prime_r2=i' => \$ignore_3prime_r2, | |
| 969 'multicore=i' => \$multicore, | |
| 970 ); | |
| 971 | |
| 972 ### EXIT ON ERROR if there were errors with any of the supplied options | |
| 973 unless ($command_line){ | |
| 974 die "Please respecify command line options\n"; | |
| 975 } | |
| 976 | |
| 977 ### HELPFILE | |
| 978 if ($help){ | |
| 979 print_helpfile(); | |
| 980 exit; | |
| 981 } | |
| 982 | |
| 983 if ($extractor_version){ | |
| 984 print << "VERSION"; | |
| 985 | |
| 986 | |
| 987 Bismark Methylation Extractor | |
| 988 | |
| 989 Bismark Extractor Version: $version | |
| 990 Copyright 2010-15 Felix Krueger, Babraham Bioinformatics | |
| 991 www.bioinformatics.babraham.ac.uk/projects/bismark/ | |
| 992 | |
| 993 | |
| 994 VERSION | |
| 995 exit; | |
| 996 } | |
| 997 | |
| 998 | |
| 999 ### no files provided | |
| 1000 unless (@ARGV){ | |
| 1001 die "You need to provide one or more Bismark files to create an individual C methylation output. Please respecify!\n"; | |
| 1002 } | |
| 1003 @filenames = @ARGV; | |
| 1004 | |
| 1005 warn "\n *** Bismark methylation extractor version $version ***\n\n"; | |
| 1006 | |
| 1007 ### M-BIAS ONLY | |
| 1008 if ($mbias_only){ | |
| 1009 | |
| 1010 if ($mbias_off){ | |
| 1011 die "Options '--mbias_only' and '--mbias_off' are not compatible. Just pick one, mkay?\n"; | |
| 1012 } | |
| 1013 if ($bedGraph){ | |
| 1014 die "Option '--mbias_only' skips all sorts of methylation extraction, including the bedGraph generation. Please respecify!\n"; | |
| 1015 } | |
| 1016 if ($cytosine_report){ | |
| 1017 die "Option '--mbias_only' skips all sorts of methylation extraction, including the genome-wide cytosine methylation report generation. Please respecify!\n"; | |
| 1018 } | |
| 1019 if ($merge_non_CpG){ | |
| 1020 warn "Option '--mbias_only' skips all sorts of methylation extraction, thus '--merge' won't have any effect\n"; | |
| 1021 } | |
| 1022 if ($full){ | |
| 1023 warn "Option '--mbias_only' skips all sorts of methylation extraction, thus '--comprehensive' won't have any effect\n"; | |
| 1024 } | |
| 1025 sleep(3); | |
| 1026 } | |
| 1027 | |
| 1028 ### PRINT A REPORT | |
| 1029 unless ($report){ | |
| 1030 $report = 1; # making this the default | |
| 1031 } | |
| 1032 | |
| 1033 ### OUTPUT DIR PATH | |
| 1034 if ($output_dir){ | |
| 1035 unless ($output_dir =~ /\/$/){ | |
| 1036 $output_dir =~ s/$/\//; | |
| 1037 } | |
| 1038 } | |
| 1039 else{ | |
| 1040 $output_dir = ''; | |
| 1041 } | |
| 1042 | |
| 1043 ### NO HEADER | |
| 1044 unless ($no_header){ | |
| 1045 $no_header = 0; | |
| 1046 } | |
| 1047 | |
| 1048 ### OLD (VANILLA) OUTPUT FORMAT | |
| 1049 unless ($vanilla){ | |
| 1050 $vanilla = 0; | |
| 1051 } | |
| 1052 | |
| 1053 if ($single_end){ | |
| 1054 $paired_end = 0; ### SINGLE END ALIGNMENTS | |
| 1055 } | |
| 1056 elsif ($paired_end){ | |
| 1057 $single_end = 0; ### PAIRED-END ALIGNMENTS | |
| 1058 } | |
| 1059 else{ | |
| 1060 | |
| 1061 ### we will try to determine whether the input file was a single-end or paired-end sequencing run from the SAM header | |
| 1062 | |
| 1063 if ($vanilla){ | |
| 1064 die "Please specify whether the supplied file(s) are in Bismark single-end or paired-end format with '-s' or '-p'\n\n"; | |
| 1065 } | |
| 1066 else{ # SAM/BAM format | |
| 1067 | |
| 1068 my $file = $filenames[0]; | |
| 1069 warn "Trying to determine the type of mapping from the SAM header line of file $file\n"; sleep(1); | |
| 1070 | |
| 1071 ### if the user did not specify whether the alignment file was single-end or paired-end we are trying to get this information from the @PG header line in the SAM/BAM file | |
| 1072 if ($file =~ /\.gz$/){ | |
| 1073 open (DETERMINE,"zcat $file |") or die "Unable to read from gzipped file $file: $!\n"; | |
| 1074 } | |
| 1075 elsif ($file =~ /\.bam$/ || isBam($file) ){ ### this would allow to read BAM files that do not end in *.bam | |
| 1076 open (DETERMINE,"samtools view -h $file |") or die "Unable to read from BAM file $file: $!\n"; | |
| 1077 } | |
| 1078 else{ | |
| 1079 open (DETERMINE,$file) or die "Unable to read from $file: $!\n"; | |
| 1080 } | |
| 1081 | |
| 1082 while (<DETERMINE>){ | |
| 1083 last unless (/^\@/); | |
| 1084 if ($_ =~ /^\@PG/){ | |
| 1085 # warn "found the \@PG line:\n"; | |
| 1086 # warn "$_"; | |
| 1087 | |
| 1088 if ($_ =~ /\s+-1\s+/ and $_ =~ /\s+-2\s+/){ | |
| 1089 warn "Treating file(s) as paired-end data (as extracted from \@PG line)\n\n"; sleep(1); | |
| 1090 $paired_end = 1; | |
| 1091 $single_end = 0; | |
| 1092 } | |
| 1093 else{ | |
| 1094 warn "Treating file(s) as single-end data (as extracted from \@PG line)\n\n"; sleep(1); | |
| 1095 $paired_end = 0; | |
| 1096 $single_end = 1; | |
| 1097 } | |
| 1098 } | |
| 1099 } | |
| 1100 | |
| 1101 # close DETERMINE or warn $!; # this always throws an error anyway... | |
| 1102 | |
| 1103 } | |
| 1104 } | |
| 1105 | |
| 1106 ### IGNORING <INT> 5' END | |
| 1107 # bases at the start of the read when processing the methylation call string | |
| 1108 unless ($ignore){ | |
| 1109 $ignore = 0; | |
| 1110 } | |
| 1111 | |
| 1112 if (defined $ignore_r2){ | |
| 1113 die "You can only specify --ignore_r2 for paired-end result files\n" unless ($paired_end); | |
| 1114 } | |
| 1115 else{ | |
| 1116 $ignore_r2 = 0; | |
| 1117 } | |
| 1118 | |
| 1119 ### IGNORING <INT> 3' END | |
| 1120 # bases at the end of the read when processing the methylation call string | |
| 1121 unless ($ignore_3prime){ | |
| 1122 $ignore_3prime = 0; | |
| 1123 } | |
| 1124 | |
| 1125 if (defined $ignore_3prime_r2){ | |
| 1126 die "You can only specify --ignore_3prime_r2 for paired-end result files\n" unless ($paired_end); | |
| 1127 } | |
| 1128 else{ | |
| 1129 $ignore_3prime_r2 = 0; | |
| 1130 } | |
| 1131 | |
| 1132 | |
| 1133 ### NO OVERLAP | |
| 1134 ### --no_overlap is the default (as of version 0.12.6), unless someone explicitly asks to include overlaps | |
| 1135 if ($include_overlap){ | |
| 1136 die "The option '--include_overlap' can only be specified for paired-end input!\n" unless ($paired_end); | |
| 1137 warn "Setting option '--inlcude_overlap' for paired-end data (user-defined)\n\n"; | |
| 1138 $no_overlap = 0; | |
| 1139 } | |
| 1140 else{ # default | |
| 1141 if ($paired_end){ | |
| 1142 warn "Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data\n\n"; | |
| 1143 $no_overlap = 1; | |
| 1144 } | |
| 1145 } | |
| 1146 | |
| 1147 ### COMPREHENSIVE OUTPUT | |
| 1148 unless ($full){ | |
| 1149 $full = 0; | |
| 1150 } | |
| 1151 | |
| 1152 ### MERGE NON-CpG context | |
| 1153 unless ($merge_non_CpG){ | |
| 1154 $merge_non_CpG = 0; | |
| 1155 } | |
| 1156 | |
| 1157 ### remove white spaces in read ID (needed for sorting using the sort command | |
| 1158 unless ($remove){ | |
| 1159 $remove = 0; | |
| 1160 } | |
| 1161 | |
| 1162 ### COVERAGE THRESHOLD FOR bedGraph OUTPUT | |
| 1163 if (defined $coverage_threshold){ | |
| 1164 unless ($coverage_threshold > 0){ | |
| 1165 die "Please select a coverage greater than 0 (positive integers only)\n"; | |
| 1166 } | |
| 1167 } | |
| 1168 else{ | |
| 1169 $coverage_threshold = 1; | |
| 1170 } | |
| 1171 | |
| 1172 ### SORT buffer size | |
| 1173 if (defined $sort_size){ | |
| 1174 unless ($sort_size =~ /^\d+\%$/ or $sort_size =~ /^\d+(K|M|G|T)$/){ | |
| 1175 die "Please select a buffer size as percentage (e.g. --buffer_size 20%) or a number to be multiplied with K, M, G, T etc. (e.g. --buffer_size 20G). For more information on sort type 'info sort' on a command line\n"; | |
| 1176 } | |
| 1177 } | |
| 1178 else{ | |
| 1179 $sort_size = '2G'; | |
| 1180 } | |
| 1181 | |
| 1182 if ($zero){ | |
| 1183 die "Option '--zero' is only available if '--bedGraph' or '--cytosine_report' are specified as well. Please respecify\n" unless ($cytosine_report or $bedGraph); | |
| 1184 } | |
| 1185 | |
| 1186 if ($CX_context){ | |
| 1187 die "Option '--CX_context' is only available if '--bedGraph' or '--cytosine_report' are specified as well. Please respecify\n" unless ($cytosine_report or $bedGraph); | |
| 1188 } | |
| 1189 else{ | |
| 1190 $CX_context = 0; | |
| 1191 } | |
| 1192 | |
| 1193 unless ($counts){ | |
| 1194 $counts = 1; # counts will always be set | |
| 1195 } | |
| 1196 | |
| 1197 if ($cytosine_report){ | |
| 1198 | |
| 1199 ### GENOME folder | |
| 1200 if ($genome_folder){ | |
| 1201 unless ($genome_folder =~/\/$/){ | |
| 1202 $genome_folder =~ s/$/\//; | |
| 1203 } | |
| 1204 } | |
| 1205 else{ | |
| 1206 die "Please specify a genome folder to proceed (full path only)\n"; | |
| 1207 } | |
| 1208 | |
| 1209 unless ($bedGraph){ | |
| 1210 warn "Setting the option '--bedGraph' since this is required for the genome-wide cytosine report\n"; | |
| 1211 $bedGraph = 1; | |
| 1212 } | |
| 1213 unless ($counts){ | |
| 1214 # warn "Setting the option '--counts' since this is required for the genome-wide cytosine report\n"; | |
| 1215 $counts = 1; | |
| 1216 } | |
| 1217 warn "\n"; | |
| 1218 } | |
| 1219 | |
| 1220 ### PATH TO SAMTOOLS | |
| 1221 if (defined $samtools_path){ | |
| 1222 # if Samtools was specified as full command | |
| 1223 if ($samtools_path =~ /samtools$/){ | |
| 1224 if (-e $samtools_path){ | |
| 1225 # Samtools executable found | |
| 1226 } | |
| 1227 else{ | |
| 1228 die "Could not find an installation of Samtools at the location $samtools_path. Please respecify\n"; | |
| 1229 } | |
| 1230 } | |
| 1231 else{ | |
| 1232 unless ($samtools_path =~ /\/$/){ | |
| 1233 $samtools_path =~ s/$/\//; | |
| 1234 } | |
| 1235 $samtools_path .= 'samtools'; | |
| 1236 if (-e $samtools_path){ | |
| 1237 # Samtools executable found | |
| 1238 } | |
| 1239 else{ | |
| 1240 die "Could not find an installation of Samtools at the location $samtools_path. Please respecify\n"; | |
| 1241 } | |
| 1242 } | |
| 1243 } | |
| 1244 # Check whether Samtools is in the PATH if no path was supplied by the user | |
| 1245 else{ | |
| 1246 if (!system "which samtools >/dev/null 2>&1"){ # STDOUT is binned, STDERR is redirected to STDOUT. Returns 0 if Samtools is in the PATH | |
| 1247 $samtools_path = `which samtools`; | |
| 1248 chomp $samtools_path; | |
| 1249 } | |
| 1250 } | |
| 1251 | |
| 1252 unless (defined $samtools_path){ | |
| 1253 $samtools_path = ''; | |
| 1254 } | |
| 1255 | |
| 1256 | |
| 1257 if ($gazillion){ | |
| 1258 if ($ample_mem){ | |
| 1259 die "You can't currently select '--ample_mem' together with '--gazillion'. Make your pick!\n\n"; | |
| 1260 } | |
| 1261 } | |
| 1262 | |
| 1263 if (defined $multicore){ | |
| 1264 unless ($multicore > 0){ | |
| 1265 die "Core usage needs to be set to 1 or more (currently selected $multicore). Please respecify!\n"; | |
| 1266 } | |
| 1267 if ($multicore > 20){ | |
| 1268 warn "Core usage currently set to more than 20 threads. Let's see how this goes... (set value: $multicore)\n\n"; | |
| 1269 } | |
| 1270 } | |
| 1271 else{ | |
| 1272 $multicore = 1; # default. Single-thread mode | |
| 1273 warn "Setting core usage to single-threaded (default). Consider using --multicore <int> to speed up the extraction process.\n\n"; | |
| 1274 } | |
| 1275 | |
| 1276 return ($ignore,$genomic_fasta,$single_end,$paired_end,$full,$report,$no_overlap,$merge_non_CpG,$vanilla,$output_dir,$no_header,$bedGraph,$remove,$coverage_threshold,$counts,$cytosine_report,$genome_folder,$zero,$CpG_only,$CX_context,$split_by_chromosome,$sort_size,$samtools_path,$gzip,$ignore_r2,$mbias_off,$mbias_only,$gazillion,$ample_mem,$ignore_3prime,$ignore_3prime_r2,$multicore); | |
| 1277 } | |
| 1278 | |
| 1279 | |
| 1280 sub test_positional_sorting{ | |
| 1281 | |
| 1282 my $filename = shift; | |
| 1283 | |
| 1284 print "\nNow testing Bismark result file $filename for positional sorting (which would be bad...)\t"; | |
| 1285 sleep(1); | |
| 1286 | |
| 1287 if ($filename =~ /\.gz$/) { | |
| 1288 open (TEST,"zcat $filename |") or die "Can't open gzipped file $filename: $!\n"; | |
| 1289 } | |
| 1290 elsif ($filename =~ /bam$/ || isBam($filename) ){ ### this would allow to read BAM files that do not end in *.bam | |
| 1291 if ($samtools_path){ | |
| 1292 open (TEST,"$samtools_path view -h $filename |") or die "Can't open BAM file $filename: $!\n"; | |
| 1293 } | |
| 1294 else{ | |
| 1295 die "Sorry couldn't find an installation of Samtools. Either specifiy an alternative path using the option '--samtools_path /your/path/', or use a SAM file instead\n\n"; | |
| 1296 } | |
| 1297 } | |
| 1298 else { | |
| 1299 open (TEST,$filename) or die "Can't open file $filename: $!\n"; | |
| 1300 } | |
| 1301 | |
| 1302 my $count = 0; | |
| 1303 | |
| 1304 while (<TEST>) { | |
| 1305 if (/^\@/) { # testing header lines if they contain the @SO flag (for being sorted) | |
| 1306 if (/^\@SO/) { | |
| 1307 die "SAM/BAM header line '$_' indicates that the Bismark aligment file has been sorted by chromosomal positions which is is incompatible with correct methylation extraction. Please use an unsorted file instead\n\n"; | |
| 1308 } | |
| 1309 next; | |
| 1310 } | |
| 1311 $count++; | |
| 1312 | |
| 1313 last if ($count > 100000); # else we test the first 100000 sequences if they start with the same read ID | |
| 1314 | |
| 1315 my ($id_1) = (split (/\t/)); | |
| 1316 | |
| 1317 ### reading the next line which should be read 2 | |
| 1318 $_ = <TEST>; | |
| 1319 my ($id_2) = (split (/\t/)); | |
| 1320 last unless ($id_2); | |
| 1321 ++$count; | |
| 1322 | |
| 1323 if ($id_1 eq $id_2){ | |
| 1324 ### ids are the same | |
| 1325 next; | |
| 1326 } | |
| 1327 else{ ### in previous versions of Bismark we appended /1 and /2 to the read IDs for easier eyeballing which read is which. These tags need to be removed first | |
| 1328 my $id_1_trunc = $id_1; | |
| 1329 $id_1_trunc =~ s/\/1$//; | |
| 1330 my $id_2_trunc = $id_2; | |
| 1331 $id_2_trunc =~ s/\/2$//; | |
| 1332 | |
| 1333 unless ($id_1_trunc eq $id_2_trunc){ | |
| 1334 die "The IDs of Read 1 ($id_1) and Read 2 ($id_2) are not the same. This might be a result of sorting the paired-end SAM/BAM files by chromosomal position which is not compatible with correct methylation extraction. Please use an unsorted file instead\n\n"; | |
| 1335 } | |
| 1336 } | |
| 1337 } | |
| 1338 # close TEST or die $!; somehow fails on our cluster... | |
| 1339 ### If it hasen't died so far then it seems the file is in the correct Bismark format (read 1 and read 2 of a pair directly following each other) | |
| 1340 warn "...passed!\n"; | |
| 1341 sleep(1); | |
| 1342 | |
| 1343 } | |
| 1344 | |
| 1345 sub process_Bismark_results_file{ | |
| 1346 | |
| 1347 my $filename = shift; | |
| 1348 my $report_filename = open_output_filehandles($filename); | |
| 1349 | |
| 1350 ### disabling buffering so we don't run into problems with half written out lines... | |
| 1351 foreach my $fh (keys %fhs){ | |
| 1352 if ($fh =~ /^[1230]$/) { | |
| 1353 foreach my $context (keys %{$fhs{$fh}}) { | |
| 1354 select($fhs{$fh}->{$context}); | |
| 1355 $|++; | |
| 1356 } | |
| 1357 } | |
| 1358 else{ | |
| 1359 select($fhs{$fh}); | |
| 1360 $|++; | |
| 1361 } | |
| 1362 } | |
| 1363 select(STDOUT); | |
| 1364 | |
| 1365 ################################################ | |
| 1366 ################################################ | |
| 1367 ### multi-process handling | |
| 1368 ### | |
| 1369 | |
| 1370 my $offset = 1; | |
| 1371 my $process_id; | |
| 1372 my @pids; | |
| 1373 if ($multicore > 1){ | |
| 1374 | |
| 1375 until ($offset == $multicore){ | |
| 1376 # warn "multicore: $multicore\noffset: $offset\n"; | |
| 1377 my $fork = fork; | |
| 1378 | |
| 1379 if (defined $fork){ | |
| 1380 if ($fork != 0){ | |
| 1381 $process_id = $fork; | |
| 1382 push @pids, $process_id; | |
| 1383 if ($offset < $multicore){ | |
| 1384 ++$offset; | |
| 1385 # warn "I am the parent process, child pid: $fork\nIncrementing offset counter to: $offset\n\n"; | |
| 1386 } | |
| 1387 else{ | |
| 1388 # warn "Reached the number of maximum multicores. Proceeeding to processing...\n"; | |
| 1389 } | |
| 1390 } | |
| 1391 elsif ($fork == 0){ | |
| 1392 # warn "I am a child process, pid: $fork\nOffset counter is: $offset\nProceeding to processing...\n"; | |
| 1393 $process_id = $fork; | |
| 1394 last; | |
| 1395 } | |
| 1396 } | |
| 1397 else{ | |
| 1398 die "Forking unsuccessful. Proceeding using a single thread only\n"; | |
| 1399 } | |
| 1400 } | |
| 1401 | |
| 1402 # warn "\nThe thread identity\n===================\n"; | |
| 1403 if ($process_id){ | |
| 1404 # print "I am the parent process. My children are called:\n"; | |
| 1405 # print join ("\t",@pids),"\n"; | |
| 1406 # print "I am going to process the following line count: $offset\n\n"; | |
| 1407 } | |
| 1408 elsif($process_id == 0){ | |
| 1409 # warn "I am a child process: Process ID: $process_id\n"; | |
| 1410 # warn "I am going to process the following line count: $offset\n\n"; | |
| 1411 } | |
| 1412 else{ | |
| 1413 die "Process ID was: $process_id\n"; | |
| 1414 } | |
| 1415 } | |
| 1416 else{ | |
| 1417 # warn "Single-core mode: setting pid to 1\n"; | |
| 1418 $process_id = 1; | |
| 1419 } | |
| 1420 | |
| 1421 ################################################ | |
| 1422 ################################################ | |
| 1423 if ($process_id){ | |
| 1424 warn "Now reading in Bismark result file $filename\n"; | |
| 1425 } | |
| 1426 else{ | |
| 1427 warn "\nNow reading in Bismark result file $filename\n\n"; | |
| 1428 } | |
| 1429 | |
| 1430 if ($filename =~ /\.gz$/) { | |
| 1431 open (IN,"zcat $filename |") or die "Can't open gzipped file $filename: $!\n"; | |
| 1432 } | |
| 1433 elsif ($filename =~ /bam$/ || isBam($filename) ){ ### this would allow to read BAM files that do not end in *.bam | |
| 1434 if ($samtools_path){ | |
| 1435 open (IN,"$samtools_path view -h $filename |") or die "Can't open BAM file $filename: $!\n"; | |
| 1436 } | |
| 1437 else{ | |
| 1438 die "Sorry couldn't find an installation of Samtools. Either specifiy an alternative path using the option '--samtools_path /your/path/', or use a SAM file instead\n\n"; | |
| 1439 } | |
| 1440 } | |
| 1441 else { | |
| 1442 open (IN,$filename) or die "Can't open file $filename: $!\n"; | |
| 1443 } | |
| 1444 | |
| 1445 ### Vanilla and SAM output need to read different numbers of header lines | |
| 1446 if ($vanilla) { | |
| 1447 my $bismark_version = <IN>; ## discarding the Bismark version info | |
| 1448 chomp $bismark_version; | |
| 1449 $bismark_version =~ s/\r//; # replaces \r line feed | |
| 1450 $bismark_version =~ s/Bismark version: //; | |
| 1451 if ($bismark_version =~ /^\@/) { | |
| 1452 warn "Detected \@ as the first character of the version information. Is it possible that the file is in SAM format?\n\n"; | |
| 1453 sleep (1); | |
| 1454 } | |
| 1455 | |
| 1456 unless ($version eq $bismark_version){ | |
| 1457 die "The methylation extractor and Bismark itself need to be of the same version!\n\nVersions used:\nmethylation extractor: '$version'\nBismark: '$bismark_version'\n"; | |
| 1458 } | |
| 1459 } else { | |
| 1460 # If the read is in SAM format (default) it can either start with @ header lines or start with alignments directly. | |
| 1461 # We are reading from it further down | |
| 1462 } | |
| 1463 | |
| 1464 my $methylation_call_strings_processed = 0; | |
| 1465 my $line_count = 0; | |
| 1466 | |
| 1467 ### proceeding differently now for single-end or paired-end Bismark files | |
| 1468 | |
| 1469 ### PROCESSING SINGLE-END RESULT FILES | |
| 1470 if ($single) { | |
| 1471 | |
| 1472 ### also proceeding differently now for SAM format or vanilla Bismark format files | |
| 1473 if ($vanilla) { # old vanilla Bismark output format | |
| 1474 while (<IN>) { | |
| 1475 ++$line_count; | |
| 1476 warn "Processed lines: $line_count\n" if ($line_count%500000==0); | |
| 1477 | |
| 1478 if ( ($line_count - $offset)%$multicore == 0){ | |
| 1479 # warn "line count: $line_count\noffset: $offset\n"; | |
| 1480 # warn "Modulus: ",($line_count - $offset)%$multicore,"\n"; | |
| 1481 # warn "processing this line $line_count (processID: $process_id with \$offset $offset)\n"; | |
| 1482 } | |
| 1483 else{ | |
| 1484 # warn "skipping line $line_count for processID: $process_id with \$offset $offset)\n"; | |
| 1485 next; | |
| 1486 } | |
| 1487 | |
| 1488 ### $seq here is the chromosomal sequence (to use for the repeat analysis for example) | |
| 1489 my ($id,$strand,$chrom,$start,$seq,$meth_call,$read_conversion,$genome_conversion) = (split("\t"))[0,1,2,3,6,7,8,9]; | |
| 1490 | |
| 1491 ### we need to remove 2 bp of the genomic sequence as we were extracting read + 2bp long fragments to make a methylation call at the first or | |
| 1492 ### last position | |
| 1493 chomp $genome_conversion; | |
| 1494 | |
| 1495 my $index; | |
| 1496 if ($meth_call) { | |
| 1497 | |
| 1498 if ($read_conversion eq 'CT' and $genome_conversion eq 'CT') { ## original top strand | |
| 1499 $index = 0; | |
| 1500 } elsif ($read_conversion eq 'GA' and $genome_conversion eq 'CT') { ## complementary to original top strand | |
| 1501 $index = 1; | |
| 1502 } elsif ($read_conversion eq 'CT' and $genome_conversion eq 'GA') { ## original bottom strand | |
| 1503 $index = 3; | |
| 1504 } elsif ($read_conversion eq 'GA' and $genome_conversion eq 'GA') { ## complementary to original bottom strand | |
| 1505 $index = 2; | |
| 1506 } else { | |
| 1507 die "Unexpected combination of read and genome conversion: '$read_conversion' / '$genome_conversion'\n"; | |
| 1508 } | |
| 1509 | |
| 1510 ### Clipping off the first <int> number of bases from the methylation call string as specified with --ignore <int> | |
| 1511 if ($ignore) { | |
| 1512 $meth_call = substr($meth_call,$ignore,length($meth_call)-$ignore); | |
| 1513 | |
| 1514 ### If we are clipping off some bases at the start we need to adjust the start position of the alignments accordingly! | |
| 1515 if ($strand eq '+') { | |
| 1516 $start += $ignore; | |
| 1517 } | |
| 1518 elsif ($strand eq '-') { | |
| 1519 $start += length($meth_call)-1; ## $meth_call is already shortened! | |
| 1520 } | |
| 1521 else { | |
| 1522 die "Alignment did not have proper strand information: $strand\n"; | |
| 1523 } | |
| 1524 } | |
| 1525 | |
| 1526 ### Clipping off the last <int> number of bases from the methylation call string as specified with --ignore_3prime <int> | |
| 1527 if ($ignore_3prime) { | |
| 1528 | |
| 1529 $meth_call = substr($meth_call,0, (length($meth_call)) - $ignore_3prime); | |
| 1530 | |
| 1531 ### If we are clipping off some bases at the end we need to adjust the end position of the alignments accordingly | |
| 1532 if ($strand eq '+') { | |
| 1533 # clipping the 3' end does not affect the starting position # ignore 5' has already been taken care of, if relevant at all | |
| 1534 } | |
| 1535 elsif ($strand eq '-') { | |
| 1536 # here we need to discriminate if the start has been adjusted because of --ignore or not | |
| 1537 if ($ignore){ | |
| 1538 # position adjusted already, and because of this 3' trimming is irrelevant for the start position | |
| 1539 } | |
| 1540 else{ | |
| 1541 # Here we need to add the length ignore_3prime to the read starting position, adjustment of the start position will take place later in the methylation extraction step | |
| 1542 $start += $ignore_3prime; | |
| 1543 } | |
| 1544 } | |
| 1545 else { | |
| 1546 die "Alignment did not have proper strand information: $strand\n"; | |
| 1547 } | |
| 1548 } | |
| 1549 ### just as a comment, if --ignore has not been specified the starting position of reverse reads is adjusted later at the methylation extraction stage | |
| 1550 | |
| 1551 ### printing out the methylation state of every C in the read | |
| 1552 print_individual_C_methylation_states_single_end($meth_call,$chrom,$start,$id,$strand,$index); | |
| 1553 | |
| 1554 ++$methylation_call_strings_processed; # 1 per single-end result | |
| 1555 } | |
| 1556 } | |
| 1557 } else { # processing single-end SAM format (default) | |
| 1558 while (<IN>) { | |
| 1559 chomp; | |
| 1560 ### SAM format can either start with header lines (starting with @) or start with alignments directly | |
| 1561 if (/^\@/) { # skipping header lines (starting with @) | |
| 1562 warn "skipping SAM header line:\t$_\n" unless ($process_id == 0); | |
| 1563 next; | |
| 1564 } | |
| 1565 | |
| 1566 ++$line_count; | |
| 1567 # warn "$line_count\n"; | |
| 1568 warn "Processed lines: $line_count\n" if ($line_count%500000 == 0); | |
| 1569 | |
| 1570 if ( ($line_count - $offset)%$multicore == 0){ | |
| 1571 # warn "line count: $line_count\noffset: $offset\n"; | |
| 1572 # warn "Modulus: ",($line_count - $offset)%$multicore,"\n"; | |
| 1573 # warn "processing this line $line_count (processID: $process_id with \$offset $offset)\n"; | |
| 1574 } | |
| 1575 else{ | |
| 1576 # warn "skipping line $line_count for processID: $process_id with \$offset $offset)\n"; | |
| 1577 next; | |
| 1578 } | |
| 1579 | |
| 1580 # example read in SAM format | |
| 1581 # 1_R1/1 67 5 103172224 255 40M = 103172417 233 AATATTTTTTTTATTTTAAAATGTGTATTGATTTAAATTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:4 XX:Z:4T1T24TT7 XM:Z:....h.h........................hh....... XR:Z:CT XG:Z:CT | |
| 1582 ### | |
| 1583 | |
| 1584 # < 0.7.6 my ($id,$chrom,$start,$meth_call,$read_conversion,$genome_conversion) = (split("\t"))[0,2,3,13,14,15]; | |
| 1585 # < 0.7.6 $meth_call =~ s/^XM:Z://; | |
| 1586 # < 0.7.6 $read_conversion =~ s/^XR:Z://; | |
| 1587 # < 0.7.6 $genome_conversion =~ s/^XG:Z://; | |
| 1588 | |
| 1589 my ($id,$chrom,$start,$cigar) = (split("\t"))[0,2,3,5]; | |
| 1590 | |
| 1591 ### detecting the following SAM flags in case the SAM entry was shuffled by CRAM or Goby compression/decompression | |
| 1592 my $meth_call; ### Thanks to Zachary Zeno for this solution | |
| 1593 my $read_conversion; | |
| 1594 my $genome_conversion; | |
| 1595 | |
| 1596 while ( /(XM|XR|XG):Z:([^\t]+)/g ) { | |
| 1597 my $tag = $1; | |
| 1598 my $value = $2; | |
| 1599 | |
| 1600 if ($tag eq "XM") { | |
| 1601 $meth_call = $value; | |
| 1602 $meth_call =~ s/\r//; | |
| 1603 } elsif ($tag eq "XR") { | |
| 1604 $read_conversion = $value; | |
| 1605 $read_conversion =~ s/\r//; | |
| 1606 } elsif ($tag eq "XG") { | |
| 1607 $genome_conversion = $value; | |
| 1608 $genome_conversion =~ s/\r//; | |
| 1609 } | |
| 1610 } | |
| 1611 | |
| 1612 my $strand; | |
| 1613 # warn "$meth_call\n$read_conversion\n$genome_conversion\n"; | |
| 1614 | |
| 1615 my $index; | |
| 1616 if ($meth_call) { | |
| 1617 if ($read_conversion eq 'CT' and $genome_conversion eq 'CT') { ## original top strand | |
| 1618 $index = 0; | |
| 1619 $strand = '+'; | |
| 1620 } elsif ($read_conversion eq 'GA' and $genome_conversion eq 'CT') { ## complementary to original top strand | |
| 1621 $index = 1; | |
| 1622 $strand = '-'; | |
| 1623 } elsif ($read_conversion eq 'GA' and $genome_conversion eq 'GA') { ## complementary to original bottom strand | |
| 1624 $index = 2; | |
| 1625 $strand = '+'; | |
| 1626 } elsif ($read_conversion eq 'CT' and $genome_conversion eq 'GA') { ## original bottom strand | |
| 1627 $index = 3; | |
| 1628 $strand = '-'; | |
| 1629 } else { | |
| 1630 die "Unexpected combination of read and genome conversion: '$read_conversion' / '$genome_conversion'\n"; | |
| 1631 } | |
| 1632 | |
| 1633 ### If the read is in SAM format we need to reverse the methylation call if the read has been reverse-complemented for the output | |
| 1634 if ($strand eq '-') { | |
| 1635 $meth_call = reverse $meth_call; | |
| 1636 } | |
| 1637 # warn "\n$meth_call\n"; | |
| 1638 | |
| 1639 ### IGNORE 5 PRIME: Clipping off the first <int> number of bases from the methylation call string as specified with --ignore <int> | |
| 1640 if ($ignore) { | |
| 1641 # warn "\n\n$meth_call\n"; | |
| 1642 $meth_call = substr($meth_call,$ignore,length($meth_call)-$ignore); | |
| 1643 # warn "$meth_call\n";sleep(1); | |
| 1644 | |
| 1645 ### If we are ignoring a part of the sequence we also need to adjust the cigar string accordingly | |
| 1646 | |
| 1647 my @len = split (/\D+/,$cigar); # storing the length per operation | |
| 1648 my @ops = split (/\d+/,$cigar); # storing the operation | |
| 1649 shift @ops; # remove the empty first element | |
| 1650 die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len == scalar @ops); | |
| 1651 | |
| 1652 my @comp_cigar; # building an array with all CIGAR operations | |
| 1653 foreach my $index (0..$#len) { | |
| 1654 foreach (1..$len[$index]) { | |
| 1655 # print "$ops[$index]"; | |
| 1656 push @comp_cigar, $ops[$index]; | |
| 1657 } | |
| 1658 } | |
| 1659 # print "original CIGAR: $cigar\n"; | |
| 1660 # print "original CIGAR: @comp_cigar\n"; | |
| 1661 | |
| 1662 ### If we are clipping off some bases at the start we need to adjust the start position of the alignments accordingly! | |
| 1663 if ($strand eq '+') { | |
| 1664 | |
| 1665 my $D_count = 0; # counting all deletions that affect the ignored genomic position, i.e. Deletions and insertions | |
| 1666 my $I_count = 0; | |
| 1667 | |
| 1668 for (1..$ignore) { | |
| 1669 my $op = shift @comp_cigar; # adjusting composite CIGAR string by removing $ignore operations from the start | |
| 1670 # print "$_ deleted $op\n"; | |
| 1671 | |
| 1672 while ($op eq 'D') { # repeating this for deletions (D) | |
| 1673 $D_count++; | |
| 1674 $op = shift @comp_cigar; | |
| 1675 # print "$_ deleted $op\n"; | |
| 1676 } | |
| 1677 if ($op eq 'I') { # adjusting the genomic position for insertions (I) | |
| 1678 $I_count++; | |
| 1679 } | |
| 1680 } | |
| 1681 $start += $ignore + $D_count - $I_count; | |
| 1682 # print "start $start\t ignore: $ignore\t D count: $D_count I_count: $I_count\n"; | |
| 1683 } | |
| 1684 elsif ($strand eq '-') { | |
| 1685 | |
| 1686 for (1..$ignore) { | |
| 1687 my $op = pop @comp_cigar; # adjusting composite CIGAR string by removing $ignore operations, here the last value of the array | |
| 1688 while ($op eq 'D') { # repeating this for deletions (D) | |
| 1689 $op = pop @comp_cigar; | |
| 1690 } | |
| 1691 } | |
| 1692 | |
| 1693 ### For reverse strand alignments we need to determine the number of matching bases (M) or deletions (D) in the read from the CIGAR | |
| 1694 ### string to be able to work out the starting position of the read which is on the 3' end of the sequence | |
| 1695 my $MD_count = 0; # counting all operations that affect the genomic position, i.e. M and D. Insertions do not affect the start position | |
| 1696 foreach (@comp_cigar) { | |
| 1697 ++$MD_count if ($_ eq 'M' or $_ eq 'D'); | |
| 1698 } | |
| 1699 $start += $MD_count - 1; | |
| 1700 } | |
| 1701 | |
| 1702 ### reconstituting shortened CIGAR string | |
| 1703 my $new_cigar; | |
| 1704 my $count = 0; | |
| 1705 my $last_op; | |
| 1706 # print "ignore adjusted: @comp_cigar\n"; | |
| 1707 foreach my $op (@comp_cigar) { | |
| 1708 unless (defined $last_op){ | |
| 1709 $last_op = $op; | |
| 1710 ++$count; | |
| 1711 next; | |
| 1712 } | |
| 1713 if ($last_op eq $op) { | |
| 1714 ++$count; | |
| 1715 } else { | |
| 1716 $new_cigar .= "$count$last_op"; | |
| 1717 $last_op = $op; | |
| 1718 $count = 1; | |
| 1719 } | |
| 1720 } | |
| 1721 $new_cigar .= "$count$last_op"; # appending the last operation and count | |
| 1722 $cigar = $new_cigar; | |
| 1723 # print "ignore adjusted scalar: $cigar\n"; | |
| 1724 } | |
| 1725 | |
| 1726 ####################### | |
| 1727 ### INGORE 3' END ### | |
| 1728 ####################### | |
| 1729 | |
| 1730 # Clipping off the last <int> number of bases from the methylation call string as specified with --ignore_3prime <int> | |
| 1731 if ($ignore_3prime) { | |
| 1732 # warn "$meth_call\n"; | |
| 1733 $meth_call = substr($meth_call,0, (length($meth_call)) - $ignore_3prime); | |
| 1734 # warn "$meth_call\n";sleep(1); | |
| 1735 | |
| 1736 ### If we are ignoring a part of the sequence we also need to adjust the cigar string accordingly | |
| 1737 | |
| 1738 my @len = split (/\D+/,$cigar); # storing the length per operation | |
| 1739 my @ops = split (/\d+/,$cigar); # storing the operation | |
| 1740 shift @ops; # remove the empty first element | |
| 1741 die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len == scalar @ops); | |
| 1742 | |
| 1743 my @comp_cigar; # building an array with all CIGAR operations | |
| 1744 foreach my $index (0..$#len) { | |
| 1745 foreach (1..$len[$index]) { | |
| 1746 # print "$ops[$index]"; | |
| 1747 push @comp_cigar, $ops[$index]; | |
| 1748 } | |
| 1749 } | |
| 1750 | |
| 1751 # print "original CIGAR: $cigar\n"; | |
| 1752 # print join ("",@comp_cigar),"\n"; | |
| 1753 | |
| 1754 ### If we are clipping off some bases at the end we might have to adjust the start position of the alignments accordingly | |
| 1755 if ($strand eq '+') { | |
| 1756 | |
| 1757 ### clipping the 3' end does not affect the starting position of forward strand alignments | |
| 1758 # ignore 5' has already been taken care of at this stage, if relevant at all | |
| 1759 | |
| 1760 for (1..$ignore_3prime) { | |
| 1761 my $op = pop @comp_cigar; # adjusting composite CIGAR string by removing $ignore_3prime operations from the end | |
| 1762 # print join ("",@comp_cigar),"\n"; | |
| 1763 # print "$_ deleted $op from 3' end\n"; | |
| 1764 while ($op eq 'D') { # repeating this for deletions (D) | |
| 1765 $op = pop @comp_cigar; | |
| 1766 # print join ("",@comp_cigar),"\n"; | |
| 1767 # print "$_ deleted $op from 3' end\n"; | |
| 1768 } | |
| 1769 } | |
| 1770 # print "Final truncated CIGAR string:\n"; | |
| 1771 # print join ("",@comp_cigar),"\n"; | |
| 1772 # $start += $ignore + $D_count - $I_count; | |
| 1773 # print "start $start\t ignore_3prime: $ignore_3prime\t D count: $D_count I_count: $I_count\n"; | |
| 1774 } | |
| 1775 elsif ($strand eq '-') { | |
| 1776 | |
| 1777 my $D_count = 0; # counting all deletions that affect the ignored genomic position, i.e. Deletions and insertions | |
| 1778 my $I_count = 0; | |
| 1779 | |
| 1780 for (1..$ignore_3prime) { | |
| 1781 my $op = shift @comp_cigar; # adjusting composite CIGAR string by removing $ignore_3prime operations, here the first value of the array | |
| 1782 while ($op eq 'D') { # repeating this for deletions (D) | |
| 1783 $D_count++; | |
| 1784 $op = shift @comp_cigar; | |
| 1785 } | |
| 1786 if ($op eq 'I') { # adjusting the genomic position for insertions (I) | |
| 1787 $I_count++; | |
| 1788 } | |
| 1789 | |
| 1790 } | |
| 1791 | |
| 1792 # here we need to discriminate if the start has been adjusted because of --ignore or not | |
| 1793 if ($ignore){ | |
| 1794 # the start position has already been modified for --ignore already, so we don't have to adjust the position again now | |
| 1795 } | |
| 1796 else{ | |
| 1797 # Here we need to add the length ignore_3prime to the read starting position | |
| 1798 # adjustment of the true starting position of this reverse read will take place later in the methylation extraction step | |
| 1799 $start += $ignore_3prime + $D_count - $I_count; | |
| 1800 } | |
| 1801 | |
| 1802 } | |
| 1803 | |
| 1804 ### reconstituting shortened CIGAR string | |
| 1805 my $new_cigar; | |
| 1806 my $count = 0; | |
| 1807 my $last_op; | |
| 1808 # print "ignore_3prime adjusted:\n"; print join ("",@comp_cigar),"\n"; | |
| 1809 foreach my $op (@comp_cigar) { | |
| 1810 unless (defined $last_op){ | |
| 1811 $last_op = $op; | |
| 1812 ++$count; | |
| 1813 next; | |
| 1814 } | |
| 1815 if ($last_op eq $op) { | |
| 1816 ++$count; | |
| 1817 } else { | |
| 1818 $new_cigar .= "$count$last_op"; | |
| 1819 $last_op = $op; | |
| 1820 $count = 1; | |
| 1821 } | |
| 1822 } | |
| 1823 $new_cigar .= "$count$last_op"; # appending the last operation and count | |
| 1824 $cigar = $new_cigar; | |
| 1825 # print "ignore_3prime adjusted scalar: $cigar\n"; | |
| 1826 } | |
| 1827 } | |
| 1828 ### printing out the methylation state of every C in the read | |
| 1829 print_individual_C_methylation_states_single_end($meth_call,$chrom,$start,$id,$strand,$index,$cigar); | |
| 1830 | |
| 1831 ++$methylation_call_strings_processed; # 1 per single-end result | |
| 1832 } | |
| 1833 } | |
| 1834 } | |
| 1835 | |
| 1836 ### PROCESSING PAIRED-END RESULT FILES | |
| 1837 elsif ($paired) { | |
| 1838 | |
| 1839 ### proceeding differently now for SAM format or vanilla Bismark format files | |
| 1840 if ($vanilla) { # old vanilla Bismark paired-end output format | |
| 1841 while (<IN>) { | |
| 1842 ++$line_count; | |
| 1843 warn "processed line: $line_count\n" if ($line_count%500000 == 0); | |
| 1844 | |
| 1845 if ( ($line_count - $offset)%$multicore == 0){ | |
| 1846 # warn "line count: $line_count\noffset: $offset\n"; | |
| 1847 # warn "Modulus: ",($line_count - $offset)%$multicore,"\n"; | |
| 1848 # warn "processing this line $line_count (processID: $process_id with \$offset $offset)\n"; | |
| 1849 } | |
| 1850 else{ | |
| 1851 # warn "skipping line $line_count for processID: $process_id with \$offset $offset)\n"; | |
| 1852 next; | |
| 1853 } | |
| 1854 | |
| 1855 ### $seq here is the chromosomal sequence (to use for the repeat analysis for example) | |
| 1856 my ($id,$strand,$chrom,$start_read_1,$end_read_2,$seq_1,$meth_call_1,$seq_2,$meth_call_2,$first_read_conversion,$genome_conversion) = (split("\t"))[0,1,2,3,4,6,7,9,10,11,12,13]; | |
| 1857 | |
| 1858 my $index; | |
| 1859 chomp $genome_conversion; | |
| 1860 | |
| 1861 if ($first_read_conversion eq 'CT' and $genome_conversion eq 'CT') { | |
| 1862 $index = 0; ## this is OT | |
| 1863 } elsif ($first_read_conversion eq 'GA' and $genome_conversion eq 'GA') { | |
| 1864 $index = 2; ## this is CTOB!!! | |
| 1865 } elsif ($first_read_conversion eq 'GA' and $genome_conversion eq 'CT') { | |
| 1866 $index = 1; ## this is CTOT!!! | |
| 1867 } elsif ($first_read_conversion eq 'CT' and $genome_conversion eq 'GA') { | |
| 1868 $index = 3; ## this is OB | |
| 1869 } else { | |
| 1870 die "Unexpected combination of read and genome conversion: $first_read_conversion / $genome_conversion\n"; | |
| 1871 } | |
| 1872 | |
| 1873 if ($meth_call_1 and $meth_call_2) { | |
| 1874 ### Clipping off the first <int> number of bases from the methylation call strings as specified with '--ignore <int>' | |
| 1875 | |
| 1876 ### IGNORE FROM 5' END | |
| 1877 if ($ignore) { | |
| 1878 $meth_call_1 = substr($meth_call_1,$ignore,length($meth_call_1)-$ignore); | |
| 1879 | |
| 1880 ### we also need to adjust the start and end positions of the alignments accordingly if '--ignore' was specified | |
| 1881 $start_read_1 += $ignore; | |
| 1882 } | |
| 1883 if ($ignore_r2) { | |
| 1884 $meth_call_2 = substr($meth_call_2,$ignore_r2,length($meth_call_2)-$ignore_r2); | |
| 1885 | |
| 1886 ### we also need to adjust the start and end positions of the alignments accordingly if '--ignore_r2' was specified | |
| 1887 $end_read_2 -= $ignore_r2; | |
| 1888 } | |
| 1889 | |
| 1890 ### IGNORE 3' END | |
| 1891 | |
| 1892 ### Clipping off the last <int> number of bases from the methylation call string of Read 1 as specified with --ignore_3prime <int> | |
| 1893 if ($ignore_3prime) { | |
| 1894 $meth_call_1 = substr($meth_call_1,0, length($meth_call_1) - $ignore_3prime); | |
| 1895 # we don't have to adjust the position now since the shortened methylation call will be fine, see below | |
| 1896 } | |
| 1897 ### Clipping off the last <int> number of bases from the methylation call string of Read 2 as specified with --ignore_3prime_r2 <int> | |
| 1898 if ($ignore_3prime_r2) { | |
| 1899 $meth_call_2 = substr($meth_call_2,0, length($meth_call_2) - $ignore_3prime_r2); | |
| 1900 # we don't have to adjust the position now since the shortened methylation call will be fine, see below | |
| 1901 } | |
| 1902 | |
| 1903 my $end_read_1; | |
| 1904 my $start_read_2; | |
| 1905 | |
| 1906 if ($strand eq '+') { | |
| 1907 | |
| 1908 $end_read_1 = $start_read_1 + length($meth_call_1) - 1; | |
| 1909 $start_read_2 = $end_read_2 - length($meth_call_2) + 1; | |
| 1910 | |
| 1911 ## we first pass the first read which is in + orientation on the forward strand | |
| 1912 print_individual_C_methylation_states_paired_end_files($meth_call_1,$chrom,$start_read_1,$id,'+',$index,0,0,undef,1); # the last two values are CIGAR string and read identity | |
| 1913 | |
| 1914 # we next pass the second read which is in - orientation on the reverse strand | |
| 1915 ### if --no_overlap was specified we also pass the end of read 1. If read 2 starts to overlap with read 1 we can stop extracting methylation calls from read 2 | |
| 1916 print_individual_C_methylation_states_paired_end_files($meth_call_2,$chrom,$end_read_2,$id,'-',$index,$no_overlap,$end_read_1,undef,2); | |
| 1917 } | |
| 1918 else { | |
| 1919 | |
| 1920 $end_read_1 = $start_read_1+length($meth_call_2)-1; # read 1 is the second reported read! | |
| 1921 $start_read_2 = $end_read_2-length($meth_call_1)+1; # read 2 is the first reported read! | |
| 1922 | |
| 1923 ## we first pass the first read which is in - orientation on the reverse strand | |
| 1924 print_individual_C_methylation_states_paired_end_files($meth_call_1,$chrom,$end_read_2,$id,'-',$index,0,0,undef,1); | |
| 1925 | |
| 1926 # we next pass the second read which is in + orientation on the forward strand | |
| 1927 ### if --no_overlap was specified we also pass the end of read 2. If read 2 starts to overlap with read 1 we will stop extracting methylation calls from read 2 | |
| 1928 print_individual_C_methylation_states_paired_end_files($meth_call_2,$chrom,$start_read_1,$id,'+',$index,$no_overlap,$start_read_2,undef,2); | |
| 1929 } | |
| 1930 | |
| 1931 $methylation_call_strings_processed += 2; # paired-end = 2 methylation calls | |
| 1932 } | |
| 1933 } | |
| 1934 } | |
| 1935 else { # Bismark paired-end BAM/SAM output format (default) | |
| 1936 while (<IN>) { | |
| 1937 chomp; | |
| 1938 ### SAM format can either start with header lines (starting with @) or start with alignments directly | |
| 1939 if (/^\@/) { # skipping header lines (starting with @) | |
| 1940 warn "skipping SAM header line:\t$_\n" unless ($process_id == 0); # no additional warnings for child procesess | |
| 1941 next; | |
| 1942 } | |
| 1943 | |
| 1944 ++$line_count; | |
| 1945 warn "Processed lines: $line_count\n" if ($line_count%500000==0); | |
| 1946 | |
| 1947 if ( ($line_count - $offset)%$multicore == 0){ | |
| 1948 # warn "line count: $line_count\noffset: $offset\n"; | |
| 1949 # warn "Modulus: ",($line_count - $offset)%$multicore,"\n"; | |
| 1950 # warn "processing this line $line_count (processID: $process_id with \$offset $offset)\n"; | |
| 1951 } | |
| 1952 else{ | |
| 1953 # warn "skipping line $line_count for processID: $process_id with \$offset $offset)\n"; | |
| 1954 $_ = <IN>; # reading and skipping another line since this is the paired-end read | |
| 1955 next; | |
| 1956 } | |
| 1957 | |
| 1958 # example paired-end reads in SAM format (2 consecutive lines) | |
| 1959 # 1_R1/1 67 5 103172224 255 40M = 103172417 233 AATATTTTTTTTATTTTAAAATGTGTATTGATTTAAATTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:4 XX:Z:4T1T24TT7 XM:Z:....h.h........................hh....... XR:Z:CT XG:Z:CT | |
| 1960 # 1_R1/2 131 5 103172417 255 40M = 103172224 -233 TATTTTTTTTTAGAGTATTTTTTAATGGTTATTAGATTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:6 XX:Z:T5T1T9T9T7T3 XM:Z:h.....h.h.........h.........h.......h... XR:Z:GA XG:Z:CT | |
| 1961 | |
| 1962 my ($id_1,$chrom,$start_read_1,$cigar_1) = (split("\t"))[0,2,3,5]; ### detecting the following SAM flags in case the SAM entry was shuffled by CRAM or Goby compression/decompression | |
| 1963 my $meth_call_1; | |
| 1964 my $first_read_conversion; | |
| 1965 my $genome_conversion; | |
| 1966 | |
| 1967 while ( /(XM|XR|XG):Z:([^\t]+)/g ) { | |
| 1968 my $tag = $1; | |
| 1969 my $value = $2; | |
| 1970 | |
| 1971 if ($tag eq "XM") { | |
| 1972 $meth_call_1 = $value; | |
| 1973 $meth_call_1 =~ s/\r//; | |
| 1974 } elsif ($tag eq "XR") { | |
| 1975 $first_read_conversion = $value; | |
| 1976 $first_read_conversion =~ s/\r//; | |
| 1977 } elsif ($tag eq "XG") { | |
| 1978 $genome_conversion = $value; | |
| 1979 $genome_conversion =~ s/\r//; | |
| 1980 } | |
| 1981 } | |
| 1982 | |
| 1983 $_ = <IN>; # reading in the paired read | |
| 1984 chomp; | |
| 1985 | |
| 1986 my ($id_2,$start_read_2,$cigar_2) = (split("\t"))[0,3,5]; ### detecting the following SAM flags in case the SAM entry was shuffled by CRAM or Goby compression/decompression | |
| 1987 | |
| 1988 my $meth_call_2; | |
| 1989 my $second_read_conversion; | |
| 1990 | |
| 1991 while ( /(XM|XR):Z:([^\t]+)/g ) { | |
| 1992 my $tag = $1; | |
| 1993 my $value = $2; | |
| 1994 | |
| 1995 if ($tag eq "XM") { | |
| 1996 $meth_call_2 = $value; | |
| 1997 $meth_call_2 =~ s/\r//; | |
| 1998 } elsif ($tag eq "XR") { | |
| 1999 $second_read_conversion = $value; | |
| 2000 $second_read_conversion = s/\r//; | |
| 2001 } | |
| 2002 } | |
| 2003 | |
| 2004 # < version 0.7.6 $genome_conversion =~ s/^XG:Z://; | |
| 2005 # chomp $genome_conversion; # in case it captured a new line character # already removed | |
| 2006 | |
| 2007 # print join ("\t",$meth_call_1,$meth_call_2,$first_read_conversion,$second_read_conversion,$genome_conversion),"\n"; | |
| 2008 | |
| 2009 my $index; | |
| 2010 my $strand; | |
| 2011 | |
| 2012 if ($first_read_conversion eq 'CT' and $genome_conversion eq 'CT') { | |
| 2013 $index = 0; ## this is OT | |
| 2014 $strand = '+'; | |
| 2015 } elsif ($first_read_conversion eq 'GA' and $genome_conversion eq 'CT') { | |
| 2016 $index = 1; ## this is CTOT | |
| 2017 $strand = '-'; | |
| 2018 } elsif ($first_read_conversion eq 'GA' and $genome_conversion eq 'GA') { | |
| 2019 $index = 2; ## this is CTOB | |
| 2020 $strand = '+'; | |
| 2021 } elsif ($first_read_conversion eq 'CT' and $genome_conversion eq 'GA') { | |
| 2022 $index = 3; ## this is OB | |
| 2023 $strand = '-'; | |
| 2024 } else { | |
| 2025 die "Unexpected combination of read and genome conversion: $first_read_conversion / $genome_conversion\n"; | |
| 2026 } | |
| 2027 | |
| 2028 ### reversing the methylation call of the read that was reverse-complemented | |
| 2029 if ($strand eq '+') { | |
| 2030 $meth_call_2 = reverse $meth_call_2; | |
| 2031 } else { | |
| 2032 $meth_call_1 = reverse $meth_call_1; | |
| 2033 } | |
| 2034 # warn "\n$meth_call_1\n$meth_call_2\n"; | |
| 2035 | |
| 2036 if ($meth_call_1 and $meth_call_2) { | |
| 2037 | |
| 2038 my $end_read_1; | |
| 2039 | |
| 2040 ### READ 1 | |
| 2041 my @len_1 = split (/\D+/,$cigar_1); # storing the length per operation | |
| 2042 my @ops_1 = split (/\d+/,$cigar_1); # storing the operation | |
| 2043 shift @ops_1; # remove the empty first element | |
| 2044 | |
| 2045 die "CIGAR string contained a non-matching number of lengths and operations: $cigar_1\n".join(" ",@len_1)."\n".join(" ",@ops_1)."\n" unless (scalar @len_1 == scalar @ops_1); | |
| 2046 | |
| 2047 my @comp_cigar_1; # building an array with all CIGAR operations | |
| 2048 foreach my $index (0..$#len_1) { | |
| 2049 foreach (1..$len_1[$index]) { | |
| 2050 # print "$ops_1[$index]"; | |
| 2051 push @comp_cigar_1, $ops_1[$index]; | |
| 2052 } | |
| 2053 } | |
| 2054 # print "original CIGAR read 1: $cigar_1\n"; | |
| 2055 # print "original CIGAR read 1: @comp_cigar_1\n"; | |
| 2056 | |
| 2057 ### READ 2 | |
| 2058 my @len_2 = split (/\D+/,$cigar_2); # storing the length per operation | |
| 2059 my @ops_2 = split (/\d+/,$cigar_2); # storing the operation | |
| 2060 shift @ops_2; # remove the empty first element | |
| 2061 die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len_2 == scalar @ops_2); | |
| 2062 my @comp_cigar_2; # building an array with all CIGAR operations for read 2 | |
| 2063 foreach my $index (0..$#len_2) { | |
| 2064 foreach (1..$len_2[$index]) { | |
| 2065 # print "$ops_2[$index]"; | |
| 2066 push @comp_cigar_2, $ops_2[$index]; | |
| 2067 } | |
| 2068 } | |
| 2069 # print "original CIGAR read 2: $cigar_2\n"; | |
| 2070 # print "original CIGAR read 2: @comp_cigar_2\n"; | |
| 2071 | |
| 2072 ################################## | |
| 2073 ### IGNORE BASES FROM 5' END ### | |
| 2074 ################################## | |
| 2075 | |
| 2076 if ($ignore) { | |
| 2077 ### Clipping off the first <int> number of bases from the methylation call string as specified with '--ignore <int>' for read 1 | |
| 2078 ### the methylation calls have already been reversed where necessary | |
| 2079 | |
| 2080 if ( (length($meth_call_1) - $ignore) <= 0){ | |
| 2081 # next; # skipping this read entirely if the read is shorter than the portion to be ignored | |
| 2082 $meth_call_1 = undef; # will skip this read entirely since the read is shorter than the portion to be ignored | |
| 2083 } | |
| 2084 else { | |
| 2085 $meth_call_1 = substr($meth_call_1,$ignore,length($meth_call_1)-$ignore); | |
| 2086 | |
| 2087 if ($strand eq '+') { | |
| 2088 | |
| 2089 ### if the (read 1) strand information is '+', read 1 needs to be trimmed from the start | |
| 2090 my $D_count_1 = 0; # counting all deletions that affect the ignored genomic position for read 1, i.e. Deletions and insertions | |
| 2091 my $I_count_1 = 0; | |
| 2092 | |
| 2093 for (1..$ignore) { | |
| 2094 my $op = shift @comp_cigar_1; # adjusting composite CIGAR string of read 1 by removing $ignore operations from the start | |
| 2095 # print "$_ deleted $op\n"; | |
| 2096 | |
| 2097 while ($op eq 'D') { # repeating this for deletions (D) | |
| 2098 $D_count_1++; | |
| 2099 $op = shift @comp_cigar_1; | |
| 2100 # print "$_ deleted $op\n"; | |
| 2101 } | |
| 2102 if ($op eq 'I') { # adjusting the genomic position for insertions (I) | |
| 2103 $I_count_1++; | |
| 2104 } | |
| 2105 } | |
| 2106 | |
| 2107 $start_read_1 += $ignore + $D_count_1 - $I_count_1; | |
| 2108 # print "start read 1 $start_read_1\t ignore: $ignore\t D count 1: $D_count_1\tI_count 1: $I_count_1\n"; | |
| 2109 | |
| 2110 # the start position of reads mapping to the reverse strand is being adjusted further below | |
| 2111 } | |
| 2112 elsif ($strand eq '-') { | |
| 2113 | |
| 2114 ### if the (read 1) strand information is '-', read 1 needs to be trimmed from the back | |
| 2115 for (1..$ignore) { | |
| 2116 my $op = pop @comp_cigar_1; # adjusting composite CIGAR string by removing $ignore operations, here the last value of the array | |
| 2117 while ($op eq 'D') { # repeating this for deletions (D) | |
| 2118 $op = pop @comp_cigar_1; | |
| 2119 } | |
| 2120 } | |
| 2121 # the start position of reads mapping to the reverse strand is being adjusted further below | |
| 2122 | |
| 2123 } | |
| 2124 } | |
| 2125 } | |
| 2126 | |
| 2127 if ($ignore_r2) { | |
| 2128 ### Clipping off the first <int> number of bases from the methylation call string as specified with '--ignore_r2 <int>' for read 2 | |
| 2129 ### the methylation calls have already been reversed where necessary | |
| 2130 | |
| 2131 if ( (length($meth_call_2) - $ignore_r2) <= 0){ | |
| 2132 # next; # skipping this read entirely if the read is shorter than the portion to be ignored # this would skip the entire read pair! | |
| 2133 $meth_call_2 = undef; # will skip this read entirely since the read is shorter than the portion to be ignored | |
| 2134 } | |
| 2135 else { | |
| 2136 $meth_call_2 = substr($meth_call_2,$ignore_r2,length($meth_call_2)-$ignore_r2); | |
| 2137 | |
| 2138 ### If we are ignoring a part of the sequence we also need to adjust the cigar string accordingly | |
| 2139 | |
| 2140 if ($strand eq '+') { | |
| 2141 | |
| 2142 ### if the (read 1) strand information is '+', read 2 needs to be trimmed from the back | |
| 2143 | |
| 2144 for (1..$ignore_r2) { | |
| 2145 my $op = pop @comp_cigar_2; # adjusting composite CIGAR string by removing $ignore operations, here the last value of the array | |
| 2146 while ($op eq 'D') { # repeating this for deletions (D) | |
| 2147 $op = pop @comp_cigar_2; | |
| 2148 } | |
| 2149 } | |
| 2150 # the start position of reads mapping to the reverse strand is being adjusted further below | |
| 2151 } | |
| 2152 elsif ($strand eq '-') { | |
| 2153 | |
| 2154 ### if the (read 1) strand information is '-', read 2 needs to be trimmed from the start | |
| 2155 my $D_count_2 = 0; # counting all deletions that affect the ignored genomic position for read 2, i.e. Deletions and insertions | |
| 2156 my $I_count_2 = 0; | |
| 2157 | |
| 2158 for (1..$ignore_r2) { | |
| 2159 my $op = shift @comp_cigar_2; # adjusting composite CIGAR string of read 2 by removing $ignore operations from the start | |
| 2160 # print "$_ deleted $op\n"; | |
| 2161 | |
| 2162 while ($op eq 'D') { # repeating this for deletions (D) | |
| 2163 $D_count_2++; | |
| 2164 $op = shift @comp_cigar_2; | |
| 2165 # print "$_ deleted $op\n"; | |
| 2166 } | |
| 2167 if ($op eq 'I') { # adjusting the genomic position for insertions (I) | |
| 2168 $I_count_2++; | |
| 2169 } | |
| 2170 } | |
| 2171 | |
| 2172 $start_read_2 += $ignore_r2 + $D_count_2 - $I_count_2; | |
| 2173 # print "start read 2 $start_read_2\t ignore R2: $ignore_r2\t D count 2: $D_count_2\tI_count 2: $I_count_2\n"; | |
| 2174 } | |
| 2175 } | |
| 2176 } | |
| 2177 | |
| 2178 if ($ignore and $meth_call_1){ # if the methylation call string is undefined at this position we don't need any new CIGAR string | |
| 2179 | |
| 2180 ### reconstituting shortened CIGAR string 1 | |
| 2181 my $new_cigar_1; | |
| 2182 my $count_1 = 0; | |
| 2183 my $last_op_1; | |
| 2184 # print "ignore adjusted CIGAR 1: @comp_cigar_1\n"; | |
| 2185 foreach my $op (@comp_cigar_1) { | |
| 2186 unless (defined $last_op_1){ | |
| 2187 $last_op_1 = $op; | |
| 2188 ++$count_1; | |
| 2189 next; | |
| 2190 } | |
| 2191 if ($last_op_1 eq $op) { | |
| 2192 ++$count_1; | |
| 2193 } else { | |
| 2194 $new_cigar_1 .= "$count_1$last_op_1"; | |
| 2195 $last_op_1 = $op; | |
| 2196 $count_1 = 1; | |
| 2197 } | |
| 2198 } | |
| 2199 $new_cigar_1 .= "$count_1$last_op_1"; # appending the last operation and count | |
| 2200 $cigar_1 = $new_cigar_1; | |
| 2201 # print "ignore adjusted CIGAR 1 scalar: $cigar_1\n"; | |
| 2202 } | |
| 2203 | |
| 2204 if ($ignore_r2 and $meth_call_2){ # if the methylation call string is undefined at this point we don't need any new CIGAR string | |
| 2205 | |
| 2206 ### reconstituting shortened CIGAR string 2 | |
| 2207 my $new_cigar_2; | |
| 2208 my $count_2 = 0; | |
| 2209 my $last_op_2; | |
| 2210 # print "ignore adjusted CIGAR 2: @comp_cigar_2\n"; | |
| 2211 foreach my $op (@comp_cigar_2) { | |
| 2212 unless (defined $last_op_2){ | |
| 2213 $last_op_2 = $op; | |
| 2214 ++$count_2; | |
| 2215 next; | |
| 2216 } | |
| 2217 if ($last_op_2 eq $op) { | |
| 2218 ++$count_2; | |
| 2219 } | |
| 2220 else { | |
| 2221 $new_cigar_2 .= "$count_2$last_op_2"; | |
| 2222 $last_op_2 = $op; | |
| 2223 $count_2 = 1; | |
| 2224 } | |
| 2225 } | |
| 2226 $new_cigar_2 .= "$count_2$last_op_2"; # appending the last operation and count | |
| 2227 $cigar_2 = $new_cigar_2; | |
| 2228 # print "ignore_r2 adjusted CIGAR 2 scalar: $cigar_2\n"; | |
| 2229 } | |
| 2230 | |
| 2231 ########################### | |
| 2232 ### END IGNORE 5' END ### | |
| 2233 ########################### | |
| 2234 | |
| 2235 ################################## | |
| 2236 ### IGNORE BASES FROM 3' END ### | |
| 2237 ################################## | |
| 2238 | |
| 2239 # print "CIGAR string before truncating 3' end (Read 1)\n"; | |
| 2240 # print join ("",@comp_cigar_1),"\n"; | |
| 2241 | |
| 2242 if ($ignore_3prime and $meth_call_1) { # if the methylation call string is undefined at this point we don't need to process the read any further | |
| 2243 | |
| 2244 ### Clipping off the last <int> number of bases from the methylation call string as specified with '--ignore_3prime <int>' for read 1 | |
| 2245 ### the methylation calls have already been reversed where necessary | |
| 2246 | |
| 2247 if ( (length($meth_call_1) - $ignore_3prime) <= 0){ | |
| 2248 $meth_call_1 = undef; # will skip this read entirely since the read is shorter than the portion to be ignored | |
| 2249 } | |
| 2250 else { | |
| 2251 $meth_call_1 = substr($meth_call_1,0,length($meth_call_1) - $ignore_3prime); | |
| 2252 # warn "truncated meth_call 1:\n$meth_call_1\n"; | |
| 2253 | |
| 2254 if ($strand eq '+') { | |
| 2255 | |
| 2256 ### if the (read 1) strand information is '+', clipping the 3' end does not affect the starting position of forward strand alignments | |
| 2257 # ignore 5' has already been taken care of at this stage, if relevant at all | |
| 2258 | |
| 2259 for (1..$ignore_3prime) { | |
| 2260 my $op = pop @comp_cigar_1; # adjusting composite CIGAR string of read 1 by removing $ignore_3prime operations from the end | |
| 2261 # print "$_ deleted $op from 3' end\n"; | |
| 2262 # print join ("",@comp_cigar_1),"\n"; | |
| 2263 | |
| 2264 while ($op eq 'D') { # repeating this for deletions (D) | |
| 2265 $op = pop @comp_cigar_1; | |
| 2266 # print join ("",@comp_cigar_1),"\n"; | |
| 2267 # print "$_ deleted $op from 3' end\n"; | |
| 2268 } | |
| 2269 } | |
| 2270 | |
| 2271 # print "Final truncated CIGAR string (Read 1):\n"; | |
| 2272 # print join ("",@comp_cigar_1),"\n"; | |
| 2273 | |
| 2274 } | |
| 2275 elsif ($strand eq '-') { | |
| 2276 | |
| 2277 my $D_count_1 = 0; # counting all deletions that affect the ignored genomic position for read 1, i.e. Deletions and insertions | |
| 2278 my $I_count_1 = 0; | |
| 2279 | |
| 2280 ### if the (read 1) strand information is '-', the read 1 CIGAR string needs to be trimmed from the start | |
| 2281 for (1..$ignore_3prime) { | |
| 2282 my $op = shift @comp_cigar_1; # adjusting composite CIGAR string by removing $ignore_3prime operations, here the first value of the array | |
| 2283 # print join ("",@comp_cigar_1),"\n"; | |
| 2284 | |
| 2285 while ($op eq 'D') { # repeating this for deletions (D) | |
| 2286 $D_count_1++; | |
| 2287 $op = shift @comp_cigar_1; | |
| 2288 # print join ("",@comp_cigar_1),"\n"; | |
| 2289 } | |
| 2290 | |
| 2291 if ($op eq 'I') { # adjusting the genomic position for insertions (I) | |
| 2292 $I_count_1++; | |
| 2293 } | |
| 2294 } | |
| 2295 | |
| 2296 # print "Final truncated CIGAR string reverse_read:\n"; | |
| 2297 # print join ("",@comp_cigar_1),"\n"; | |
| 2298 | |
| 2299 # Here we need to add the length ignore_3prime to the read starting position | |
| 2300 # adjustment of the true start position of this reverse read will take place later in the methylation extraction step | |
| 2301 $start_read_1 += $ignore_3prime + $D_count_1 - $I_count_1; | |
| 2302 | |
| 2303 } | |
| 2304 } | |
| 2305 } | |
| 2306 | |
| 2307 if ($ignore_3prime_r2 and $meth_call_2) { # if the methylation call string is undefined at this point we don't need to process the read any further | |
| 2308 | |
| 2309 ### Clipping off the last <int> number of bases from the methylation call string as specified with '--ignore_3prime_r2 <int>' for read 2 | |
| 2310 ### the methylation calls have already been reversed where necessary | |
| 2311 | |
| 2312 if ( (length($meth_call_2) - $ignore_3prime_r2) <= 0){ | |
| 2313 $meth_call_2 = undef; # will skip this read entirely since the read is shorter than the portion to be ignored | |
| 2314 } | |
| 2315 else { | |
| 2316 $meth_call_2 = substr($meth_call_2,0,length($meth_call_2) - $ignore_3prime_r2); | |
| 2317 # warn "truncated meth_call 2:\n$meth_call_2\n"; | |
| 2318 | |
| 2319 ### If we are ignoring a part of the sequence we also need to adjust the cigar string and the positions accordingly | |
| 2320 | |
| 2321 if ($strand eq '+') { | |
| 2322 | |
| 2323 ### if the (read 1) strand information is '+', clipping the 3' end of read 2 does potentially affect the starting position of read 2 (reverse strand alignment) | |
| 2324 ### if the (read 1) strand information is '+', read 2 needs to be trimmed from the start | |
| 2325 | |
| 2326 my $D_count_2 = 0; # counting all deletions that affect the ignored genomic position for read 2, i.e. Deletions and insertions | |
| 2327 my $I_count_2 = 0; | |
| 2328 | |
| 2329 for (1..$ignore_3prime_r2) { | |
| 2330 my $op = shift @comp_cigar_2; # adjusting composite CIGAR string by removing $ignore operations, here the first value of the array | |
| 2331 # print "$_ deleted $op from 3' end\n"; | |
| 2332 # print join ("",@comp_cigar_2),"\n"; | |
| 2333 | |
| 2334 while ($op eq 'D') { # repeating this for deletions (D) | |
| 2335 $D_count_2++; | |
| 2336 $op = shift @comp_cigar_2; | |
| 2337 # print "$_ deleted $op from 3' end\n"; | |
| 2338 # print join ("",@comp_cigar_2),"\n"; | |
| 2339 } | |
| 2340 | |
| 2341 if ($op eq 'I') { # adjusting the genomic position for insertions (I) | |
| 2342 $I_count_2++; | |
| 2343 } | |
| 2344 } | |
| 2345 | |
| 2346 # print "Final truncated CIGAR string 2 (+ alignment):\n"; | |
| 2347 # print join ("",@comp_cigar_2),"\n"; | |
| 2348 | |
| 2349 # Here we need to add the length ignore_3prime_r2 to the read starting position | |
| 2350 # adjustment of the true start position of this reverse read will take place later in the methylation extraction step | |
| 2351 $start_read_2 += $ignore_3prime_r2 + $D_count_2 - $I_count_2; | |
| 2352 | |
| 2353 # print "start read 2 $start_read_2\t ignore R2: $ignore_r2\t D count 2: $D_count_2\tI_count 2: $I_count_2\n"; | |
| 2354 } | |
| 2355 elsif ($strand eq '-') { | |
| 2356 ### if the (read 1) strand information is '-', clipping the 3' end of read 2 does not affect its starting position (forward strand alignment) | |
| 2357 ### ignore_r2 5' has already been taken care of at this stage, if relevant at all | |
| 2358 | |
| 2359 ### if the (read 1) strand information is '-', read 2 needs to be trimmed from the end | |
| 2360 | |
| 2361 for (1..$ignore_3prime_r2) { | |
| 2362 my $op = pop @comp_cigar_2; # adjusting composite CIGAR string of read 2 by removing $ignore operations from the start | |
| 2363 # print "$_ deleted $op\n"; | |
| 2364 # print join ("",@comp_cigar_2),"\n"; | |
| 2365 | |
| 2366 while ($op eq 'D') { # repeating this for deletions (D) | |
| 2367 $op = pop @comp_cigar_2; | |
| 2368 # print "$_ deleted $op\n"; | |
| 2369 # print join ("",@comp_cigar_2),"\n"; | |
| 2370 } | |
| 2371 } | |
| 2372 | |
| 2373 # print "Final truncated CIGAR string 2 (- alignment):\n"; | |
| 2374 # print join ("",@comp_cigar_2),"\n"; | |
| 2375 | |
| 2376 } | |
| 2377 } | |
| 2378 } | |
| 2379 | |
| 2380 if ($ignore_3prime and $meth_call_1){ # if the methylation call string is undefined at this point we don't need any new CIGAR string | |
| 2381 | |
| 2382 ### reconstituting shortened CIGAR string 1 | |
| 2383 my $new_cigar_1; | |
| 2384 my $count_1 = 0; | |
| 2385 my $last_op_1; | |
| 2386 # print "ignore_3prime adjusted CIGAR 1: @comp_cigar_1\n"; | |
| 2387 foreach my $op (@comp_cigar_1) { | |
| 2388 unless (defined $last_op_1){ | |
| 2389 $last_op_1 = $op; | |
| 2390 ++$count_1; | |
| 2391 next; | |
| 2392 } | |
| 2393 if ($last_op_1 eq $op) { | |
| 2394 ++$count_1; | |
| 2395 } | |
| 2396 else { | |
| 2397 $new_cigar_1 .= "$count_1$last_op_1"; | |
| 2398 $last_op_1 = $op; | |
| 2399 $count_1 = 1; | |
| 2400 } | |
| 2401 } | |
| 2402 $new_cigar_1 .= "$count_1$last_op_1"; # appending the last operation and count | |
| 2403 $cigar_1 = $new_cigar_1; | |
| 2404 # warn "ignore_3prime adjusted CIGAR 1 scalar: $cigar_1\n"; | |
| 2405 } | |
| 2406 | |
| 2407 if ($ignore_3prime_r2 and $meth_call_2){ # if the methylation call string is undefined at this point we don't need any new CIGAR string | |
| 2408 | |
| 2409 ### reconstituting shortened CIGAR string 2 | |
| 2410 my $new_cigar_2; | |
| 2411 my $count_2 = 0; | |
| 2412 my $last_op_2; | |
| 2413 # print "ignore_3prime_r2 adjusted CIGAR 2: @comp_cigar_2\n"; | |
| 2414 foreach my $op (@comp_cigar_2) { | |
| 2415 unless (defined $last_op_2){ | |
| 2416 $last_op_2 = $op; | |
| 2417 ++$count_2; | |
| 2418 next; | |
| 2419 } | |
| 2420 if ($last_op_2 eq $op) { | |
| 2421 ++$count_2; | |
| 2422 } | |
| 2423 else { | |
| 2424 $new_cigar_2 .= "$count_2$last_op_2"; | |
| 2425 $last_op_2 = $op; | |
| 2426 $count_2 = 1; | |
| 2427 } | |
| 2428 } | |
| 2429 $new_cigar_2 .= "$count_2$last_op_2"; # appending the last operation and count | |
| 2430 $cigar_2 = $new_cigar_2; | |
| 2431 # warn "ignore_3prime_r2 adjusted CIGAR 2 scalar: $cigar_2\n"; | |
| 2432 } | |
| 2433 | |
| 2434 ########################### | |
| 2435 ### END IGNORE 3' END ### | |
| 2436 ########################### | |
| 2437 | |
| 2438 | |
| 2439 ### Adjusting CIGAR string and starting position of reads in reverse orientation which we will pass to the extraction subroutine later on | |
| 2440 | |
| 2441 if ($strand eq '+') { | |
| 2442 ### adjusting the start position for all reads mapping to the reverse strand, in this case read 2 | |
| 2443 @comp_cigar_2 = reverse@comp_cigar_2; # the CIGAR string needs to be reversed for all reads aligning to the reverse strand, too | |
| 2444 # print "reverse: @comp_cigar_2\n"; | |
| 2445 | |
| 2446 my $MD_count_1 = 0; | |
| 2447 foreach (@comp_cigar_1) { | |
| 2448 ++$MD_count_1 if ($_ eq 'M' or $_ eq 'D'); # Matching bases or deletions affect the genomic position of the 3' ends of reads, insertions don't | |
| 2449 } | |
| 2450 | |
| 2451 my $MD_count_2 = 0; | |
| 2452 foreach (@comp_cigar_2) { | |
| 2453 ++$MD_count_2 if ($_ eq 'M' or $_ eq 'D'); # Matching bases or deletions affect the genomic position of the 3' ends of reads, insertions don't | |
| 2454 } | |
| 2455 | |
| 2456 $end_read_1 = $start_read_1 + $MD_count_1 - 1; | |
| 2457 $start_read_2 += $MD_count_2 - 1; ## Passing on the start position on the reverse strand | |
| 2458 } | |
| 2459 else { | |
| 2460 ### adjusting the start position for all reads mapping to the reverse strand, in this case read 1 | |
| 2461 | |
| 2462 @comp_cigar_1 = reverse@comp_cigar_1; # the CIGAR string needs to be reversed for all reads aligning to the reverse strand, too | |
| 2463 # print "reverse: @comp_cigar_1\n"; | |
| 2464 | |
| 2465 my $MD_count_1 = 0; | |
| 2466 foreach (@comp_cigar_1) { | |
| 2467 ++$MD_count_1 if ($_ eq 'M' or $_ eq 'D'); # Matching bases or deletions affect the genomic position of the 3' ends of reads, insertions don't | |
| 2468 } | |
| 2469 | |
| 2470 $end_read_1 = $start_read_1; | |
| 2471 $start_read_1 += $MD_count_1 - 1; ### Passing on the start position on the reverse strand | |
| 2472 } | |
| 2473 | |
| 2474 if ($strand eq '+') { | |
| 2475 ## we first pass the first read which is in + orientation on the forward strand; the last value is the read identity | |
| 2476 print_individual_C_methylation_states_paired_end_files($meth_call_1,$chrom,$start_read_1,$id_1,'+',$index,0,0,$cigar_1,1); | |
| 2477 | |
| 2478 # we next pass the second read which is in - orientation on the reverse strand | |
| 2479 ### if --no_overlap was specified we also pass the end of read 1. If read 2 starts to overlap with read 1 we can stop extracting methylation calls from read 2 | |
| 2480 print_individual_C_methylation_states_paired_end_files($meth_call_2,$chrom,$start_read_2,$id_2,'-',$index,$no_overlap,$end_read_1,$cigar_2,2); | |
| 2481 } | |
| 2482 else { | |
| 2483 ## we first pass the first read which is in - orientation on the reverse strand | |
| 2484 print_individual_C_methylation_states_paired_end_files($meth_call_1,$chrom,$start_read_1,$id_1,'-',$index,0,0,$cigar_1,1); | |
| 2485 | |
| 2486 # we next pass the second read which is in + orientation on the forward strand | |
| 2487 ### if --no_overlap was specified we also pass the end of read 1. If read 2 starts to overlap with read 1 we will stop extracting methylation calls from read 2 | |
| 2488 print_individual_C_methylation_states_paired_end_files($meth_call_2,$chrom,$start_read_2,$id_2,'+',$index,$no_overlap,$end_read_1,$cigar_2,2); | |
| 2489 } | |
| 2490 | |
| 2491 $methylation_call_strings_processed += 2; # paired-end = 2 methylation call strings | |
| 2492 } | |
| 2493 } | |
| 2494 } | |
| 2495 } else { | |
| 2496 die "Single-end or paired-end reads not specified properly\n"; | |
| 2497 } | |
| 2498 | |
| 2499 $counting{sequences_count} = $line_count; | |
| 2500 $counting{methylation_call_strings} = $methylation_call_strings_processed; | |
| 2501 | |
| 2502 if ($multicore == 1){ | |
| 2503 print_splitting_report (); | |
| 2504 } | |
| 2505 elsif ($multicore > 1){ | |
| 2506 print_splitting_report_multicore($report_filename,$offset,$line_count,$methylation_call_strings_processed); | |
| 2507 print_mbias_report_multicore($report_filename,$offset,$line_count,$methylation_call_strings_processed); | |
| 2508 } | |
| 2509 | |
| 2510 return ($process_id,\@pids,$report_filename); | |
| 2511 | |
| 2512 } | |
| 2513 | |
| 2514 | |
| 2515 | |
| 2516 sub print_splitting_report{ | |
| 2517 | |
| 2518 ### Calculating methylation percentages if applicable | |
| 2519 warn "\nProcessed $counting{sequences_count} lines in total\n"; | |
| 2520 warn "Total number of methylation call strings processed: $counting{methylation_call_strings}\n\n"; | |
| 2521 if ($report) { | |
| 2522 print REPORT "\nProcessed $counting{sequences_count} lines in total\n"; | |
| 2523 print REPORT "Total number of methylation call strings processed: $counting{methylation_call_strings}\n\n"; | |
| 2524 } | |
| 2525 | |
| 2526 my $percent_meCpG; | |
| 2527 if (($counting{total_meCpG_count}+$counting{total_unmethylated_CpG_count}) > 0){ | |
| 2528 $percent_meCpG = sprintf("%.1f",100*$counting{total_meCpG_count}/($counting{total_meCpG_count}+$counting{total_unmethylated_CpG_count})); | |
| 2529 } | |
| 2530 | |
| 2531 my $percent_meCHG; | |
| 2532 if (($counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count}) > 0){ | |
| 2533 $percent_meCHG = sprintf("%.1f",100*$counting{total_meCHG_count}/($counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count})); | |
| 2534 } | |
| 2535 | |
| 2536 my $percent_meCHH; | |
| 2537 if (($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}) > 0){ | |
| 2538 $percent_meCHH = sprintf("%.1f",100*$counting{total_meCHH_count}/($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count})); | |
| 2539 } | |
| 2540 | |
| 2541 my $percent_non_CpG_methylation; | |
| 2542 if ($merge_non_CpG){ | |
| 2543 if ( ($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}+$counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count}) > 0){ | |
| 2544 $percent_non_CpG_methylation = sprintf("%.1f",100* ( $counting{total_meCHH_count}+$counting{total_meCHG_count} ) / ( $counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}+$counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count} ) ); | |
| 2545 } | |
| 2546 } | |
| 2547 | |
| 2548 if ($report){ | |
| 2549 ### detailed information about Cs analysed | |
| 2550 print REPORT "Final Cytosine Methylation Report\n",'='x33,"\n"; | |
| 2551 | |
| 2552 my $total_number_of_C = $counting{total_meCHG_count}+$counting{total_meCHH_count}+$counting{total_meCpG_count}+$counting{total_unmethylated_CHG_count}+$counting{total_unmethylated_CHH_count}+$counting{total_unmethylated_CpG_count}; | |
| 2553 print REPORT "Total number of C's analysed:\t$total_number_of_C\n\n"; | |
| 2554 | |
| 2555 print REPORT "Total methylated C's in CpG context:\t$counting{total_meCpG_count}\n"; | |
| 2556 print REPORT "Total methylated C's in CHG context:\t$counting{total_meCHG_count}\n"; | |
| 2557 print REPORT "Total methylated C's in CHH context:\t$counting{total_meCHH_count}\n\n"; | |
| 2558 | |
| 2559 print REPORT "Total C to T conversions in CpG context:\t$counting{total_unmethylated_CpG_count}\n"; | |
| 2560 print REPORT "Total C to T conversions in CHG context:\t$counting{total_unmethylated_CHG_count}\n"; | |
| 2561 print REPORT "Total C to T conversions in CHH context:\t$counting{total_unmethylated_CHH_count}\n\n"; | |
| 2562 | |
| 2563 ### calculating methylated CpG percentage if applicable | |
| 2564 if ($percent_meCpG){ | |
| 2565 print REPORT "C methylated in CpG context:\t${percent_meCpG}%\n"; | |
| 2566 } | |
| 2567 else{ | |
| 2568 print REPORT "Can't determine percentage of methylated Cs in CpG context if value was 0\n"; | |
| 2569 } | |
| 2570 | |
| 2571 ### 2-Context Output | |
| 2572 if ($merge_non_CpG){ | |
| 2573 if ($percent_non_CpG_methylation){ | |
| 2574 print REPORT "C methylated in non-CpG context:\t${percent_non_CpG_methylation}%\n\n\n"; | |
| 2575 } | |
| 2576 else{ | |
| 2577 print REPORT "Can't determine percentage of methylated Cs in non-CpG context if value was 0\n\n\n"; | |
| 2578 } | |
| 2579 } | |
| 2580 | |
| 2581 ### 3 Context Output | |
| 2582 else{ | |
| 2583 ### calculating methylated CHG percentage if applicable | |
| 2584 if ($percent_meCHG){ | |
| 2585 print REPORT "C methylated in CHG context:\t${percent_meCHG}%\n"; | |
| 2586 } | |
| 2587 else{ | |
| 2588 print REPORT "Can't determine percentage of methylated Cs in CHG context if value was 0\n"; | |
| 2589 } | |
| 2590 | |
| 2591 ### calculating methylated CHH percentage if applicable | |
| 2592 if ($percent_meCHH){ | |
| 2593 print REPORT "C methylated in CHH context:\t${percent_meCHH}%\n\n\n"; | |
| 2594 } | |
| 2595 else{ | |
| 2596 print REPORT "Can't determine percentage of methylated Cs in CHH context if value was 0\n\n\n"; | |
| 2597 } | |
| 2598 } | |
| 2599 } | |
| 2600 | |
| 2601 ### detailed information about Cs analysed for on-screen report | |
| 2602 warn "Final Cytosine Methylation Report\n",'='x33,"\n"; | |
| 2603 | |
| 2604 my $total_number_of_C = $counting{total_meCHG_count}+$counting{total_meCHH_count}+$counting{total_meCpG_count}+$counting{total_unmethylated_CHG_count}+$counting{total_unmethylated_CHH_count}+$counting{total_unmethylated_CpG_count}; | |
| 2605 warn "Total number of C's analysed:\t$total_number_of_C\n\n"; | |
| 2606 | |
| 2607 warn "Total methylated C's in CpG context:\t$counting{total_meCpG_count}\n"; | |
| 2608 warn "Total methylated C's in CHG context:\t$counting{total_meCHG_count}\n"; | |
| 2609 warn"Total methylated C's in CHH context:\t$counting{total_meCHH_count}\n\n"; | |
| 2610 | |
| 2611 warn "Total C to T conversions in CpG context:\t$counting{total_unmethylated_CpG_count}\n"; | |
| 2612 warn "Total C to T conversions in CHG context:\t$counting{total_unmethylated_CHG_count}\n"; | |
| 2613 warn"Total C to T conversions in CHH context:\t$counting{total_unmethylated_CHH_count}\n\n"; | |
| 2614 | |
| 2615 ### printing methylated CpG percentage if applicable | |
| 2616 if ($percent_meCpG){ | |
| 2617 warn "C methylated in CpG context:\t${percent_meCpG}%\n"; | |
| 2618 } | |
| 2619 else{ | |
| 2620 warn "Can't determine percentage of methylated Cs in CpG context if value was 0\n"; | |
| 2621 } | |
| 2622 | |
| 2623 ### 2-Context Output | |
| 2624 if ($merge_non_CpG){ | |
| 2625 if ($percent_non_CpG_methylation){ | |
| 2626 warn "C methylated in non-CpG context:\t${percent_non_CpG_methylation}%\n\n\n"; | |
| 2627 } | |
| 2628 else{ | |
| 2629 warn "Can't determine percentage of methylated Cs in non-CpG context if value was 0\n\n\n"; | |
| 2630 } | |
| 2631 } | |
| 2632 | |
| 2633 ### 3-Context Output | |
| 2634 else{ | |
| 2635 ### printing methylated CHG percentage if applicable | |
| 2636 if ($percent_meCHG){ | |
| 2637 warn "C methylated in CHG context:\t${percent_meCHG}%\n"; | |
| 2638 } | |
| 2639 else{ | |
| 2640 warn "Can't determine percentage of methylated Cs in CHG context if value was 0\n"; | |
| 2641 } | |
| 2642 | |
| 2643 ### printing methylated CHH percentage if applicable | |
| 2644 if ($percent_meCHH){ | |
| 2645 warn "C methylated in CHH context:\t${percent_meCHH}%\n\n\n"; | |
| 2646 } | |
| 2647 else{ | |
| 2648 warn "Can't determine percentage of methylated Cs in CHH context if value was 0\n\n\n"; | |
| 2649 } | |
| 2650 } | |
| 2651 } | |
| 2652 | |
| 2653 ### | |
| 2654 | |
| 2655 sub print_splitting_report_multicore{ | |
| 2656 | |
| 2657 my ($report_filename,$offset,$line_count,$meth_call_strings) = @_; | |
| 2658 | |
| 2659 # warn "\$report_filename is $report_filename\n"; | |
| 2660 my $special_report = $report_filename.".$offset"; | |
| 2661 | |
| 2662 open (SPECIAL_REPORT,'>',$special_report) or die $!; | |
| 2663 # warn "line count\t$line_count\n"; | |
| 2664 # warn "meth call strings\t$meth_call_strings\n"; | |
| 2665 | |
| 2666 print SPECIAL_REPORT "line count\t$line_count\n"; | |
| 2667 print SPECIAL_REPORT "meth call strings\t$meth_call_strings\n"; | |
| 2668 | |
| 2669 ### Calculating methylation percentages if applicable | |
| 2670 my $percent_meCpG; | |
| 2671 if (($counting{total_meCpG_count}+$counting{total_unmethylated_CpG_count}) > 0){ | |
| 2672 $percent_meCpG = sprintf("%.1f",100*$counting{total_meCpG_count}/($counting{total_meCpG_count}+$counting{total_unmethylated_CpG_count})); | |
| 2673 } | |
| 2674 | |
| 2675 my $percent_meCHG; | |
| 2676 if (($counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count}) > 0){ | |
| 2677 $percent_meCHG = sprintf("%.1f",100*$counting{total_meCHG_count}/($counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count})); | |
| 2678 } | |
| 2679 | |
| 2680 my $percent_meCHH; | |
| 2681 if (($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}) > 0){ | |
| 2682 $percent_meCHH = sprintf("%.1f",100*$counting{total_meCHH_count}/($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count})); | |
| 2683 } | |
| 2684 | |
| 2685 my $percent_non_CpG_methylation; | |
| 2686 if ($merge_non_CpG){ | |
| 2687 if ( ($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}+$counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count}) > 0){ | |
| 2688 $percent_non_CpG_methylation = sprintf("%.1f",100* ( $counting{total_meCHH_count}+$counting{total_meCHG_count} ) / ( $counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}+$counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count} ) ); | |
| 2689 } | |
| 2690 } | |
| 2691 | |
| 2692 if ($report){ | |
| 2693 | |
| 2694 ### detailed information about Cs analysed | |
| 2695 print SPECIAL_REPORT "Final Cytosine Methylation Report\n",'='x33,"\n"; | |
| 2696 | |
| 2697 my $total_number_of_C = $counting{total_meCHG_count}+$counting{total_meCHH_count}+$counting{total_meCpG_count}+$counting{total_unmethylated_CHG_count}+$counting{total_unmethylated_CHH_count}+$counting{total_unmethylated_CpG_count}; | |
| 2698 print SPECIAL_REPORT "Total number of C's analysed:\t$total_number_of_C\n\n"; | |
| 2699 | |
| 2700 print SPECIAL_REPORT "Total methylated C's in CpG context:\t$counting{total_meCpG_count}\n"; | |
| 2701 print SPECIAL_REPORT "Total methylated C's in CHG context:\t$counting{total_meCHG_count}\n"; | |
| 2702 print SPECIAL_REPORT "Total methylated C's in CHH context:\t$counting{total_meCHH_count}\n\n"; | |
| 2703 | |
| 2704 print SPECIAL_REPORT "Total C to T conversions in CpG context:\t$counting{total_unmethylated_CpG_count}\n"; | |
| 2705 print SPECIAL_REPORT "Total C to T conversions in CHG context:\t$counting{total_unmethylated_CHG_count}\n"; | |
| 2706 print SPECIAL_REPORT "Total C to T conversions in CHH context:\t$counting{total_unmethylated_CHH_count}\n\n"; | |
| 2707 | |
| 2708 ### calculating methylated CpG percentage if applicable | |
| 2709 if ($percent_meCpG){ | |
| 2710 print SPECIAL_REPORT "C methylated in CpG context:\t${percent_meCpG}%\n"; | |
| 2711 } | |
| 2712 else{ | |
| 2713 print SPECIAL_REPORT "Can't determine percentage of methylated Cs in CpG context if value was 0\n"; | |
| 2714 } | |
| 2715 | |
| 2716 ### 2-Context Output | |
| 2717 if ($merge_non_CpG){ | |
| 2718 if ($percent_non_CpG_methylation){ | |
| 2719 print SPECIAL_REPORT "C methylated in non-CpG context:\t${percent_non_CpG_methylation}%\n\n\n"; | |
| 2720 } | |
| 2721 else{ | |
| 2722 print SPECIAL_REPORT "Can't determine percentage of methylated Cs in non-CpG context if value was 0\n\n\n"; | |
| 2723 } | |
| 2724 } | |
| 2725 | |
| 2726 ### 3 Context Output | |
| 2727 else{ | |
| 2728 ### calculating methylated CHG percentage if applicable | |
| 2729 if ($percent_meCHG){ | |
| 2730 print SPECIAL_REPORT "C methylated in CHG context:\t${percent_meCHG}%\n"; | |
| 2731 } | |
| 2732 else{ | |
| 2733 print SPECIAL_REPORT "Can't determine percentage of methylated Cs in CHG context if value was 0\n"; | |
| 2734 } | |
| 2735 | |
| 2736 ### calculating methylated CHH percentage if applicable | |
| 2737 if ($percent_meCHH){ | |
| 2738 print SPECIAL_REPORT "C methylated in CHH context:\t${percent_meCHH}%\n\n\n"; | |
| 2739 } | |
| 2740 else{ | |
| 2741 print SPECIAL_REPORT "Can't determine percentage of methylated Cs in CHH context if value was 0\n\n\n"; | |
| 2742 } | |
| 2743 } | |
| 2744 } | |
| 2745 close SPECIAL_REPORT or warn "Failed to close filehandle for individual report $special_report\n"; | |
| 2746 } | |
| 2747 | |
| 2748 | |
| 2749 ### | |
| 2750 | |
| 2751 ### INDIVIDUAL M-BIAS REPORTS | |
| 2752 | |
| 2753 sub print_mbias_report_multicore{ | |
| 2754 | |
| 2755 my ($report_filename,$offset,$line_count,$meth_call_strings) = @_; | |
| 2756 | |
| 2757 # warn "\$report_filename is $report_filename\n"; | |
| 2758 my $special_mbias_report = $report_filename.".${offset}.mbias"; | |
| 2759 | |
| 2760 open (SPECIAL_MBIAS,'>',$special_mbias_report) or die $!; | |
| 2761 | |
| 2762 # determining maximum read length | |
| 2763 my $max_length_1 = 0; | |
| 2764 my $max_length_2 = 0; | |
| 2765 | |
| 2766 foreach my $context (keys %mbias_1){ | |
| 2767 foreach my $pos (sort {$a<=>$b} keys %{$mbias_1{$context}}){ | |
| 2768 $max_length_1 = $pos unless ($max_length_1 >= $pos); | |
| 2769 } | |
| 2770 } | |
| 2771 if ($paired){ | |
| 2772 foreach my $context (keys %mbias_2){ | |
| 2773 foreach my $pos (sort {$a<=>$b} keys %{$mbias_2{$context}}){ | |
| 2774 $max_length_2 = $pos unless ($max_length_2 >= $pos); | |
| 2775 } | |
| 2776 } | |
| 2777 } | |
| 2778 | |
| 2779 if ($single){ | |
| 2780 # warn "Determining maximum read length for M-Bias plot\n"; | |
| 2781 # warn "Maximum read length of Read 1: $max_length_1\n\n"; | |
| 2782 } | |
| 2783 else{ | |
| 2784 # warn "Determining maximum read lengths for M-Bias plots\n"; | |
| 2785 # warn "Maximum read length of Read 1: $max_length_1\n"; | |
| 2786 # warn "Maximum read length of Read 2: $max_length_2\n\n"; | |
| 2787 } | |
| 2788 | |
| 2789 foreach my $context (qw(CpG CHG CHH)){ | |
| 2790 | |
| 2791 if ($paired){ | |
| 2792 print SPECIAL_MBIAS "$context context (R1)\n================\n"; | |
| 2793 } | |
| 2794 else{ | |
| 2795 print SPECIAL_MBIAS "$context context\n===========\n"; | |
| 2796 } | |
| 2797 print SPECIAL_MBIAS "position\tcount methylated\tcount unmethylated\t% methylation\tcoverage\n"; | |
| 2798 | |
| 2799 foreach my $pos (1..$max_length_1){ | |
| 2800 | |
| 2801 unless (defined $mbias_1{$context}->{$pos}->{meth}){ | |
| 2802 $mbias_1{$context}->{$pos}->{meth} = 0; | |
| 2803 } | |
| 2804 unless (defined $mbias_1{$context}->{$pos}->{un}){ | |
| 2805 $mbias_1{$context}->{$pos}->{un} = 0; | |
| 2806 } | |
| 2807 | |
| 2808 my $percent = ''; | |
| 2809 if (($mbias_1{$context}->{$pos}->{meth} + $mbias_1{$context}->{$pos}->{un}) > 0){ | |
| 2810 $percent = sprintf("%.2f",$mbias_1{$context}->{$pos}->{meth} * 100/ ( $mbias_1{$context}->{$pos}->{meth} + $mbias_1{$context}->{$pos}->{un}) ); | |
| 2811 } | |
| 2812 my $coverage = $mbias_1{$context}->{$pos}->{un} + $mbias_1{$context}->{$pos}->{meth}; | |
| 2813 | |
| 2814 print SPECIAL_MBIAS "$pos\t$mbias_1{$context}->{$pos}->{meth}\t$mbias_1{$context}->{$pos}->{un}\t$percent\t$coverage\n"; | |
| 2815 } | |
| 2816 print SPECIAL_MBIAS "\n"; | |
| 2817 } | |
| 2818 | |
| 2819 if ($paired){ | |
| 2820 | |
| 2821 foreach my $context (qw(CpG CHG CHH)){ | |
| 2822 | |
| 2823 print SPECIAL_MBIAS "$context context (R2)\n================\n"; | |
| 2824 print SPECIAL_MBIAS "position\tcount methylated\tcount unmethylated\t% methylation\tcoverage\n"; | |
| 2825 | |
| 2826 foreach my $pos (1..$max_length_2){ | |
| 2827 | |
| 2828 unless (defined $mbias_2{$context}->{$pos}->{meth}){ | |
| 2829 $mbias_2{$context}->{$pos}->{meth} = 0; | |
| 2830 } | |
| 2831 unless (defined $mbias_2{$context}->{$pos}->{un}){ | |
| 2832 $mbias_2{$context}->{$pos}->{un} = 0; | |
| 2833 } | |
| 2834 | |
| 2835 my $percent = ''; | |
| 2836 if (($mbias_2{$context}->{$pos}->{meth} + $mbias_2{$context}->{$pos}->{un}) > 0){ | |
| 2837 $percent = sprintf("%.2f",$mbias_2{$context}->{$pos}->{meth} * 100/ ($mbias_2{$context}->{$pos}->{meth} + $mbias_2{$context}->{$pos}->{un}) ); | |
| 2838 } | |
| 2839 my $coverage = $mbias_2{$context}->{$pos}->{un} + $mbias_2{$context}->{$pos}->{meth}; | |
| 2840 | |
| 2841 print SPECIAL_MBIAS "$pos\t$mbias_2{$context}->{$pos}->{meth}\t$mbias_2{$context}->{$pos}->{un}\t$percent\t$coverage\n"; | |
| 2842 } | |
| 2843 } | |
| 2844 } | |
| 2845 | |
| 2846 close SPECIAL_MBIAS or warn "Failed to close filehandle for individual M-bias report $special_mbias_report\n"; | |
| 2847 } | |
| 2848 | |
| 2849 | |
| 2850 ### | |
| 2851 | |
| 2852 | |
| 2853 sub print_individual_C_methylation_states_paired_end_files{ | |
| 2854 | |
| 2855 my ($meth_call,$chrom,$start,$id,$strand,$filehandle_index,$no_overlap,$end_read_1,$cigar,$read_identity) = @_; | |
| 2856 | |
| 2857 unless (defined $meth_call) { | |
| 2858 return; # skip this read | |
| 2859 } | |
| 2860 | |
| 2861 ### we will use the read identity for the M-bias plot to discriminate read 1 and read 2 | |
| 2862 die "Read identity was neither 1 nor 2: $read_identity\n\n" unless ($read_identity == 1 or $read_identity == 2); | |
| 2863 | |
| 2864 my @methylation_calls = split(//,$meth_call); | |
| 2865 | |
| 2866 ################################################################# | |
| 2867 ### . for bases not involving cytosines ### | |
| 2868 ### X for methylated C in CHG context (was protected) ### | |
| 2869 ### x for not methylated C in CHG context (was converted) ### | |
| 2870 ### H for methylated C in CHH context (was protected) ### | |
| 2871 ### h for not methylated C in CHH context (was converted) ### | |
| 2872 ### Z for methylated C in CpG context (was protected) ### | |
| 2873 ### z for not methylated C in CpG context (was converted) ### | |
| 2874 ### U for methylated C in Unknown context (was protected) ### | |
| 2875 ### u for not methylated C in Unknown context (was converted) ### | |
| 2876 ################################################################# | |
| 2877 | |
| 2878 my $methyl_CHG_count = 0; | |
| 2879 my $methyl_CHH_count = 0; | |
| 2880 my $methyl_CpG_count = 0; | |
| 2881 my $unmethylated_CHG_count = 0; | |
| 2882 my $unmethylated_CHH_count = 0; | |
| 2883 my $unmethylated_CpG_count = 0; | |
| 2884 | |
| 2885 my $pos_offset = 0; # this is only relevant for SAM reads with insertions or deletions | |
| 2886 my $cigar_offset = 0; # again, this is only relevant for SAM reads containing indels | |
| 2887 my @comp_cigar; | |
| 2888 | |
| 2889 ### Checking whether the CIGAR string is a linear genomic match or whether if requires indel processing | |
| 2890 if ($cigar =~ /^\d+M$/){ | |
| 2891 # this check speeds up the extraction process by up to 60%!!! | |
| 2892 } | |
| 2893 else{ # parsing CIGAR string | |
| 2894 my @len; | |
| 2895 my @ops; | |
| 2896 @len = split (/\D+/,$cigar); # storing the length per operation | |
| 2897 @ops = split (/\d+/,$cigar); # storing the operation | |
| 2898 shift @ops; # remove the empty first element | |
| 2899 | |
| 2900 die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len == scalar @ops); | |
| 2901 | |
| 2902 foreach my $index (0..$#len){ | |
| 2903 foreach (1..$len[$index]){ | |
| 2904 # print "$ops[$index]"; | |
| 2905 push @comp_cigar, $ops[$index]; | |
| 2906 } | |
| 2907 } | |
| 2908 # warn "\nDetected CIGAR string: $cigar\n"; | |
| 2909 # warn "Length of methylation call: ",length $meth_call,"\n"; | |
| 2910 # warn "number of operations: ",scalar @ops,"\n"; | |
| 2911 # warn "number of length digits: ",scalar @len,"\n\n"; | |
| 2912 # print @comp_cigar,"\n"; | |
| 2913 # print "$meth_call\n\n"; | |
| 2914 # sleep (1); | |
| 2915 } | |
| 2916 | |
| 2917 if ($strand eq '-') { | |
| 2918 | |
| 2919 ### the CIGAR string needs to be reversed, the methylation call has already been reversed above | |
| 2920 if (@comp_cigar){ | |
| 2921 @comp_cigar = reverse@comp_cigar; # the CIGAR string needs to be reversed for all reads aligning to the reverse strand, too | |
| 2922 } | |
| 2923 # print "reverse CIGAR string: @comp_cigar\n"; | |
| 2924 | |
| 2925 ### the start position of paired-end files has already been corrected, see above | |
| 2926 } | |
| 2927 | |
| 2928 ### THIS IS AN OPTIONAL 2-CONTEXT (CpG and non-CpG) SECTION IF --merge_non_CpG was specified | |
| 2929 | |
| 2930 if ($merge_non_CpG) { | |
| 2931 if ($no_overlap) { # this has to be read 2... | |
| 2932 | |
| 2933 ### single-file CpG and non-CpG context output | |
| 2934 if ($full) { | |
| 2935 if ($strand eq '+') { | |
| 2936 for my $index (0..$#methylation_calls) { | |
| 2937 | |
| 2938 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 2939 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 2940 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; | |
| 2941 $cigar_offset += $cigar_mod; | |
| 2942 $pos_offset += $pos_mod; | |
| 2943 } | |
| 2944 | |
| 2945 ### Returning as soon as the methylation calls start overlapping | |
| 2946 if ($start+$index+$pos_offset >= $end_read_1) { | |
| 2947 return; | |
| 2948 } | |
| 2949 | |
| 2950 if ($methylation_calls[$index] eq 'X') { | |
| 2951 $counting{total_meCHG_count}++; | |
| 2952 print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 2953 if ($read_identity == 1){ | |
| 2954 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 2955 } | |
| 2956 else{ | |
| 2957 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 2958 } | |
| 2959 } | |
| 2960 elsif ($methylation_calls[$index] eq 'x') { | |
| 2961 $counting{total_unmethylated_CHG_count}++; | |
| 2962 print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 2963 if ($read_identity == 1){ | |
| 2964 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 2965 } | |
| 2966 else{ | |
| 2967 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 2968 } | |
| 2969 } | |
| 2970 elsif ($methylation_calls[$index] eq 'Z') { | |
| 2971 $counting{total_meCpG_count}++; | |
| 2972 print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 2973 if ($read_identity == 1){ | |
| 2974 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 2975 } | |
| 2976 else{ | |
| 2977 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 2978 } | |
| 2979 } | |
| 2980 elsif ($methylation_calls[$index] eq 'z') { | |
| 2981 $counting{total_unmethylated_CpG_count}++; | |
| 2982 print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 2983 if ($read_identity == 1){ | |
| 2984 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 2985 } | |
| 2986 else{ | |
| 2987 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 2988 } | |
| 2989 } | |
| 2990 elsif ($methylation_calls[$index] eq 'H') { | |
| 2991 $counting{total_meCHH_count}++; | |
| 2992 print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 2993 if ($read_identity == 1){ | |
| 2994 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 2995 } | |
| 2996 else{ | |
| 2997 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 2998 } | |
| 2999 } | |
| 3000 elsif ($methylation_calls[$index] eq 'h') { | |
| 3001 $counting{total_unmethylated_CHH_count}++; | |
| 3002 print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3003 if ($read_identity == 1){ | |
| 3004 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 3005 } | |
| 3006 else{ | |
| 3007 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 3008 } | |
| 3009 } | |
| 3010 elsif ($methylation_calls[$index] eq '.'){} | |
| 3011 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 3012 else{ | |
| 3013 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n" unless($mbias_only); | |
| 3014 } | |
| 3015 } | |
| 3016 } | |
| 3017 elsif ($strand eq '-') { | |
| 3018 for my $index (0..$#methylation_calls) { | |
| 3019 | |
| 3020 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 3021 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; | |
| 3022 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 3023 $cigar_offset += $cigar_mod; | |
| 3024 $pos_offset += $pos_mod; | |
| 3025 } | |
| 3026 | |
| 3027 ### Returning as soon as the methylation calls start overlapping | |
| 3028 if ($start-$index+$pos_offset <= $end_read_1) { | |
| 3029 return; | |
| 3030 } | |
| 3031 | |
| 3032 if ($methylation_calls[$index] eq 'X') { | |
| 3033 $counting{total_meCHG_count}++; | |
| 3034 print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3035 if ($read_identity == 1){ | |
| 3036 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 3037 } | |
| 3038 else{ | |
| 3039 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 3040 } | |
| 3041 } | |
| 3042 elsif ($methylation_calls[$index] eq 'x') { | |
| 3043 $counting{total_unmethylated_CHG_count}++; | |
| 3044 print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3045 if ($read_identity == 1){ | |
| 3046 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 3047 } | |
| 3048 else{ | |
| 3049 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 3050 } | |
| 3051 } | |
| 3052 elsif ($methylation_calls[$index] eq 'Z') { | |
| 3053 $counting{total_meCpG_count}++; | |
| 3054 print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3055 if ($read_identity == 1){ | |
| 3056 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 3057 } | |
| 3058 else{ | |
| 3059 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 3060 } | |
| 3061 } | |
| 3062 elsif ($methylation_calls[$index] eq 'z') { | |
| 3063 $counting{total_unmethylated_CpG_count}++; | |
| 3064 print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3065 if ($read_identity == 1){ | |
| 3066 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 3067 } | |
| 3068 else{ | |
| 3069 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 3070 } | |
| 3071 } | |
| 3072 elsif ($methylation_calls[$index] eq 'H') { | |
| 3073 $counting{total_meCHH_count}++; | |
| 3074 print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3075 if ($read_identity == 1){ | |
| 3076 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 3077 } | |
| 3078 else{ | |
| 3079 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 3080 } | |
| 3081 } | |
| 3082 elsif ($methylation_calls[$index] eq 'h') { | |
| 3083 $counting{total_unmethylated_CHH_count}++; | |
| 3084 print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3085 if ($read_identity == 1){ | |
| 3086 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 3087 } | |
| 3088 else{ | |
| 3089 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 3090 } | |
| 3091 } | |
| 3092 elsif ($methylation_calls[$index] eq '.') {} | |
| 3093 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 3094 else{ | |
| 3095 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n" unless($mbias_only); | |
| 3096 } | |
| 3097 } | |
| 3098 } else { | |
| 3099 die "The read orientation was neither + nor -: '$strand'\n"; | |
| 3100 } | |
| 3101 } | |
| 3102 | |
| 3103 ### strand-specific methylation output | |
| 3104 else { | |
| 3105 if ($strand eq '+') { | |
| 3106 for my $index (0..$#methylation_calls) { | |
| 3107 | |
| 3108 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 3109 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 3110 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; | |
| 3111 $cigar_offset += $cigar_mod; | |
| 3112 $pos_offset += $pos_mod; | |
| 3113 } | |
| 3114 | |
| 3115 ### Returning as soon as the methylation calls start overlapping | |
| 3116 if ($start+$index+$pos_offset >= $end_read_1) { | |
| 3117 return; | |
| 3118 } | |
| 3119 | |
| 3120 if ($methylation_calls[$index] eq 'X') { | |
| 3121 $counting{total_meCHG_count}++; | |
| 3122 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3123 if ($read_identity == 1){ | |
| 3124 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 3125 } | |
| 3126 else{ | |
| 3127 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 3128 } | |
| 3129 } | |
| 3130 elsif ($methylation_calls[$index] eq 'x') { | |
| 3131 $counting{total_unmethylated_CHG_count}++; | |
| 3132 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3133 if ($read_identity == 1){ | |
| 3134 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 3135 } | |
| 3136 else{ | |
| 3137 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 3138 } | |
| 3139 } | |
| 3140 elsif ($methylation_calls[$index] eq 'Z') { | |
| 3141 $counting{total_meCpG_count}++; | |
| 3142 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3143 if ($read_identity == 1){ | |
| 3144 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 3145 } | |
| 3146 else{ | |
| 3147 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 3148 } | |
| 3149 } | |
| 3150 elsif ($methylation_calls[$index] eq 'z') { | |
| 3151 $counting{total_unmethylated_CpG_count}++; | |
| 3152 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3153 if ($read_identity == 1){ | |
| 3154 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 3155 } | |
| 3156 else{ | |
| 3157 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 3158 } | |
| 3159 } | |
| 3160 elsif ($methylation_calls[$index] eq 'H') { | |
| 3161 $counting{total_meCHH_count}++; | |
| 3162 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3163 if ($read_identity == 1){ | |
| 3164 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 3165 } | |
| 3166 else{ | |
| 3167 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 3168 } | |
| 3169 } | |
| 3170 elsif ($methylation_calls[$index] eq 'h') { | |
| 3171 $counting{total_unmethylated_CHH_count}++; | |
| 3172 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3173 if ($read_identity == 1){ | |
| 3174 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 3175 } | |
| 3176 else{ | |
| 3177 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 3178 } | |
| 3179 } | |
| 3180 elsif ($methylation_calls[$index] eq '.') {} | |
| 3181 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 3182 else{ | |
| 3183 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 3184 } | |
| 3185 } | |
| 3186 } elsif ($strand eq '-') { | |
| 3187 for my $index (0..$#methylation_calls) { | |
| 3188 | |
| 3189 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 3190 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; | |
| 3191 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 3192 $cigar_offset += $cigar_mod; | |
| 3193 $pos_offset += $pos_mod; | |
| 3194 } | |
| 3195 | |
| 3196 ### Returning as soon as the methylation calls start overlapping | |
| 3197 if ($start-$index+$pos_offset <= $end_read_1) { | |
| 3198 return; | |
| 3199 } | |
| 3200 | |
| 3201 if ($methylation_calls[$index] eq 'X') { | |
| 3202 $counting{total_meCHG_count}++; | |
| 3203 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3204 if ($read_identity == 1){ | |
| 3205 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 3206 } | |
| 3207 else{ | |
| 3208 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 3209 } | |
| 3210 } | |
| 3211 elsif ($methylation_calls[$index] eq 'x') { | |
| 3212 $counting{total_unmethylated_CHG_count}++; | |
| 3213 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3214 if ($read_identity == 1){ | |
| 3215 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 3216 } | |
| 3217 else{ | |
| 3218 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 3219 } | |
| 3220 } | |
| 3221 elsif ($methylation_calls[$index] eq 'Z') { | |
| 3222 $counting{total_meCpG_count}++; | |
| 3223 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3224 if ($read_identity == 1){ | |
| 3225 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 3226 } | |
| 3227 else{ | |
| 3228 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 3229 } | |
| 3230 } | |
| 3231 elsif ($methylation_calls[$index] eq 'z') { | |
| 3232 $counting{total_unmethylated_CpG_count}++; | |
| 3233 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3234 if ($read_identity == 1){ | |
| 3235 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 3236 } | |
| 3237 else{ | |
| 3238 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 3239 } | |
| 3240 } | |
| 3241 elsif ($methylation_calls[$index] eq 'H') { | |
| 3242 $counting{total_meCHH_count}++; | |
| 3243 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3244 if ($read_identity == 1){ | |
| 3245 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 3246 } | |
| 3247 else{ | |
| 3248 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 3249 } | |
| 3250 } | |
| 3251 elsif ($methylation_calls[$index] eq 'h') { | |
| 3252 $counting{total_unmethylated_CHH_count}++; | |
| 3253 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3254 if ($read_identity == 1){ | |
| 3255 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 3256 } | |
| 3257 else{ | |
| 3258 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 3259 } | |
| 3260 } | |
| 3261 elsif ($methylation_calls[$index] eq '.') {} | |
| 3262 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 3263 else{ | |
| 3264 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 3265 } | |
| 3266 } | |
| 3267 } else { | |
| 3268 die "The strand orientation was neither + nor -: '$strand'/n"; | |
| 3269 } | |
| 3270 } | |
| 3271 } | |
| 3272 | |
| 3273 ### this is the default paired-end procedure allowing overlaps and using every single C position | |
| 3274 ### Still within the 2-CONTEXT ONLY optional section | |
| 3275 else { | |
| 3276 ### single-file CpG and non-CpG context output | |
| 3277 if ($full) { | |
| 3278 if ($strand eq '+') { | |
| 3279 for my $index (0..$#methylation_calls) { | |
| 3280 | |
| 3281 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 3282 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 3283 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; | |
| 3284 $cigar_offset += $cigar_mod; | |
| 3285 $pos_offset += $pos_mod; | |
| 3286 } | |
| 3287 | |
| 3288 if ($methylation_calls[$index] eq 'X') { | |
| 3289 $counting{total_meCHG_count}++; | |
| 3290 print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3291 if ($read_identity == 1){ | |
| 3292 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 3293 } | |
| 3294 else{ | |
| 3295 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 3296 } | |
| 3297 } | |
| 3298 elsif ($methylation_calls[$index] eq 'x') { | |
| 3299 $counting{total_unmethylated_CHG_count}++; | |
| 3300 print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3301 if ($read_identity == 1){ | |
| 3302 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 3303 } | |
| 3304 else{ | |
| 3305 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 3306 } | |
| 3307 } | |
| 3308 elsif ($methylation_calls[$index] eq 'Z') { | |
| 3309 $counting{total_meCpG_count}++; | |
| 3310 print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3311 if ($read_identity == 1){ | |
| 3312 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 3313 } | |
| 3314 else{ | |
| 3315 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 3316 } | |
| 3317 } | |
| 3318 elsif ($methylation_calls[$index] eq 'z') { | |
| 3319 $counting{total_unmethylated_CpG_count}++; | |
| 3320 print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3321 if ($read_identity == 1){ | |
| 3322 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 3323 } | |
| 3324 else{ | |
| 3325 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 3326 } | |
| 3327 } | |
| 3328 elsif ($methylation_calls[$index] eq 'H') { | |
| 3329 $counting{total_meCHH_count}++; | |
| 3330 print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3331 if ($read_identity == 1){ | |
| 3332 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 3333 } | |
| 3334 else{ | |
| 3335 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 3336 } | |
| 3337 } | |
| 3338 elsif ($methylation_calls[$index] eq 'h') { | |
| 3339 $counting{total_unmethylated_CHH_count}++; | |
| 3340 print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3341 if ($read_identity == 1){ | |
| 3342 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 3343 } | |
| 3344 else{ | |
| 3345 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 3346 } | |
| 3347 } | |
| 3348 elsif ($methylation_calls[$index] eq '.') {} | |
| 3349 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 3350 else{ | |
| 3351 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n" unless($mbias_only); | |
| 3352 } | |
| 3353 } | |
| 3354 } elsif ($strand eq '-') { | |
| 3355 for my $index (0..$#methylation_calls) { | |
| 3356 | |
| 3357 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 3358 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; | |
| 3359 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 3360 $cigar_offset += $cigar_mod; | |
| 3361 $pos_offset += $pos_mod; | |
| 3362 } | |
| 3363 | |
| 3364 if ($methylation_calls[$index] eq 'X') { | |
| 3365 $counting{total_meCHG_count}++; | |
| 3366 print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3367 if ($read_identity == 1){ | |
| 3368 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 3369 } | |
| 3370 else{ | |
| 3371 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 3372 } | |
| 3373 } | |
| 3374 elsif ($methylation_calls[$index] eq 'x') { | |
| 3375 $counting{total_unmethylated_CHG_count}++; | |
| 3376 print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3377 if ($read_identity == 1){ | |
| 3378 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 3379 } | |
| 3380 else{ | |
| 3381 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 3382 } | |
| 3383 } | |
| 3384 elsif ($methylation_calls[$index] eq 'Z') { | |
| 3385 $counting{total_meCpG_count}++; | |
| 3386 print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3387 if ($read_identity == 1){ | |
| 3388 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 3389 } | |
| 3390 else{ | |
| 3391 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 3392 } | |
| 3393 } | |
| 3394 elsif ($methylation_calls[$index] eq 'z') { | |
| 3395 $counting{total_unmethylated_CpG_count}++; | |
| 3396 print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3397 if ($read_identity == 1){ | |
| 3398 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 3399 } | |
| 3400 else{ | |
| 3401 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 3402 } | |
| 3403 } | |
| 3404 elsif ($methylation_calls[$index] eq 'H') { | |
| 3405 $counting{total_meCHH_count}++; | |
| 3406 print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3407 if ($read_identity == 1){ | |
| 3408 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 3409 } | |
| 3410 else{ | |
| 3411 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 3412 } | |
| 3413 } | |
| 3414 elsif ($methylation_calls[$index] eq 'h') { | |
| 3415 $counting{total_unmethylated_CHH_count}++; | |
| 3416 print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3417 if ($read_identity == 1){ | |
| 3418 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 3419 } | |
| 3420 else{ | |
| 3421 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 3422 } | |
| 3423 } | |
| 3424 elsif ($methylation_calls[$index] eq '.') {} | |
| 3425 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 3426 else{ | |
| 3427 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n" unless($mbias_only); | |
| 3428 } | |
| 3429 } | |
| 3430 } else { | |
| 3431 die "The strand orientation as neither + nor -: '$strand'\n"; | |
| 3432 } | |
| 3433 } | |
| 3434 | |
| 3435 ### strand-specific methylation output | |
| 3436 ### still within the 2-CONTEXT optional section | |
| 3437 else { | |
| 3438 if ($strand eq '+') { | |
| 3439 for my $index (0..$#methylation_calls) { | |
| 3440 | |
| 3441 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 3442 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 3443 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; | |
| 3444 $cigar_offset += $cigar_mod; | |
| 3445 $pos_offset += $pos_mod; | |
| 3446 } | |
| 3447 | |
| 3448 if ($methylation_calls[$index] eq 'X') { | |
| 3449 $counting{total_meCHG_count}++; | |
| 3450 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3451 if ($read_identity == 1){ | |
| 3452 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 3453 } | |
| 3454 else{ | |
| 3455 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 3456 } | |
| 3457 } | |
| 3458 elsif ($methylation_calls[$index] eq 'x') { | |
| 3459 $counting{total_unmethylated_CHG_count}++; | |
| 3460 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3461 if ($read_identity == 1){ | |
| 3462 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 3463 } | |
| 3464 else{ | |
| 3465 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 3466 } | |
| 3467 } | |
| 3468 elsif ($methylation_calls[$index] eq 'Z') { | |
| 3469 $counting{total_meCpG_count}++; | |
| 3470 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3471 if ($read_identity == 1){ | |
| 3472 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 3473 } | |
| 3474 else{ | |
| 3475 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 3476 } | |
| 3477 } | |
| 3478 elsif ($methylation_calls[$index] eq 'z') { | |
| 3479 $counting{total_unmethylated_CpG_count}++; | |
| 3480 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3481 if ($read_identity == 1){ | |
| 3482 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 3483 } | |
| 3484 else{ | |
| 3485 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 3486 } | |
| 3487 } | |
| 3488 elsif ($methylation_calls[$index] eq 'H') { | |
| 3489 $counting{total_meCHH_count}++; | |
| 3490 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3491 if ($read_identity == 1){ | |
| 3492 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 3493 } | |
| 3494 else{ | |
| 3495 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 3496 } | |
| 3497 } | |
| 3498 elsif ($methylation_calls[$index] eq 'h') { | |
| 3499 $counting{total_unmethylated_CHH_count}++; | |
| 3500 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3501 if ($read_identity == 1){ | |
| 3502 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 3503 } | |
| 3504 else{ | |
| 3505 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 3506 } | |
| 3507 } | |
| 3508 elsif ($methylation_calls[$index] eq '.') {} | |
| 3509 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 3510 else{ | |
| 3511 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 3512 } | |
| 3513 } | |
| 3514 } elsif ($strand eq '-') { | |
| 3515 for my $index (0..$#methylation_calls) { | |
| 3516 | |
| 3517 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 3518 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; | |
| 3519 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 3520 $cigar_offset += $cigar_mod; | |
| 3521 $pos_offset += $pos_mod; | |
| 3522 } | |
| 3523 | |
| 3524 if ($methylation_calls[$index] eq 'X') { | |
| 3525 $counting{total_meCHG_count}++; | |
| 3526 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3527 if ($read_identity == 1){ | |
| 3528 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 3529 } | |
| 3530 else{ | |
| 3531 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 3532 } | |
| 3533 } | |
| 3534 elsif ($methylation_calls[$index] eq 'x') { | |
| 3535 $counting{total_unmethylated_CHG_count}++; | |
| 3536 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3537 if ($read_identity == 1){ | |
| 3538 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 3539 } | |
| 3540 else{ | |
| 3541 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 3542 } | |
| 3543 } | |
| 3544 elsif ($methylation_calls[$index] eq 'Z') { | |
| 3545 $counting{total_meCpG_count}++; | |
| 3546 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3547 if ($read_identity == 1){ | |
| 3548 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 3549 } | |
| 3550 else{ | |
| 3551 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 3552 } | |
| 3553 } | |
| 3554 elsif ($methylation_calls[$index] eq 'z') { | |
| 3555 $counting{total_unmethylated_CpG_count}++; | |
| 3556 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3557 if ($read_identity == 1){ | |
| 3558 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 3559 } | |
| 3560 else{ | |
| 3561 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 3562 } | |
| 3563 } | |
| 3564 elsif ($methylation_calls[$index] eq 'H') { | |
| 3565 $counting{total_meCHH_count}++; | |
| 3566 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3567 if ($read_identity == 1){ | |
| 3568 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 3569 } | |
| 3570 else{ | |
| 3571 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 3572 } | |
| 3573 } | |
| 3574 elsif ($methylation_calls[$index] eq 'h') { | |
| 3575 $counting{total_unmethylated_CHH_count}++; | |
| 3576 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3577 if ($read_identity == 1){ | |
| 3578 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 3579 } | |
| 3580 else{ | |
| 3581 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 3582 } | |
| 3583 } | |
| 3584 elsif ($methylation_calls[$index] eq '.') {} | |
| 3585 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 3586 else{ | |
| 3587 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 3588 } | |
| 3589 } | |
| 3590 } else { | |
| 3591 die "The strand orientation as neither + nor -: '$strand'\n"; | |
| 3592 } | |
| 3593 } | |
| 3594 } | |
| 3595 } | |
| 3596 | |
| 3597 ############################################ | |
| 3598 ### THIS IS THE DEFAULT 3-CONTEXT OUTPUT ### | |
| 3599 ############################################ | |
| 3600 | |
| 3601 elsif ($no_overlap) { | |
| 3602 ### single-file CpG, CHG and CHH context output | |
| 3603 if ($full) { | |
| 3604 if ($strand eq '+') { | |
| 3605 for my $index (0..$#methylation_calls) { | |
| 3606 | |
| 3607 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 3608 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 3609 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; | |
| 3610 $cigar_offset += $cigar_mod; | |
| 3611 $pos_offset += $pos_mod; | |
| 3612 } | |
| 3613 | |
| 3614 ### Returning as soon as the methylation calls start overlapping | |
| 3615 if ($start+$index+$pos_offset >= $end_read_1) { | |
| 3616 return; | |
| 3617 } | |
| 3618 | |
| 3619 if ($methylation_calls[$index] eq 'X') { | |
| 3620 $counting{total_meCHG_count}++; | |
| 3621 print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3622 if ($read_identity == 1){ | |
| 3623 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 3624 } | |
| 3625 else{ | |
| 3626 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 3627 } | |
| 3628 } | |
| 3629 elsif ($methylation_calls[$index] eq 'x') { | |
| 3630 $counting{total_unmethylated_CHG_count}++; | |
| 3631 print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3632 if ($read_identity == 1){ | |
| 3633 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 3634 } | |
| 3635 else{ | |
| 3636 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 3637 } | |
| 3638 } | |
| 3639 elsif ($methylation_calls[$index] eq 'Z') { | |
| 3640 $counting{total_meCpG_count}++; | |
| 3641 print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3642 if ($read_identity == 1){ | |
| 3643 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 3644 } | |
| 3645 else{ | |
| 3646 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 3647 } | |
| 3648 } | |
| 3649 elsif ($methylation_calls[$index] eq 'z') { | |
| 3650 $counting{total_unmethylated_CpG_count}++; | |
| 3651 print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3652 if ($read_identity == 1){ | |
| 3653 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 3654 } | |
| 3655 else{ | |
| 3656 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 3657 } | |
| 3658 } | |
| 3659 elsif ($methylation_calls[$index] eq 'H') { | |
| 3660 $counting{total_meCHH_count}++; | |
| 3661 print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3662 if ($read_identity == 1){ | |
| 3663 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 3664 } | |
| 3665 else{ | |
| 3666 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 3667 } | |
| 3668 } | |
| 3669 elsif ($methylation_calls[$index] eq 'h') { | |
| 3670 $counting{total_unmethylated_CHH_count}++; | |
| 3671 print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3672 if ($read_identity == 1){ | |
| 3673 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 3674 } | |
| 3675 else{ | |
| 3676 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 3677 } | |
| 3678 } | |
| 3679 elsif ($methylation_calls[$index] eq '.') {} | |
| 3680 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 3681 else{ | |
| 3682 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 3683 } | |
| 3684 } | |
| 3685 } elsif ($strand eq '-') { | |
| 3686 for my $index (0..$#methylation_calls) { | |
| 3687 | |
| 3688 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 3689 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; | |
| 3690 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 3691 $cigar_offset += $cigar_mod; | |
| 3692 $pos_offset += $pos_mod; | |
| 3693 } | |
| 3694 | |
| 3695 ### Returning as soon as the methylation calls start overlapping | |
| 3696 if ($start-$index+$pos_offset <= $end_read_1) { | |
| 3697 return; | |
| 3698 } | |
| 3699 | |
| 3700 if ($methylation_calls[$index] eq 'X') { | |
| 3701 $counting{total_meCHG_count}++; | |
| 3702 print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3703 if ($read_identity == 1){ | |
| 3704 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 3705 } | |
| 3706 else{ | |
| 3707 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 3708 } | |
| 3709 } | |
| 3710 elsif ($methylation_calls[$index] eq 'x') { | |
| 3711 $counting{total_unmethylated_CHG_count}++; | |
| 3712 print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3713 if ($read_identity == 1){ | |
| 3714 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 3715 } | |
| 3716 else{ | |
| 3717 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 3718 } | |
| 3719 } | |
| 3720 elsif ($methylation_calls[$index] eq 'Z') { | |
| 3721 $counting{total_meCpG_count}++; | |
| 3722 print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3723 if ($read_identity == 1){ | |
| 3724 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 3725 } | |
| 3726 else{ | |
| 3727 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 3728 } | |
| 3729 } | |
| 3730 elsif ($methylation_calls[$index] eq 'z') { | |
| 3731 $counting{total_unmethylated_CpG_count}++; | |
| 3732 print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3733 if ($read_identity == 1){ | |
| 3734 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 3735 } | |
| 3736 else{ | |
| 3737 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 3738 } | |
| 3739 } | |
| 3740 elsif ($methylation_calls[$index] eq 'H') { | |
| 3741 $counting{total_meCHH_count}++; | |
| 3742 print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3743 if ($read_identity == 1){ | |
| 3744 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 3745 } | |
| 3746 else{ | |
| 3747 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 3748 } | |
| 3749 } | |
| 3750 elsif ($methylation_calls[$index] eq 'h') { | |
| 3751 $counting{total_unmethylated_CHH_count}++; | |
| 3752 print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3753 if ($read_identity == 1){ | |
| 3754 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 3755 } | |
| 3756 else{ | |
| 3757 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 3758 } | |
| 3759 } | |
| 3760 elsif ($methylation_calls[$index] eq '.') {} | |
| 3761 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 3762 else{ | |
| 3763 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 3764 } | |
| 3765 } | |
| 3766 } else { | |
| 3767 die "The strand orientation as neither + nor -: '$strand'\n"; | |
| 3768 } | |
| 3769 } | |
| 3770 | |
| 3771 ### strand-specific methylation output | |
| 3772 else { | |
| 3773 if ($strand eq '+') { | |
| 3774 for my $index (0..$#methylation_calls) { | |
| 3775 | |
| 3776 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 3777 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 3778 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; | |
| 3779 $cigar_offset += $cigar_mod; | |
| 3780 $pos_offset += $pos_mod; | |
| 3781 } | |
| 3782 | |
| 3783 ### Returning as soon as the methylation calls start overlapping | |
| 3784 if ($start+$index+$pos_offset >= $end_read_1) { | |
| 3785 return; | |
| 3786 } | |
| 3787 | |
| 3788 if ($methylation_calls[$index] eq 'X') { | |
| 3789 $counting{total_meCHG_count}++; | |
| 3790 print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3791 if ($read_identity == 1){ | |
| 3792 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 3793 } | |
| 3794 else{ | |
| 3795 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 3796 } | |
| 3797 } | |
| 3798 elsif ($methylation_calls[$index] eq 'x') { | |
| 3799 $counting{total_unmethylated_CHG_count}++; | |
| 3800 print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3801 if ($read_identity == 1){ | |
| 3802 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 3803 } | |
| 3804 else{ | |
| 3805 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 3806 } | |
| 3807 } | |
| 3808 elsif ($methylation_calls[$index] eq 'Z') { | |
| 3809 $counting{total_meCpG_count}++; | |
| 3810 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3811 if ($read_identity == 1){ | |
| 3812 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 3813 } | |
| 3814 else{ | |
| 3815 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 3816 } | |
| 3817 } | |
| 3818 elsif ($methylation_calls[$index] eq 'z') { | |
| 3819 $counting{total_unmethylated_CpG_count}++; | |
| 3820 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3821 if ($read_identity == 1){ | |
| 3822 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 3823 } | |
| 3824 else{ | |
| 3825 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 3826 } | |
| 3827 } | |
| 3828 elsif ($methylation_calls[$index] eq 'H') { | |
| 3829 $counting{total_meCHH_count}++; | |
| 3830 print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3831 if ($read_identity == 1){ | |
| 3832 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 3833 } | |
| 3834 else{ | |
| 3835 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 3836 } | |
| 3837 } | |
| 3838 elsif ($methylation_calls[$index] eq 'h') { | |
| 3839 $counting{total_unmethylated_CHH_count}++; | |
| 3840 print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3841 if ($read_identity == 1){ | |
| 3842 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 3843 } | |
| 3844 else{ | |
| 3845 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 3846 } | |
| 3847 } | |
| 3848 elsif ($methylation_calls[$index] eq '.') {} | |
| 3849 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 3850 else{ | |
| 3851 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 3852 } | |
| 3853 } | |
| 3854 } elsif ($strand eq '-') { | |
| 3855 for my $index (0..$#methylation_calls) { | |
| 3856 | |
| 3857 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 3858 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; | |
| 3859 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 3860 $cigar_offset += $cigar_mod; | |
| 3861 $pos_offset += $pos_mod; | |
| 3862 } | |
| 3863 | |
| 3864 ### Returning as soon as the methylation calls start overlapping | |
| 3865 if ($start-$index+$pos_offset <= $end_read_1) { | |
| 3866 return; | |
| 3867 } | |
| 3868 | |
| 3869 if ($methylation_calls[$index] eq 'X') { | |
| 3870 $counting{total_meCHG_count}++; | |
| 3871 print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3872 if ($read_identity == 1){ | |
| 3873 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 3874 } | |
| 3875 else{ | |
| 3876 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 3877 } | |
| 3878 } | |
| 3879 elsif ($methylation_calls[$index] eq 'x') { | |
| 3880 $counting{total_unmethylated_CHG_count}++; | |
| 3881 print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3882 if ($read_identity == 1){ | |
| 3883 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 3884 } | |
| 3885 else{ | |
| 3886 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 3887 } | |
| 3888 } | |
| 3889 elsif ($methylation_calls[$index] eq 'Z') { | |
| 3890 $counting{total_meCpG_count}++; | |
| 3891 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3892 if ($read_identity == 1){ | |
| 3893 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 3894 } | |
| 3895 else{ | |
| 3896 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 3897 } | |
| 3898 } | |
| 3899 elsif ($methylation_calls[$index] eq 'z') { | |
| 3900 $counting{total_unmethylated_CpG_count}++; | |
| 3901 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3902 if ($read_identity == 1){ | |
| 3903 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 3904 } | |
| 3905 else{ | |
| 3906 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 3907 } | |
| 3908 } | |
| 3909 elsif ($methylation_calls[$index] eq 'H') { | |
| 3910 $counting{total_meCHH_count}++; | |
| 3911 print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3912 if ($read_identity == 1){ | |
| 3913 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 3914 } | |
| 3915 else{ | |
| 3916 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 3917 } | |
| 3918 } | |
| 3919 elsif ($methylation_calls[$index] eq 'h') { | |
| 3920 $counting{total_unmethylated_CHH_count}++; | |
| 3921 print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3922 if ($read_identity == 1){ | |
| 3923 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 3924 } | |
| 3925 else{ | |
| 3926 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 3927 } | |
| 3928 } | |
| 3929 elsif ($methylation_calls[$index] eq '.') {} | |
| 3930 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 3931 else{ | |
| 3932 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 3933 } | |
| 3934 } | |
| 3935 } else { | |
| 3936 die "The strand orientation as neither + nor -: '$strand'\n"; | |
| 3937 } | |
| 3938 } | |
| 3939 } | |
| 3940 | |
| 3941 ### this is the paired-end procedure allowing overlaps and using every single C position | |
| 3942 else { | |
| 3943 ### single-file CpG, CHG and CHH context output | |
| 3944 if ($full) { | |
| 3945 if ($strand eq '+') { | |
| 3946 for my $index (0..$#methylation_calls) { | |
| 3947 | |
| 3948 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 3949 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 3950 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; | |
| 3951 $cigar_offset += $cigar_mod; | |
| 3952 $pos_offset += $pos_mod; | |
| 3953 } | |
| 3954 | |
| 3955 if ($methylation_calls[$index] eq 'X') { | |
| 3956 $counting{total_meCHG_count}++; | |
| 3957 print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3958 if ($read_identity == 1){ | |
| 3959 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 3960 } | |
| 3961 else{ | |
| 3962 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 3963 } | |
| 3964 } | |
| 3965 elsif ($methylation_calls[$index] eq 'x') { | |
| 3966 $counting{total_unmethylated_CHG_count}++; | |
| 3967 print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3968 if ($read_identity == 1){ | |
| 3969 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 3970 } | |
| 3971 else{ | |
| 3972 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 3973 } | |
| 3974 } | |
| 3975 elsif ($methylation_calls[$index] eq 'Z') { | |
| 3976 $counting{total_meCpG_count}++; | |
| 3977 print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3978 if ($read_identity == 1){ | |
| 3979 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 3980 } | |
| 3981 else{ | |
| 3982 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 3983 } | |
| 3984 } | |
| 3985 elsif ($methylation_calls[$index] eq 'z') { | |
| 3986 $counting{total_unmethylated_CpG_count}++; | |
| 3987 print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3988 if ($read_identity == 1){ | |
| 3989 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 3990 } | |
| 3991 else{ | |
| 3992 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 3993 } | |
| 3994 } | |
| 3995 elsif ($methylation_calls[$index] eq 'H') { | |
| 3996 $counting{total_meCHH_count}++; | |
| 3997 print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 3998 if ($read_identity == 1){ | |
| 3999 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 4000 } | |
| 4001 else{ | |
| 4002 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 4003 } | |
| 4004 } | |
| 4005 elsif ($methylation_calls[$index] eq 'h') { | |
| 4006 $counting{total_unmethylated_CHH_count}++; | |
| 4007 print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4008 if ($read_identity == 1){ | |
| 4009 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 4010 } | |
| 4011 else{ | |
| 4012 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 4013 } | |
| 4014 } | |
| 4015 elsif ($methylation_calls[$index] eq '.') {} | |
| 4016 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 4017 else{ | |
| 4018 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 4019 } | |
| 4020 } | |
| 4021 } elsif ($strand eq '-') { | |
| 4022 for my $index (0..$#methylation_calls) { | |
| 4023 | |
| 4024 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 4025 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; | |
| 4026 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 4027 $cigar_offset += $cigar_mod; | |
| 4028 $pos_offset += $pos_mod; | |
| 4029 } | |
| 4030 | |
| 4031 if ($methylation_calls[$index] eq 'X') { | |
| 4032 $counting{total_meCHG_count}++; | |
| 4033 print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4034 if ($read_identity == 1){ | |
| 4035 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 4036 } | |
| 4037 else{ | |
| 4038 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 4039 } | |
| 4040 } | |
| 4041 elsif ($methylation_calls[$index] eq 'x') { | |
| 4042 $counting{total_unmethylated_CHG_count}++; | |
| 4043 print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4044 if ($read_identity == 1){ | |
| 4045 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 4046 } | |
| 4047 else{ | |
| 4048 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 4049 } | |
| 4050 } | |
| 4051 elsif ($methylation_calls[$index] eq 'Z') { | |
| 4052 $counting{total_meCpG_count}++; | |
| 4053 print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4054 if ($read_identity == 1){ | |
| 4055 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 4056 } | |
| 4057 else{ | |
| 4058 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 4059 } | |
| 4060 } | |
| 4061 elsif ($methylation_calls[$index] eq 'z') { | |
| 4062 $counting{total_unmethylated_CpG_count}++; | |
| 4063 print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4064 if ($read_identity == 1){ | |
| 4065 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 4066 } | |
| 4067 else{ | |
| 4068 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 4069 } | |
| 4070 } | |
| 4071 elsif ($methylation_calls[$index] eq 'H') { | |
| 4072 $counting{total_meCHH_count}++; | |
| 4073 print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4074 if ($read_identity == 1){ | |
| 4075 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 4076 } | |
| 4077 else{ | |
| 4078 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 4079 } | |
| 4080 } | |
| 4081 elsif ($methylation_calls[$index] eq 'h') { | |
| 4082 $counting{total_unmethylated_CHH_count}++; | |
| 4083 print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4084 if ($read_identity == 1){ | |
| 4085 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 4086 } | |
| 4087 else{ | |
| 4088 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 4089 } | |
| 4090 } | |
| 4091 elsif ($methylation_calls[$index] eq '.') {} | |
| 4092 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 4093 else{ | |
| 4094 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 4095 } | |
| 4096 } | |
| 4097 } else { | |
| 4098 die "The strand orientation as neither + nor -: '$strand'\n"; | |
| 4099 } | |
| 4100 } | |
| 4101 | |
| 4102 ### strand-specific methylation output | |
| 4103 else { | |
| 4104 if ($strand eq '+') { | |
| 4105 for my $index (0..$#methylation_calls) { | |
| 4106 | |
| 4107 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 4108 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 4109 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; | |
| 4110 $cigar_offset += $cigar_mod; | |
| 4111 $pos_offset += $pos_mod; | |
| 4112 } | |
| 4113 | |
| 4114 if ($methylation_calls[$index] eq 'X') { | |
| 4115 $counting{total_meCHG_count}++; | |
| 4116 print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4117 if ($read_identity == 1){ | |
| 4118 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 4119 } | |
| 4120 else{ | |
| 4121 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 4122 } | |
| 4123 } | |
| 4124 elsif ($methylation_calls[$index] eq 'x') { | |
| 4125 $counting{total_unmethylated_CHG_count}++; | |
| 4126 print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4127 if ($read_identity == 1){ | |
| 4128 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 4129 } | |
| 4130 else{ | |
| 4131 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 4132 } | |
| 4133 } | |
| 4134 elsif ($methylation_calls[$index] eq 'Z') { | |
| 4135 $counting{total_meCpG_count}++; | |
| 4136 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4137 if ($read_identity == 1){ | |
| 4138 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 4139 } | |
| 4140 else{ | |
| 4141 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 4142 } | |
| 4143 } | |
| 4144 elsif ($methylation_calls[$index] eq 'z') { | |
| 4145 $counting{total_unmethylated_CpG_count}++; | |
| 4146 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4147 if ($read_identity == 1){ | |
| 4148 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 4149 } | |
| 4150 else{ | |
| 4151 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 4152 } | |
| 4153 } | |
| 4154 elsif ($methylation_calls[$index] eq 'H') { | |
| 4155 $counting{total_meCHH_count}++; | |
| 4156 print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4157 if ($read_identity == 1){ | |
| 4158 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 4159 } | |
| 4160 else{ | |
| 4161 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 4162 } | |
| 4163 } | |
| 4164 elsif ($methylation_calls[$index] eq 'h') { | |
| 4165 $counting{total_unmethylated_CHH_count}++; | |
| 4166 print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4167 if ($read_identity == 1){ | |
| 4168 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 4169 } | |
| 4170 else{ | |
| 4171 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 4172 } | |
| 4173 } | |
| 4174 elsif ($methylation_calls[$index] eq '.') {} | |
| 4175 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 4176 else{ | |
| 4177 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 4178 } | |
| 4179 } | |
| 4180 } elsif ($strand eq '-') { | |
| 4181 for my $index (0..$#methylation_calls) { | |
| 4182 | |
| 4183 if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels | |
| 4184 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; | |
| 4185 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 4186 $cigar_offset += $cigar_mod; | |
| 4187 $pos_offset += $pos_mod; | |
| 4188 } | |
| 4189 | |
| 4190 if ($methylation_calls[$index] eq 'X') { | |
| 4191 $counting{total_meCHG_count}++; | |
| 4192 print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4193 if ($read_identity == 1){ | |
| 4194 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 4195 } | |
| 4196 else{ | |
| 4197 $mbias_2{CHG}->{$index+1}->{meth}++; | |
| 4198 } | |
| 4199 } | |
| 4200 elsif ($methylation_calls[$index] eq 'x') { | |
| 4201 $counting{total_unmethylated_CHG_count}++; | |
| 4202 print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4203 if ($read_identity == 1){ | |
| 4204 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 4205 } | |
| 4206 else{ | |
| 4207 $mbias_2{CHG}->{$index+1}->{un}++; | |
| 4208 } | |
| 4209 } | |
| 4210 elsif ($methylation_calls[$index] eq 'Z') { | |
| 4211 $counting{total_meCpG_count}++; | |
| 4212 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4213 if ($read_identity == 1){ | |
| 4214 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 4215 } | |
| 4216 else{ | |
| 4217 $mbias_2{CpG}->{$index+1}->{meth}++; | |
| 4218 } | |
| 4219 } | |
| 4220 elsif ($methylation_calls[$index] eq 'z') { | |
| 4221 $counting{total_unmethylated_CpG_count}++; | |
| 4222 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4223 if ($read_identity == 1){ | |
| 4224 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 4225 } | |
| 4226 else{ | |
| 4227 $mbias_2{CpG}->{$index+1}->{un}++; | |
| 4228 } | |
| 4229 } | |
| 4230 elsif ($methylation_calls[$index] eq 'H') { | |
| 4231 $counting{total_meCHH_count}++; | |
| 4232 print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4233 if ($read_identity == 1){ | |
| 4234 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 4235 } | |
| 4236 else{ | |
| 4237 $mbias_2{CHH}->{$index+1}->{meth}++; | |
| 4238 } | |
| 4239 } | |
| 4240 elsif ($methylation_calls[$index] eq 'h') { | |
| 4241 $counting{total_unmethylated_CHH_count}++; | |
| 4242 print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4243 if ($read_identity == 1){ | |
| 4244 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 4245 } | |
| 4246 else{ | |
| 4247 $mbias_2{CHH}->{$index+1}->{un}++; | |
| 4248 } | |
| 4249 } | |
| 4250 elsif ($methylation_calls[$index] eq '.') {} | |
| 4251 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 4252 else{ | |
| 4253 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 4254 } | |
| 4255 } | |
| 4256 } else { | |
| 4257 die "The strand orientation as neither + nor -: '$strand'\n"; | |
| 4258 } | |
| 4259 } | |
| 4260 } | |
| 4261 } | |
| 4262 | |
| 4263 sub check_cigar_string { | |
| 4264 my ($index,$cigar_offset,$pos_offset,$strand,$comp_cigar) = @_; | |
| 4265 # print "$index\t$cigar_offset\t$pos_offset\t$strand\t"; | |
| 4266 my ($new_cigar_offset,$new_pos_offset) = (0,0); | |
| 4267 | |
| 4268 if ($strand eq '+') { | |
| 4269 # print "### $strand strand @$comp_cigar[$index + $cigar_offset]\t"; | |
| 4270 | |
| 4271 if (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'M'){ # sequence position matches the genomic position | |
| 4272 # warn "position needs no adjustment\n"; | |
| 4273 } | |
| 4274 | |
| 4275 elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'I'){ # insertion in the read sequence | |
| 4276 $new_pos_offset -= 1; # we need to subtract the length of inserted bases from the genomic position | |
| 4277 # warn "adjusted genomic position by -1 bp (insertion)\n"; | |
| 4278 } | |
| 4279 | |
| 4280 elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'D'){ # deletion in the read sequence | |
| 4281 $new_cigar_offset += 1; # the composite cigar string does no longer match the methylation call index | |
| 4282 $new_pos_offset += 1; # we need to add the length of deleted bases to get the genomic position | |
| 4283 # warn "adjusted genomic position by +1 bp (deletion). Now looping through the CIGAR string until we hit another M or I\n"; | |
| 4284 | |
| 4285 while ( ($index + $cigar_offset + $new_cigar_offset) < (scalar @$comp_cigar) ){ | |
| 4286 if (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'M'){ # sequence position matches the genomic position | |
| 4287 # warn "position needs no adjustment\n"; | |
| 4288 last; | |
| 4289 } | |
| 4290 elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'I'){ | |
| 4291 $new_pos_offset -= 1; # we need to subtract the length of inserted bases from the genomic position | |
| 4292 # warn "adjusted genomic position by another -1 bp (insertion)\n"; | |
| 4293 last; | |
| 4294 } | |
| 4295 elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'D'){ # deletion in the read sequence | |
| 4296 $new_cigar_offset += 1; # the composite cigar string does no longer match the methylation call index | |
| 4297 $new_pos_offset += 1; # we need to add the length of deleted bases to get the genomic position | |
| 4298 # warn "adjusted genomic position by another +1 bp (deletion)\n"; | |
| 4299 } | |
| 4300 else{ | |
| 4301 die "The CIGAR string contained undefined operations in addition to 'M', 'I' and 'D': '@$comp_cigar[$index + $cigar_offset + $new_cigar_offset]'\n"; | |
| 4302 } | |
| 4303 } | |
| 4304 } | |
| 4305 else{ | |
| 4306 die "The CIGAR string contained undefined operations in addition to 'M', 'I' and 'D': '@$comp_cigar[$index + $cigar_offset + $new_cigar_offset]'\n"; | |
| 4307 } | |
| 4308 } | |
| 4309 | |
| 4310 elsif ($strand eq '-') { | |
| 4311 # print "### $strand strand @$comp_cigar[$index + $cigar_offset]\t"; | |
| 4312 | |
| 4313 if (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'M'){ # sequence position matches the genomic position | |
| 4314 # warn "position needs no adjustment\n"; | |
| 4315 } | |
| 4316 | |
| 4317 elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'I'){ # insertion in the read sequence | |
| 4318 $new_pos_offset += 1; # we need to add the length of inserted bases to the genomic position | |
| 4319 # warn "adjusted genomic position by +1 bp (insertion)\n"; | |
| 4320 } | |
| 4321 | |
| 4322 elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'D'){ # deletion in the read sequence | |
| 4323 $new_cigar_offset += 1; # the composite cigar string does no longer match the methylation call index | |
| 4324 $new_pos_offset -= 1; # we need to subtract the length of deleted bases to get the genomic position | |
| 4325 # warn "adjusted genomic position by -1 bp (deletion). Now looping through the CIGAR string until we hit another M or I\n"; | |
| 4326 | |
| 4327 while ( ($index + $cigar_offset + $new_cigar_offset) < (scalar @$comp_cigar) ){ | |
| 4328 if (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'M'){ # sequence position matches the genomic position | |
| 4329 # warn "Found new 'M' operation; position needs no adjustment\n"; | |
| 4330 last; | |
| 4331 } | |
| 4332 elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'I'){ | |
| 4333 $new_pos_offset += 1; # we need to subtract the length of inserted bases from the genomic position | |
| 4334 # warn "Found new 'I' operation; adjusted genomic position by another +1 bp (insertion)\n"; | |
| 4335 last; | |
| 4336 } | |
| 4337 elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'D'){ # deletion in the read sequence | |
| 4338 $new_cigar_offset += 1; # the composite cigar string does no longer match the methylation call index | |
| 4339 $new_pos_offset -= 1; # we need to subtract the length of deleted bases to get the genomic position | |
| 4340 # warn "adjusted genomic position by another -1 bp (deletion)\n"; | |
| 4341 } | |
| 4342 else{ | |
| 4343 die "The CIGAR string contained undefined operations in addition to 'M', 'I' and 'D': '@$comp_cigar[$index + $cigar_offset + $new_cigar_offset]'\n"; | |
| 4344 } | |
| 4345 } | |
| 4346 } | |
| 4347 else{ | |
| 4348 die "The CIGAR string contained undefined operations in addition to 'M', 'I' and 'D': '@$comp_cigar[$index + $cigar_offset + $new_cigar_offset]'\n"; | |
| 4349 } | |
| 4350 } | |
| 4351 # print "new cigar offset: $new_cigar_offset\tnew pos offset: $new_pos_offset\n"; | |
| 4352 return ($new_cigar_offset,$new_pos_offset); | |
| 4353 } | |
| 4354 | |
| 4355 sub print_individual_C_methylation_states_single_end{ | |
| 4356 | |
| 4357 my ($meth_call,$chrom,$start,$id,$strand,$filehandle_index,$cigar) = @_; | |
| 4358 my @methylation_calls = split(//,$meth_call); | |
| 4359 | |
| 4360 ################################################################# | |
| 4361 ### . for bases not involving cytosines ### | |
| 4362 ### X for methylated C in CHG context (was protected) ### | |
| 4363 ### x for not methylated C in CHG context (was converted) ### | |
| 4364 ### H for methylated C in CHH context (was protected) ### | |
| 4365 ### h for not methylated C in CHH context (was converted) ### | |
| 4366 ### Z for methylated C in CpG context (was protected) ### | |
| 4367 ### z for not methylated C in CpG context (was converted) ### | |
| 4368 ################################################################# | |
| 4369 | |
| 4370 my $methyl_CHG_count = 0; | |
| 4371 my $methyl_CHH_count = 0; | |
| 4372 my $methyl_CpG_count = 0; | |
| 4373 my $unmethylated_CHG_count = 0; | |
| 4374 my $unmethylated_CHH_count = 0; | |
| 4375 my $unmethylated_CpG_count = 0; | |
| 4376 | |
| 4377 my $pos_offset = 0; # this is only relevant for SAM reads with insertions or deletions | |
| 4378 my $cigar_offset = 0; # again, this is only relevant for SAM reads containing indels | |
| 4379 | |
| 4380 my @comp_cigar; | |
| 4381 | |
| 4382 if ($cigar){ # parsing CIGAR string | |
| 4383 | |
| 4384 ### Checking whether the CIGAR string is a linear genomic match or whether it requires indel processing | |
| 4385 if ($cigar =~ /^\d+M$/){ | |
| 4386 # warn "See!? I told you so! $cigar\n"; | |
| 4387 # sleep(1); | |
| 4388 } | |
| 4389 else{ | |
| 4390 | |
| 4391 my @len; | |
| 4392 my @ops; | |
| 4393 | |
| 4394 @len = split (/\D+/,$cigar); # storing the length per operation | |
| 4395 @ops = split (/\d+/,$cigar); # storing the operation | |
| 4396 shift @ops; # remove the empty first element | |
| 4397 # die "CIGAR string contained a non-matching number of lengths and operations: id: $id\nmeth call: $meth_call\nCIGAR: $cigar\n".join(" ",@len)."\n".join(" ",@ops)."\n" unless (scalar @len == scalar @ops); | |
| 4398 die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len == scalar @ops); | |
| 4399 | |
| 4400 foreach my $index (0..$#len){ | |
| 4401 foreach (1..$len[$index]){ | |
| 4402 # print "$ops[$index]"; | |
| 4403 push @comp_cigar, $ops[$index]; | |
| 4404 } | |
| 4405 } | |
| 4406 } | |
| 4407 # warn "\nDetected CIGAR string: $cigar\n"; | |
| 4408 # warn "Length of methylation call: ",length $meth_call,"\n"; | |
| 4409 # warn "number of operations: ",scalar @ops,"\n"; | |
| 4410 # warn "number of length digits: ",scalar @len,"\n\n"; | |
| 4411 # print @comp_cigar,"\n"; | |
| 4412 # print "$meth_call\n\n"; | |
| 4413 # sleep (1); | |
| 4414 } | |
| 4415 | |
| 4416 ### adjusting the start position for all reads mapping to the reverse strand | |
| 4417 if ($strand eq '-') { | |
| 4418 | |
| 4419 if (@comp_cigar){ # only needed for SAM reads with InDels | |
| 4420 @comp_cigar = reverse@comp_cigar; # the CIGAR string needs to be reversed for all reads aligning to the reverse strand, too | |
| 4421 # print @comp_cigar,"\n"; | |
| 4422 } | |
| 4423 | |
| 4424 unless ($ignore){ ### if --ignore was specified the start position has already been corrected | |
| 4425 | |
| 4426 if ($cigar){ ### SAM format | |
| 4427 if ($cigar =~ /^(\d+)M$/){ # linear match | |
| 4428 $start += $1 - 1; | |
| 4429 } | |
| 4430 else{ # InDel read | |
| 4431 my $MD_count = 0; | |
| 4432 foreach (@comp_cigar){ | |
| 4433 ++$MD_count if ($_ eq 'M' or $_ eq 'D'); # Matching bases or deletions affect the genomic position of the 3' ends of reads, insertions don't | |
| 4434 } | |
| 4435 $start += $MD_count - 1; | |
| 4436 } | |
| 4437 } | |
| 4438 else{ ### vanilla format | |
| 4439 $start += length($meth_call)-1; | |
| 4440 } | |
| 4441 } | |
| 4442 } | |
| 4443 | |
| 4444 ### THIS IS THE CpG and Non-CpG SECTION (OPTIONAL) | |
| 4445 | |
| 4446 ### single-file CpG and other-context output | |
| 4447 if ($full and $merge_non_CpG) { | |
| 4448 if ($strand eq '+') { | |
| 4449 for my $index (0..$#methylation_calls) { | |
| 4450 | |
| 4451 if ($cigar and @comp_cigar){ # only needed for SAM alignments with InDels | |
| 4452 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 4453 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t"; | |
| 4454 $cigar_offset += $cigar_mod; | |
| 4455 $pos_offset += $pos_mod; | |
| 4456 } | |
| 4457 | |
| 4458 ### methylated Cs (any context) will receive a forward (+) orientation | |
| 4459 ### not methylated Cs (any context) will receive a reverse (-) orientation | |
| 4460 if ($methylation_calls[$index] eq 'X') { | |
| 4461 $counting{total_meCHG_count}++; | |
| 4462 my $line = join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n"; | |
| 4463 print {$fhs{other_context}} $line unless($mbias_only); | |
| 4464 # print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4465 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 4466 } | |
| 4467 elsif ($methylation_calls[$index] eq 'x') { | |
| 4468 $counting{total_unmethylated_CHG_count}++; | |
| 4469 my $line = join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n"; | |
| 4470 print {$fhs{other_context}} $line unless($mbias_only); | |
| 4471 # print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4472 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 4473 } | |
| 4474 elsif ($methylation_calls[$index] eq 'Z') { | |
| 4475 $counting{total_meCpG_count}++; | |
| 4476 my $line = join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n"; | |
| 4477 print {$fhs{CpG_context}} $line unless($mbias_only); | |
| 4478 # print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4479 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 4480 } | |
| 4481 elsif ($methylation_calls[$index] eq 'z') { | |
| 4482 $counting{total_unmethylated_CpG_count}++; | |
| 4483 my $line = join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n"; | |
| 4484 print {$fhs{CpG_context}} $line unless($mbias_only); | |
| 4485 # print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4486 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 4487 } | |
| 4488 elsif ($methylation_calls[$index] eq 'H') { | |
| 4489 $counting{total_meCHH_count}++; | |
| 4490 my $line = join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n"; | |
| 4491 print {$fhs{other_context}} $line unless($mbias_only); | |
| 4492 # print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4493 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 4494 } | |
| 4495 elsif ($methylation_calls[$index] eq 'h') { | |
| 4496 $counting{total_unmethylated_CHH_count}++; | |
| 4497 my $line = join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n"; | |
| 4498 print {$fhs{other_context}} $line unless($mbias_only); | |
| 4499 # print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4500 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 4501 } | |
| 4502 elsif ($methylation_calls[$index] eq '.') {} | |
| 4503 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 4504 else{ | |
| 4505 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 4506 } | |
| 4507 } | |
| 4508 } | |
| 4509 elsif ($strand eq '-') { | |
| 4510 | |
| 4511 for my $index (0..$#methylation_calls) { | |
| 4512 ### methylated Cs (any context) will receive a forward (+) orientation | |
| 4513 ### not methylated Cs (any context) will receive a reverse (-) orientation | |
| 4514 | |
| 4515 if ($cigar and @comp_cigar){ # only needed for SAM entries with InDels | |
| 4516 # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t"; | |
| 4517 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 4518 $cigar_offset += $cigar_mod; | |
| 4519 $pos_offset += $pos_mod; | |
| 4520 } | |
| 4521 | |
| 4522 if ($methylation_calls[$index] eq 'X') { | |
| 4523 $counting{total_meCHG_count}++; | |
| 4524 my $line = join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n"; | |
| 4525 print {$fhs{other_context}} $line unless($mbias_only); | |
| 4526 #print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4527 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 4528 } | |
| 4529 elsif ($methylation_calls[$index] eq 'x') { | |
| 4530 $counting{total_unmethylated_CHG_count}++; | |
| 4531 my $line = join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n"; | |
| 4532 print {$fhs{other_context}} $line unless($mbias_only); | |
| 4533 #print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4534 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 4535 } | |
| 4536 elsif ($methylation_calls[$index] eq 'Z') { | |
| 4537 $counting{total_meCpG_count}++; | |
| 4538 my $line = join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n"; | |
| 4539 print {$fhs{CpG_context}} $line unless($mbias_only); | |
| 4540 #print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4541 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 4542 } | |
| 4543 elsif ($methylation_calls[$index] eq 'z') { | |
| 4544 $counting{total_unmethylated_CpG_count}++; | |
| 4545 my $line = join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n"; | |
| 4546 print {$fhs{CpG_context}} $line unless($mbias_only); | |
| 4547 #print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4548 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 4549 } | |
| 4550 elsif ($methylation_calls[$index] eq 'H') { | |
| 4551 $counting{total_meCHH_count}++; | |
| 4552 my $line = join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n"; | |
| 4553 print {$fhs{other_context}} $line unless($mbias_only); | |
| 4554 #print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4555 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 4556 } | |
| 4557 elsif ($methylation_calls[$index] eq 'h') { | |
| 4558 $counting{total_unmethylated_CHH_count}++; | |
| 4559 my $line = join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n"; | |
| 4560 print {$fhs{other_context}} $line unless($mbias_only); | |
| 4561 #print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4562 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 4563 } | |
| 4564 elsif ($methylation_calls[$index] eq '.'){} | |
| 4565 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 4566 else{ | |
| 4567 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 4568 } | |
| 4569 } | |
| 4570 } | |
| 4571 else { | |
| 4572 die "The strand information was neither + nor -: $strand\n"; | |
| 4573 } | |
| 4574 } | |
| 4575 | |
| 4576 ### strand-specific methylation output | |
| 4577 elsif ($merge_non_CpG) { | |
| 4578 if ($strand eq '+') { | |
| 4579 for my $index (0..$#methylation_calls) { | |
| 4580 ### methylated Cs (any context) will receive a forward (+) orientation | |
| 4581 ### not methylated Cs (any context) will receive a reverse (-) orientation | |
| 4582 | |
| 4583 if ($cigar and @comp_cigar){ # only needed for SAM reads with Indels | |
| 4584 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 4585 $cigar_offset += $cigar_mod; | |
| 4586 $pos_offset += $pos_mod; | |
| 4587 } | |
| 4588 | |
| 4589 if ($methylation_calls[$index] eq 'X') { | |
| 4590 $counting{total_meCHG_count}++; | |
| 4591 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4592 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 4593 } | |
| 4594 elsif ($methylation_calls[$index] eq 'x') { | |
| 4595 $counting{total_unmethylated_CHG_count}++; | |
| 4596 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4597 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 4598 } | |
| 4599 elsif ($methylation_calls[$index] eq 'Z') { | |
| 4600 $counting{total_meCpG_count}++; | |
| 4601 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4602 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 4603 } | |
| 4604 elsif ($methylation_calls[$index] eq 'z') { | |
| 4605 $counting{total_unmethylated_CpG_count}++; | |
| 4606 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4607 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 4608 } | |
| 4609 elsif ($methylation_calls[$index] eq 'H') { | |
| 4610 $counting{total_meCHH_count}++; | |
| 4611 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4612 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 4613 } | |
| 4614 elsif ($methylation_calls[$index] eq 'h') { | |
| 4615 $counting{total_unmethylated_CHH_count}++; | |
| 4616 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4617 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 4618 } | |
| 4619 elsif ($methylation_calls[$index] eq '.') {} | |
| 4620 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 4621 else{ | |
| 4622 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 4623 } | |
| 4624 } | |
| 4625 } | |
| 4626 elsif ($strand eq '-') { | |
| 4627 | |
| 4628 for my $index (0..$#methylation_calls) { | |
| 4629 ### methylated Cs (any context) will receive a forward (+) orientation | |
| 4630 ### not methylated Cs (any context) will receive a reverse (-) orientation | |
| 4631 | |
| 4632 if ($cigar and @comp_cigar){ # only needed for SAM reads with Indels | |
| 4633 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 4634 $cigar_offset += $cigar_mod; | |
| 4635 $pos_offset += $pos_mod; | |
| 4636 } | |
| 4637 | |
| 4638 if ($methylation_calls[$index] eq 'X') { | |
| 4639 $counting{total_meCHG_count}++; | |
| 4640 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4641 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 4642 } | |
| 4643 elsif ($methylation_calls[$index] eq 'x') { | |
| 4644 $counting{total_unmethylated_CHG_count}++; | |
| 4645 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4646 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 4647 } | |
| 4648 elsif ($methylation_calls[$index] eq 'Z') { | |
| 4649 $counting{total_meCpG_count}++; | |
| 4650 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4651 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 4652 } | |
| 4653 elsif ($methylation_calls[$index] eq 'z') { | |
| 4654 $counting{total_unmethylated_CpG_count}++; | |
| 4655 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4656 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 4657 } | |
| 4658 elsif ($methylation_calls[$index] eq 'H') { | |
| 4659 $counting{total_meCHH_count}++; | |
| 4660 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4661 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 4662 } | |
| 4663 elsif ($methylation_calls[$index] eq 'h') { | |
| 4664 $counting{total_unmethylated_CHH_count}++; | |
| 4665 print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4666 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 4667 } | |
| 4668 elsif ($methylation_calls[$index] eq '.') {} | |
| 4669 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 4670 else{ | |
| 4671 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 4672 } | |
| 4673 } | |
| 4674 } | |
| 4675 else { | |
| 4676 die "The strand information was neither + nor -: $strand\n"; | |
| 4677 } | |
| 4678 } | |
| 4679 | |
| 4680 ### THIS IS THE 3-CONTEXT (CpG, CHG and CHH) DEFAULT SECTION | |
| 4681 | |
| 4682 elsif ($full) { | |
| 4683 if ($strand eq '+') { | |
| 4684 for my $index (0..$#methylation_calls) { | |
| 4685 ### methylated Cs (any context) will receive a forward (+) orientation | |
| 4686 ### not methylated Cs (any context) will receive a reverse (-) orientation | |
| 4687 | |
| 4688 if ($cigar and @comp_cigar){ # only needed for SAM reads with Indels | |
| 4689 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 4690 $cigar_offset += $cigar_mod; | |
| 4691 $pos_offset += $pos_mod; | |
| 4692 } | |
| 4693 | |
| 4694 if ($methylation_calls[$index] eq 'X') { | |
| 4695 $counting{total_meCHG_count}++; | |
| 4696 print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4697 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 4698 } | |
| 4699 elsif ($methylation_calls[$index] eq 'x') { | |
| 4700 $counting{total_unmethylated_CHG_count}++; | |
| 4701 print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4702 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 4703 } | |
| 4704 elsif ($methylation_calls[$index] eq 'Z') { | |
| 4705 $counting{total_meCpG_count}++; | |
| 4706 print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4707 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 4708 } | |
| 4709 elsif ($methylation_calls[$index] eq 'z') { | |
| 4710 $counting{total_unmethylated_CpG_count}++; | |
| 4711 print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4712 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 4713 } | |
| 4714 elsif ($methylation_calls[$index] eq 'H') { | |
| 4715 $counting{total_meCHH_count}++; | |
| 4716 print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4717 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 4718 } | |
| 4719 elsif ($methylation_calls[$index] eq 'h') { | |
| 4720 $counting{total_unmethylated_CHH_count}++; | |
| 4721 print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4722 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 4723 } | |
| 4724 elsif ($methylation_calls[$index] eq '.') {} | |
| 4725 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 4726 else{ | |
| 4727 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n" unless($mbias_only); | |
| 4728 } | |
| 4729 } | |
| 4730 } | |
| 4731 elsif ($strand eq '-') { | |
| 4732 | |
| 4733 for my $index (0..$#methylation_calls) { | |
| 4734 ### methylated Cs (any context) will receive a forward (+) orientation | |
| 4735 ### not methylated Cs (any context) will receive a reverse (-) orientation | |
| 4736 | |
| 4737 if ($cigar and @comp_cigar){ # only needed for SAM reads with Indels | |
| 4738 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 4739 $cigar_offset += $cigar_mod; | |
| 4740 $pos_offset += $pos_mod; | |
| 4741 } | |
| 4742 | |
| 4743 if ($methylation_calls[$index] eq 'X') { | |
| 4744 $counting{total_meCHG_count}++; | |
| 4745 print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4746 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 4747 } | |
| 4748 elsif ($methylation_calls[$index] eq 'x') { | |
| 4749 $counting{total_unmethylated_CHG_count}++; | |
| 4750 print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4751 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 4752 } | |
| 4753 elsif ($methylation_calls[$index] eq 'Z') { | |
| 4754 $counting{total_meCpG_count}++; | |
| 4755 print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4756 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 4757 } | |
| 4758 elsif ($methylation_calls[$index] eq 'z') { | |
| 4759 $counting{total_unmethylated_CpG_count}++; | |
| 4760 print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4761 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 4762 } | |
| 4763 elsif ($methylation_calls[$index] eq 'H') { | |
| 4764 $counting{total_meCHH_count}++; | |
| 4765 print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4766 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 4767 } | |
| 4768 elsif ($methylation_calls[$index] eq 'h') { | |
| 4769 $counting{total_unmethylated_CHH_count}++; | |
| 4770 print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4771 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 4772 } | |
| 4773 elsif ($methylation_calls[$index] eq '.') {} | |
| 4774 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 4775 else{ | |
| 4776 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 4777 } | |
| 4778 } | |
| 4779 } | |
| 4780 else { | |
| 4781 die "The read had a strand orientation which was neither + nor -: $strand\n"; | |
| 4782 } | |
| 4783 } | |
| 4784 | |
| 4785 ### strand-specific methylation output | |
| 4786 else { | |
| 4787 if ($strand eq '+') { | |
| 4788 for my $index (0..$#methylation_calls) { | |
| 4789 ### methylated Cs (any context) will receive a forward (+) orientation | |
| 4790 ### not methylated Cs (any context) will receive a reverse (-) orientation | |
| 4791 | |
| 4792 if ($cigar and @comp_cigar){ # only needed for SAM reads with Indels | |
| 4793 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 4794 $cigar_offset += $cigar_mod; | |
| 4795 $pos_offset += $pos_mod; | |
| 4796 } | |
| 4797 | |
| 4798 if ($methylation_calls[$index] eq 'X') { | |
| 4799 $counting{total_meCHG_count}++; | |
| 4800 print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4801 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 4802 } | |
| 4803 elsif ($methylation_calls[$index] eq 'x') { | |
| 4804 $counting{total_unmethylated_CHG_count}++; | |
| 4805 print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4806 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 4807 } | |
| 4808 elsif ($methylation_calls[$index] eq 'Z') { | |
| 4809 $counting{total_meCpG_count}++; | |
| 4810 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4811 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 4812 } | |
| 4813 elsif ($methylation_calls[$index] eq 'z') { | |
| 4814 $counting{total_unmethylated_CpG_count}++; | |
| 4815 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4816 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 4817 } | |
| 4818 elsif ($methylation_calls[$index] eq 'H') { | |
| 4819 $counting{total_meCHH_count}++; | |
| 4820 print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4821 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 4822 } | |
| 4823 elsif ($methylation_calls[$index] eq 'h') { | |
| 4824 $counting{total_unmethylated_CHH_count}++; | |
| 4825 print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4826 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 4827 } | |
| 4828 elsif ($methylation_calls[$index] eq '.') {} | |
| 4829 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 4830 else{ | |
| 4831 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 4832 } | |
| 4833 } | |
| 4834 } | |
| 4835 elsif ($strand eq '-') { | |
| 4836 | |
| 4837 for my $index (0..$#methylation_calls) { | |
| 4838 ### methylated Cs (any context) will receive a forward (+) orientation | |
| 4839 ### not methylated Cs (any context) will receive a reverse (-) orientation | |
| 4840 | |
| 4841 if ($cigar and @comp_cigar){ # only needed for SAM reads with Indels | |
| 4842 my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar); | |
| 4843 $cigar_offset += $cigar_mod; | |
| 4844 $pos_offset += $pos_mod; | |
| 4845 } | |
| 4846 | |
| 4847 if ($methylation_calls[$index] eq 'X') { | |
| 4848 $counting{total_meCHG_count}++; | |
| 4849 print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4850 $mbias_1{CHG}->{$index+1}->{meth}++; | |
| 4851 } | |
| 4852 elsif ($methylation_calls[$index] eq 'x') { | |
| 4853 $counting{total_unmethylated_CHG_count}++; | |
| 4854 print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4855 $mbias_1{CHG}->{$index+1}->{un}++; | |
| 4856 } | |
| 4857 elsif ($methylation_calls[$index] eq 'Z') { | |
| 4858 $counting{total_meCpG_count}++; | |
| 4859 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4860 $mbias_1{CpG}->{$index+1}->{meth}++; | |
| 4861 } | |
| 4862 elsif ($methylation_calls[$index] eq 'z') { | |
| 4863 $counting{total_unmethylated_CpG_count}++; | |
| 4864 print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4865 $mbias_1{CpG}->{$index+1}->{un}++; | |
| 4866 } | |
| 4867 elsif ($methylation_calls[$index] eq 'H') { | |
| 4868 $counting{total_meCHH_count}++; | |
| 4869 print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4870 $mbias_1{CHH}->{$index+1}->{meth}++; | |
| 4871 } | |
| 4872 elsif ($methylation_calls[$index] eq 'h') { | |
| 4873 $counting{total_unmethylated_CHH_count}++; | |
| 4874 print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only); | |
| 4875 $mbias_1{CHH}->{$index+1}->{un}++; | |
| 4876 } | |
| 4877 elsif ($methylation_calls[$index] eq '.') {} | |
| 4878 elsif (lc$methylation_calls[$index] eq 'u'){} | |
| 4879 else{ | |
| 4880 die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n"; | |
| 4881 } | |
| 4882 } | |
| 4883 } | |
| 4884 else { | |
| 4885 die "The strand information was neither + nor -: $strand\n"; | |
| 4886 } | |
| 4887 } | |
| 4888 } | |
| 4889 | |
| 4890 sub open_output_filehandles{ | |
| 4891 | |
| 4892 my $filename = shift; | |
| 4893 | |
| 4894 my $output_filename = (split (/\//,$filename))[-1]; | |
| 4895 my $report_filename = $output_filename; | |
| 4896 | |
| 4897 ### OPENING OUTPUT-FILEHANDLES | |
| 4898 if ($report) { | |
| 4899 $report_filename =~ s/\.sam$//; | |
| 4900 $report_filename =~ s/\.txt$//; | |
| 4901 $report_filename =~ s/$/_splitting_report.txt/; | |
| 4902 $report_filename = $output_dir . $report_filename; | |
| 4903 open (REPORT,'>',$report_filename) or die "Failed to write to file $report_filename $!\n"; | |
| 4904 } | |
| 4905 | |
| 4906 if ($report) { | |
| 4907 | |
| 4908 print REPORT "$output_filename\n\n"; | |
| 4909 print REPORT "Parameters used to extract methylation information:\n"; | |
| 4910 print REPORT "Bismark Extractor Version: $version\n"; | |
| 4911 | |
| 4912 if ($paired) { | |
| 4913 if ($vanilla) { | |
| 4914 print REPORT "Bismark result file: paired-end (vanilla Bismark format)\n"; | |
| 4915 } else { | |
| 4916 print REPORT "Bismark result file: paired-end (SAM format)\n"; # default | |
| 4917 } | |
| 4918 } | |
| 4919 | |
| 4920 if ($single) { | |
| 4921 if ($vanilla) { | |
| 4922 print REPORT "Bismark result file: single-end (vanilla Bismark format)\n"; | |
| 4923 } else { | |
| 4924 print REPORT "Bismark result file: single-end (SAM format)\n"; # default | |
| 4925 } | |
| 4926 } | |
| 4927 if ($single){ | |
| 4928 if ($ignore) { | |
| 4929 print REPORT "Ignoring first $ignore bp\n"; | |
| 4930 } | |
| 4931 if ($ignore_3prime) { | |
| 4932 print REPORT "Ignoring last $ignore_3prime bp\n"; | |
| 4933 } | |
| 4934 } | |
| 4935 else{ # paired-end | |
| 4936 if ($ignore) { | |
| 4937 print REPORT "Ignoring first $ignore bp of Read 1\n"; | |
| 4938 } | |
| 4939 if ($ignore_r2){ | |
| 4940 print REPORT "Ignoring first $ignore_r2 bp of Read 2\n"; | |
| 4941 } | |
| 4942 | |
| 4943 if ($ignore_3prime) { | |
| 4944 print REPORT "Ignoring last $ignore_3prime bp of Read 1\n"; | |
| 4945 } | |
| 4946 if ($ignore_3prime_r2){ | |
| 4947 print REPORT "Ignoring last $ignore_3prime_r2 bp of Read 2\n"; | |
| 4948 } | |
| 4949 | |
| 4950 } | |
| 4951 | |
| 4952 if ($full) { | |
| 4953 print REPORT "Output specified: comprehensive\n"; | |
| 4954 } else { | |
| 4955 print REPORT "Output specified: strand-specific (default)\n"; | |
| 4956 } | |
| 4957 | |
| 4958 if ($no_overlap) { | |
| 4959 print REPORT "No overlapping methylation calls specified\n"; | |
| 4960 } | |
| 4961 if ($genomic_fasta) { | |
| 4962 print REPORT "Genomic equivalent sequences will be printed out in FastA format\n"; | |
| 4963 } | |
| 4964 if ($merge_non_CpG) { | |
| 4965 print REPORT "Methylation in CHG and CHH context will be merged into \"non-CpG context\" output\n"; | |
| 4966 } | |
| 4967 | |
| 4968 print REPORT "\n"; | |
| 4969 } | |
| 4970 | |
| 4971 ##### open (OUT,"| gzip -c - > $output_dir$outfile") or die "Failed to write to $outfile: $!\n"; | |
| 4972 | |
| 4973 ### CpG-context and non-CpG context. THIS SECTION IS OPTIONAL | |
| 4974 ### if --comprehensive AND --merge_non_CpG was specified we are only writing out one CpG-context and one Any-Other-context result file | |
| 4975 if ($full and $merge_non_CpG) { | |
| 4976 my $cpg_output = my $other_c_output = $output_filename; | |
| 4977 ### C in CpG context | |
| 4978 $cpg_output =~ s/^/CpG_context_/; | |
| 4979 $cpg_output =~ s/sam$/txt/; | |
| 4980 $cpg_output =~ s/bam$/txt/; | |
| 4981 $cpg_output =~ s/$/.txt/ unless ($cpg_output =~ /\.txt$/); | |
| 4982 $cpg_output = $output_dir . $cpg_output; | |
| 4983 | |
| 4984 if ($gzip){ | |
| 4985 $cpg_output .= '.gz'; | |
| 4986 open ($fhs{CpG_context},"| gzip -c - > $cpg_output") or die "Failed to write to $cpg_output $! \n" unless($mbias_only); | |
| 4987 } | |
| 4988 else{ ### disclaimer: I am aware of "The Useless Use of Cat Awards", but I saw no other option... | |
| 4989 open ($fhs{CpG_context},"| cat > $cpg_output") or die "Failed to write to $cpg_output $! \n" unless($mbias_only); | |
| 4990 # open ($fhs{CpG_context},'>',$cpg_output) or die "Failed to write to $cpg_output $! \n" unless($mbias_only); | |
| 4991 } | |
| 4992 | |
| 4993 warn "Writing result file containing methylation information for C in CpG context to $cpg_output\n" unless($mbias_only); | |
| 4994 push @sorting_files,$cpg_output; | |
| 4995 | |
| 4996 unless ($no_header) { | |
| 4997 print {$fhs{CpG_context}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 4998 } | |
| 4999 | |
| 5000 ### C in any other context than CpG | |
| 5001 $other_c_output =~ s/^/Non_CpG_context_/; | |
| 5002 $other_c_output =~ s/sam$/txt/; | |
| 5003 $other_c_output =~ s/bam$/txt/; | |
| 5004 $other_c_output =~ s/$/.txt/ unless ($other_c_output =~ /\.txt$/); | |
| 5005 $other_c_output = $output_dir . $other_c_output; | |
| 5006 | |
| 5007 if ($gzip){ | |
| 5008 $other_c_output .= '.gz'; | |
| 5009 open ($fhs{other_context},"| gzip -c - > $other_c_output") or die "Failed to write to $other_c_output $! \n" unless($mbias_only); | |
| 5010 } | |
| 5011 else{ | |
| 5012 open ($fhs{other_context},"| cat > $other_c_output") or die "Failed to write to $other_c_output $!\n" unless($mbias_only); | |
| 5013 # open ($fhs{other_context},'>',$other_c_output) or die "Failed to write to $other_c_output $!\n" unless($mbias_only); | |
| 5014 } | |
| 5015 | |
| 5016 warn "Writing result file containing methylation information for C in any other context to $other_c_output\n" unless($mbias_only); | |
| 5017 push @sorting_files,$other_c_output; | |
| 5018 | |
| 5019 | |
| 5020 unless ($no_header) { | |
| 5021 print {$fhs{other_context}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5022 } | |
| 5023 } | |
| 5024 | |
| 5025 ### if only --merge_non_CpG was specified we will write out 8 different output files, depending on where the (first) unique best alignment has been found | |
| 5026 elsif ($merge_non_CpG) { | |
| 5027 | |
| 5028 my $cpg_ot = my $cpg_ctot = my $cpg_ctob = my $cpg_ob = $output_filename; | |
| 5029 | |
| 5030 ### For cytosines in CpG context | |
| 5031 $cpg_ot =~ s/^/CpG_OT_/; | |
| 5032 $cpg_ot =~ s/sam$/txt/; | |
| 5033 $cpg_ot =~ s/bam$/txt/; | |
| 5034 $cpg_ot =~ s/$/.txt/ unless ($cpg_ot =~ /\.txt$/); | |
| 5035 $cpg_ot = $output_dir . $cpg_ot; | |
| 5036 | |
| 5037 if ($gzip){ | |
| 5038 $cpg_ot .= '.gz'; | |
| 5039 open ($fhs{0}->{CpG},"| gzip -c - > $cpg_ot") or die "Failed to write to $cpg_ot $!\n" unless($mbias_only); | |
| 5040 } | |
| 5041 else{ | |
| 5042 open ($fhs{0}->{CpG},"| cat > $cpg_ot") or die "Failed to write to $cpg_ot $!\n" unless($mbias_only); | |
| 5043 # open ($fhs{0}->{CpG},'>',$cpg_ot) or die "Failed to write to $cpg_ot $!\n" unless($mbias_only); | |
| 5044 } | |
| 5045 | |
| 5046 warn "Writing result file containing methylation information for C in CpG context from the original top strand to $cpg_ot\n" unless($mbias_only); | |
| 5047 push @sorting_files,$cpg_ot; | |
| 5048 | |
| 5049 unless($no_header){ | |
| 5050 print {$fhs{0}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5051 } | |
| 5052 | |
| 5053 $cpg_ctot =~ s/^/CpG_CTOT_/; | |
| 5054 $cpg_ctot =~ s/sam$/txt/; | |
| 5055 $cpg_ctot =~ s/bam$/txt/; | |
| 5056 $cpg_ctot =~ s/$/.txt/ unless ($cpg_ctot =~ /\.txt$/); | |
| 5057 $cpg_ctot = $output_dir . $cpg_ctot; | |
| 5058 | |
| 5059 if ($gzip){ | |
| 5060 $cpg_ctot .= '.gz'; | |
| 5061 open ($fhs{1}->{CpG},"| gzip -c - > $cpg_ctot") or die "Failed to write to $cpg_ctot $!\n" unless($mbias_only); | |
| 5062 } | |
| 5063 else{ | |
| 5064 open ($fhs{1}->{CpG},"| cat > $cpg_ctot") or die "Failed to write to $cpg_ctot $!\n" unless($mbias_only); | |
| 5065 # open ($fhs{1}->{CpG},'>',$cpg_ctot) or die "Failed to write to $cpg_ctot $!\n" unless($mbias_only); | |
| 5066 } | |
| 5067 | |
| 5068 warn "Writing result file containing methylation information for C in CpG context from the complementary to original top strand to $cpg_ctot\n" unless($mbias_only); | |
| 5069 push @sorting_files,$cpg_ctot; | |
| 5070 | |
| 5071 unless($no_header){ | |
| 5072 print {$fhs{1}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5073 } | |
| 5074 | |
| 5075 $cpg_ctob =~ s/^/CpG_CTOB_/; | |
| 5076 $cpg_ctob =~ s/sam$/txt/; | |
| 5077 $cpg_ctob =~ s/bam$/txt/; | |
| 5078 $cpg_ctob =~ s/$/.txt/ unless ($cpg_ctob =~ /\.txt$/); | |
| 5079 $cpg_ctob = $output_dir . $cpg_ctob; | |
| 5080 | |
| 5081 if ($gzip){ | |
| 5082 $cpg_ctob .= '.gz'; | |
| 5083 open ($fhs{2}->{CpG},"| gzip -c - > $cpg_ctob") or die "Failed to write to $cpg_ctob $!\n" unless($mbias_only); | |
| 5084 } | |
| 5085 else{ | |
| 5086 open ($fhs{2}->{CpG},"| cat > $cpg_ctob") or die "Failed to write to $cpg_ctob $!\n" unless($mbias_only); | |
| 5087 # open ($fhs{2}->{CpG},'>',$cpg_ctob) or die "Failed to write to $cpg_ctob $!\n" unless($mbias_only); | |
| 5088 } | |
| 5089 | |
| 5090 warn "Writing result file containing methylation information for C in CpG context from the complementary to original bottom strand to $cpg_ctob\n" unless($mbias_only); | |
| 5091 push @sorting_files,$cpg_ctob; | |
| 5092 | |
| 5093 unless($no_header){ | |
| 5094 print {$fhs{2}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5095 } | |
| 5096 | |
| 5097 $cpg_ob =~ s/^/CpG_OB_/; | |
| 5098 $cpg_ob =~ s/sam$/txt/; | |
| 5099 $cpg_ob =~ s/bam$/txt/; | |
| 5100 $cpg_ob =~ s/$/.txt/ unless ($cpg_ob =~ /\.txt$/); | |
| 5101 $cpg_ob = $output_dir . $cpg_ob; | |
| 5102 | |
| 5103 if ($gzip){ | |
| 5104 $cpg_ob .= '.gz'; | |
| 5105 open ($fhs{3}->{CpG},"| gzip -c - > $cpg_ob") or die "Failed to write to $cpg_ob $!\n" unless($mbias_only); | |
| 5106 } | |
| 5107 else{ | |
| 5108 open ($fhs{3}->{CpG},"| cat > $cpg_ob") or die "Failed to write to $cpg_ob $!\n" unless($mbias_only); | |
| 5109 # open ($fhs{3}->{CpG},'>',$cpg_ob) or die "Failed to write to $cpg_ob $!\n" unless($mbias_only); | |
| 5110 } | |
| 5111 | |
| 5112 warn "Writing result file containing methylation information for C in CpG context from the original bottom strand to $cpg_ob\n\n" unless($mbias_only); | |
| 5113 push @sorting_files,$cpg_ob; | |
| 5114 | |
| 5115 unless($no_header){ | |
| 5116 print {$fhs{3}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5117 } | |
| 5118 | |
| 5119 ### For cytosines in Non-CpG (CC, CT or CA) context | |
| 5120 my $other_c_ot = my $other_c_ctot = my $other_c_ctob = my $other_c_ob = $output_filename; | |
| 5121 | |
| 5122 $other_c_ot =~ s/^/Non_CpG_OT_/; | |
| 5123 $other_c_ot =~ s/sam$/txt/; | |
| 5124 $other_c_ot =~ s/bam$/txt/; | |
| 5125 $other_c_ot =~ s/$/.txt/ unless ($other_c_ot =~ /\.txt$/); | |
| 5126 $other_c_ot = $output_dir . $other_c_ot; | |
| 5127 | |
| 5128 if ($gzip){ | |
| 5129 $other_c_ot .= '.gz'; | |
| 5130 open ($fhs{0}->{other_c},"| gzip -c - > $other_c_ot") or die "Failed to write to $other_c_ot $!\n" unless($mbias_only); | |
| 5131 } | |
| 5132 else{ | |
| 5133 open ($fhs{0}->{other_c},"| cat > $other_c_ot") or die "Failed to write to $other_c_ot $!\n" unless($mbias_only); | |
| 5134 # open ($fhs{0}->{other_c},'>',$other_c_ot) or die "Failed to write to $other_c_ot $!\n" unless($mbias_only); | |
| 5135 } | |
| 5136 | |
| 5137 warn "Writing result file containing methylation information for C in any other context from the original top strand to $other_c_ot\n" unless($mbias_only); | |
| 5138 push @sorting_files,$other_c_ot; | |
| 5139 | |
| 5140 unless($no_header){ | |
| 5141 print {$fhs{0}->{other_c}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5142 } | |
| 5143 | |
| 5144 $other_c_ctot =~ s/^/Non_CpG_CTOT_/; | |
| 5145 $other_c_ctot =~ s/sam$/txt/; | |
| 5146 $other_c_ctot =~ s/bam$/txt/; | |
| 5147 $other_c_ctot =~ s/$/.txt/ unless ($other_c_ctot =~ /\.txt$/); | |
| 5148 $other_c_ctot = $output_dir . $other_c_ctot; | |
| 5149 | |
| 5150 if ($gzip){ | |
| 5151 $other_c_ctot .= '.gz'; | |
| 5152 open ($fhs{1}->{other_c},"| gzip -c - > $other_c_ctot") or die "Failed to write to $other_c_ctot $!\n" unless($mbias_only); | |
| 5153 } | |
| 5154 else{ | |
| 5155 open ($fhs{1}->{other_c},"| cat > $other_c_ctot") or die "Failed to write to $other_c_ctot $!\n" unless($mbias_only); | |
| 5156 # open ($fhs{1}->{other_c},'>',$other_c_ctot) or die "Failed to write to $other_c_ctot $!\n" unless($mbias_only); | |
| 5157 } | |
| 5158 | |
| 5159 warn "Writing result file containing methylation information for C in any other context from the complementary to original top strand to $other_c_ctot\n" unless($mbias_only); | |
| 5160 push @sorting_files,$other_c_ctot; | |
| 5161 | |
| 5162 unless($no_header){ | |
| 5163 print {$fhs{1}->{other_c}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5164 } | |
| 5165 | |
| 5166 $other_c_ctob =~ s/^/Non_CpG_CTOB_/; | |
| 5167 $other_c_ctob =~ s/sam$/txt/; | |
| 5168 $other_c_ctob =~ s/bam$/txt/; | |
| 5169 $other_c_ctob =~ s/$/.txt/ unless ($other_c_ctob =~ /\.txt$/); | |
| 5170 $other_c_ctob = $output_dir . $other_c_ctob; | |
| 5171 | |
| 5172 if ($gzip){ | |
| 5173 $other_c_ctob .= '.gz'; | |
| 5174 open ($fhs{2}->{other_c},"| gzip -c - > $other_c_ctob") or die "Failed to write to $other_c_ctob $!\n" unless($mbias_only); | |
| 5175 } | |
| 5176 else{ | |
| 5177 open ($fhs{2}->{other_c},"| cat > $other_c_ctob") or die "Failed to write to $other_c_ctob $!\n" unless($mbias_only); | |
| 5178 # open ($fhs{2}->{other_c},'>',$other_c_ctob) or die "Failed to write to $other_c_ctob $!\n" unless($mbias_only); | |
| 5179 } | |
| 5180 | |
| 5181 warn "Writing result file containing methylation information for C in any other context from the complementary to original bottom strand to $other_c_ctob\n" unless($mbias_only); | |
| 5182 push @sorting_files,$other_c_ctob; | |
| 5183 | |
| 5184 unless($no_header){ | |
| 5185 print {$fhs{2}->{other_c}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5186 } | |
| 5187 | |
| 5188 $other_c_ob =~ s/^/Non_CpG_OB_/; | |
| 5189 $other_c_ob =~ s/sam$/txt/; | |
| 5190 $other_c_ob =~ s/sam$/txt/; | |
| 5191 $other_c_ob =~ s/$/.txt/ unless ($other_c_ob =~ /\.txt$/); | |
| 5192 $other_c_ob = $output_dir . $other_c_ob; | |
| 5193 | |
| 5194 if ($gzip){ | |
| 5195 $other_c_ob .= '.gz'; | |
| 5196 open ($fhs{3}->{other_c},"| gzip -c - > $other_c_ob") or die "Failed to write to $other_c_ob $!\n" unless($mbias_only); | |
| 5197 } | |
| 5198 else{ | |
| 5199 open ($fhs{3}->{other_c},"| cat > $other_c_ob") or die "Failed to write to $other_c_ob $!\n" unless($mbias_only); | |
| 5200 # open ($fhs{3}->{other_c},'>',$other_c_ob) or die "Failed to write to $other_c_ob $!\n" unless($mbias_only); | |
| 5201 } | |
| 5202 | |
| 5203 warn "Writing result file containing methylation information for C in any other context from the original bottom strand to $other_c_ob\n\n" unless($mbias_only); | |
| 5204 push @sorting_files,$other_c_ob; | |
| 5205 | |
| 5206 unless($no_header){ | |
| 5207 print {$fhs{3}->{other_c}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5208 } | |
| 5209 } | |
| 5210 ### THIS SECTION IS THE DEFAULT (CpG, CHG and CHH context) | |
| 5211 | |
| 5212 ### if --comprehensive was specified we are only writing one file per context | |
| 5213 elsif ($full) { | |
| 5214 my $cpg_output = my $chg_output = my $chh_output = $output_filename; | |
| 5215 ### C in CpG context | |
| 5216 $cpg_output =~ s/^/CpG_context_/; | |
| 5217 $cpg_output =~ s/sam$/txt/; | |
| 5218 $cpg_output =~ s/bam$/txt/; | |
| 5219 $cpg_output =~ s/$/.txt/ unless ($cpg_output =~ /\.txt$/); | |
| 5220 $cpg_output = $output_dir . $cpg_output; | |
| 5221 | |
| 5222 if ($gzip){ | |
| 5223 $cpg_output .= '.gz'; | |
| 5224 open ($fhs{CpG_context},"| gzip -c - > $cpg_output") or die "Failed to write to $cpg_output $! \n" unless($mbias_only); | |
| 5225 } | |
| 5226 else{ | |
| 5227 open ($fhs{CpG_context},"| cat > $cpg_output") or die "Failed to write to $cpg_output $! \n" unless($mbias_only); | |
| 5228 # open ($fhs{CpG_context},'>',$cpg_output) or die "Failed to write to $cpg_output $! \n" unless($mbias_only); | |
| 5229 } | |
| 5230 | |
| 5231 warn "Writing result file containing methylation information for C in CpG context to $cpg_output\n" unless($mbias_only); | |
| 5232 push @sorting_files,$cpg_output; | |
| 5233 | |
| 5234 unless($no_header){ | |
| 5235 print {$fhs{CpG_context}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5236 } | |
| 5237 | |
| 5238 ### C in CHG context | |
| 5239 $chg_output =~ s/^/CHG_context_/; | |
| 5240 $chg_output =~ s/sam$/txt/; | |
| 5241 $chg_output =~ s/bam$/txt/; | |
| 5242 $chg_output =~ s/$/.txt/ unless ($chg_output =~ /\.txt$/); | |
| 5243 $chg_output = $output_dir . $chg_output; | |
| 5244 | |
| 5245 if ($gzip){ | |
| 5246 $chg_output .= '.gz'; | |
| 5247 open ($fhs{CHG_context},"| gzip -c - > $chg_output") or die "Failed to write to $chg_output $!\n" unless($mbias_only); | |
| 5248 } | |
| 5249 else{ | |
| 5250 open ($fhs{CHG_context},"| cat > $chg_output") or die "Failed to write to $chg_output $!\n" unless($mbias_only); | |
| 5251 # open ($fhs{CHG_context},'>',$chg_output) or die "Failed to write to $chg_output $!\n" unless($mbias_only); | |
| 5252 } | |
| 5253 | |
| 5254 warn "Writing result file containing methylation information for C in CHG context to $chg_output\n" unless($mbias_only); | |
| 5255 push @sorting_files,$chg_output; | |
| 5256 | |
| 5257 unless($no_header){ | |
| 5258 print {$fhs{CHG_context}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5259 } | |
| 5260 | |
| 5261 ### C in CHH context | |
| 5262 $chh_output =~ s/^/CHH_context_/; | |
| 5263 $chh_output =~ s/sam$/txt/; | |
| 5264 $chh_output =~ s/bam$/txt/; | |
| 5265 $chh_output =~ s/$/.txt/ unless ($chh_output =~ /\.txt$/); | |
| 5266 $chh_output = $output_dir . $chh_output; | |
| 5267 | |
| 5268 if ($gzip){ | |
| 5269 $chh_output .= '.gz'; | |
| 5270 open ($fhs{CHH_context},"| gzip -c - > $chh_output") or die "Failed to write to $chh_output $!\n" unless($mbias_only); | |
| 5271 } | |
| 5272 else{ | |
| 5273 open ($fhs{CHH_context},"| cat > $chh_output") or die "Failed to write to $chh_output $!\n" unless($mbias_only); | |
| 5274 # open ($fhs{CHH_context},'>',$chh_output) or die "Failed to write to $chh_output $!\n" unless($mbias_only); | |
| 5275 } | |
| 5276 | |
| 5277 warn "Writing result file containing methylation information for C in CHH context to $chh_output\n" unless($mbias_only); | |
| 5278 push @sorting_files, $chh_output; | |
| 5279 | |
| 5280 unless($no_header){ | |
| 5281 print {$fhs{CHH_context}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5282 } | |
| 5283 } | |
| 5284 ### else we will write out 12 different output files, depending on where the (first) unique best alignment was found | |
| 5285 else { | |
| 5286 my $cpg_ot = my $cpg_ctot = my $cpg_ctob = my $cpg_ob = $output_filename; | |
| 5287 | |
| 5288 ### For cytosines in CpG context | |
| 5289 $cpg_ot =~ s/^/CpG_OT_/; | |
| 5290 $cpg_ot =~ s/sam$/txt/; | |
| 5291 $cpg_ot =~ s/bam$/txt/; | |
| 5292 $cpg_ot =~ s/$/.txt/ unless ($cpg_ot =~ /\.txt$/); | |
| 5293 $cpg_ot = $output_dir . $cpg_ot; | |
| 5294 | |
| 5295 if ($gzip){ | |
| 5296 $cpg_ot .= '.gz'; | |
| 5297 open ($fhs{0}->{CpG},"| gzip -c - > $cpg_ot") or die "Failed to write to $cpg_ot $!\n" unless($mbias_only); | |
| 5298 } | |
| 5299 else{ | |
| 5300 open ($fhs{0}->{CpG},"| cat > $cpg_ot") or die "Failed to write to $cpg_ot $!\n" unless($mbias_only); | |
| 5301 # open ($fhs{0}->{CpG},'>',$cpg_ot) or die "Failed to write to $cpg_ot $!\n" unless($mbias_only); | |
| 5302 } | |
| 5303 | |
| 5304 warn "Writing result file containing methylation information for C in CpG context from the original top strand to $cpg_ot\n" unless($mbias_only); | |
| 5305 push @sorting_files,$cpg_ot; | |
| 5306 | |
| 5307 unless($no_header){ | |
| 5308 print {$fhs{0}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5309 } | |
| 5310 | |
| 5311 $cpg_ctot =~ s/^/CpG_CTOT_/; | |
| 5312 $cpg_ctot =~ s/sam$/txt/; | |
| 5313 $cpg_ctot =~ s/bam$/txt/; | |
| 5314 $cpg_ctot =~ s/$/.txt/ unless ($cpg_ctot =~ /\.txt$/); | |
| 5315 $cpg_ctot = $output_dir . $cpg_ctot; | |
| 5316 | |
| 5317 if ($gzip){ | |
| 5318 $cpg_ctot .= '.gz'; | |
| 5319 open ($fhs{1}->{CpG},"| gzip -c - > $cpg_ctot") or die "Failed to write to $cpg_ctot $!\n" unless($mbias_only); | |
| 5320 } | |
| 5321 else{ | |
| 5322 open ($fhs{1}->{CpG},"| cat > $cpg_ctot") or die "Failed to write to $cpg_ctot $!\n" unless($mbias_only); | |
| 5323 # open ($fhs{1}->{CpG},'>',$cpg_ctot) or die "Failed to write to $cpg_ctot $!\n" unless($mbias_only); | |
| 5324 } | |
| 5325 | |
| 5326 warn "Writing result file containing methylation information for C in CpG context from the complementary to original top strand to $cpg_ctot\n" unless($mbias_only); | |
| 5327 push @sorting_files,$cpg_ctot; | |
| 5328 | |
| 5329 unless($no_header){ | |
| 5330 print {$fhs{1}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5331 } | |
| 5332 | |
| 5333 $cpg_ctob =~ s/^/CpG_CTOB_/; | |
| 5334 $cpg_ctob =~ s/sam$/txt/; | |
| 5335 $cpg_ctob =~ s/bam$/txt/; | |
| 5336 $cpg_ctob =~ s/$/.txt/ unless ($cpg_ctob =~ /\.txt$/); | |
| 5337 $cpg_ctob = $output_dir . $cpg_ctob; | |
| 5338 | |
| 5339 if ($gzip){ | |
| 5340 $cpg_ctob .= '.gz'; | |
| 5341 open ($fhs{2}->{CpG},"| gzip -c - > $cpg_ctob") or die "Failed to write to $cpg_ctob $!\n" unless($mbias_only); | |
| 5342 } | |
| 5343 else{ | |
| 5344 open ($fhs{2}->{CpG},"| cat > $cpg_ctob") or die "Failed to write to $cpg_ctob $!\n" unless($mbias_only); | |
| 5345 # open ($fhs{2}->{CpG},'>',$cpg_ctob) or die "Failed to write to $cpg_ctob $!\n" unless($mbias_only); | |
| 5346 } | |
| 5347 | |
| 5348 warn "Writing result file containing methylation information for C in CpG context from the complementary to original bottom strand to $cpg_ctob\n" unless($mbias_only); | |
| 5349 push @sorting_files,$cpg_ctob; | |
| 5350 | |
| 5351 unless($no_header){ | |
| 5352 print {$fhs{2}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5353 } | |
| 5354 | |
| 5355 $cpg_ob =~ s/^/CpG_OB_/; | |
| 5356 $cpg_ob =~ s/sam$/txt/; | |
| 5357 $cpg_ob =~ s/bam$/txt/; | |
| 5358 $cpg_ob =~ s/$/.txt/ unless ($cpg_ob =~ /\.txt$/); | |
| 5359 $cpg_ob = $output_dir . $cpg_ob; | |
| 5360 | |
| 5361 if ($gzip){ | |
| 5362 $cpg_ob .= '.gz'; | |
| 5363 open ($fhs{3}->{CpG},"| gzip -c - > $cpg_ob") or die "Failed to write to $cpg_ob $!\n" unless($mbias_only); | |
| 5364 } | |
| 5365 else{ | |
| 5366 open ($fhs{3}->{CpG},"| cat > $cpg_ob") or die "Failed to write to $cpg_ob $!\n" unless($mbias_only); | |
| 5367 # open ($fhs{3}->{CpG},'>',$cpg_ob) or die "Failed to write to $cpg_ob $!\n" unless($mbias_only); | |
| 5368 } | |
| 5369 | |
| 5370 warn "Writing result file containing methylation information for C in CpG context from the original bottom strand to $cpg_ob\n\n" unless($mbias_only); | |
| 5371 push @sorting_files,$cpg_ob; | |
| 5372 | |
| 5373 unless($no_header){ | |
| 5374 print {$fhs{3}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5375 } | |
| 5376 | |
| 5377 ### For cytosines in CHG context | |
| 5378 my $chg_ot = my $chg_ctot = my $chg_ctob = my $chg_ob = $output_filename; | |
| 5379 | |
| 5380 $chg_ot =~ s/^/CHG_OT_/; | |
| 5381 $chg_ot =~ s/sam$/txt/; | |
| 5382 $chg_ot =~ s/bam$/txt/; | |
| 5383 $chg_ot =~ s/$/.txt/ unless ($chg_ot =~ /\.txt$/); | |
| 5384 $chg_ot = $output_dir . $chg_ot; | |
| 5385 | |
| 5386 if ($gzip){ | |
| 5387 $chg_ot .= '.gz'; | |
| 5388 open ($fhs{0}->{CHG},"| gzip -c - > $chg_ot") or die "Failed to write to $chg_ot $!\n" unless($mbias_only); | |
| 5389 } | |
| 5390 else{ | |
| 5391 open ($fhs{0}->{CHG},"| cat > $chg_ot") or die "Failed to write to $chg_ot $!\n" unless($mbias_only); | |
| 5392 # open ($fhs{0}->{CHG},'>',$chg_ot) or die "Failed to write to $chg_ot $!\n" unless($mbias_only); | |
| 5393 } | |
| 5394 | |
| 5395 warn "Writing result file containing methylation information for C in CHG context from the original top strand to $chg_ot\n" unless($mbias_only); | |
| 5396 push @sorting_files,$chg_ot; | |
| 5397 | |
| 5398 unless($no_header){ | |
| 5399 print {$fhs{0}->{CHG}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5400 } | |
| 5401 | |
| 5402 $chg_ctot =~ s/^/CHG_CTOT_/; | |
| 5403 $chg_ctot =~ s/sam$/txt/; | |
| 5404 $chg_ctot =~ s/bam$/txt/; | |
| 5405 $chg_ctot =~ s/$/.txt/ unless ($chg_ctot =~ /\.txt$/); | |
| 5406 $chg_ctot = $output_dir . $chg_ctot; | |
| 5407 | |
| 5408 if ($gzip){ | |
| 5409 $chg_ctot .= '.gz'; | |
| 5410 open ($fhs{1}->{CHG},"| gzip -c - > $chg_ctot") or die "Failed to write to $chg_ctot $!\n" unless($mbias_only); | |
| 5411 } | |
| 5412 else{ | |
| 5413 open ($fhs{1}->{CHG},"| cat > $chg_ctot") or die "Failed to write to $chg_ctot $!\n" unless($mbias_only); | |
| 5414 # open ($fhs{1}->{CHG},'>',$chg_ctot) or die "Failed to write to $chg_ctot $!\n" unless($mbias_only); | |
| 5415 } | |
| 5416 | |
| 5417 warn "Writing result file containing methylation information for C in CHG context from the complementary to original top strand to $chg_ctot\n" unless($mbias_only); | |
| 5418 push @sorting_files,$chg_ctot; | |
| 5419 | |
| 5420 unless($no_header){ | |
| 5421 print {$fhs{1}->{CHG}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5422 } | |
| 5423 | |
| 5424 $chg_ctob =~ s/^/CHG_CTOB_/; | |
| 5425 $chg_ctob =~ s/sam$/txt/; | |
| 5426 $chg_ctob =~ s/bam$/txt/; | |
| 5427 $chg_ctob =~ s/$/.txt/ unless ($chg_ctob =~ /\.txt$/); | |
| 5428 $chg_ctob = $output_dir . $chg_ctob; | |
| 5429 | |
| 5430 if ($gzip){ | |
| 5431 $chg_ctob .= '.gz'; | |
| 5432 open ($fhs{2}->{CHG},"| gzip -c - > $chg_ctob") or die "Failed to write to $chg_ctob $!\n" unless($mbias_only); | |
| 5433 } | |
| 5434 else{ | |
| 5435 open ($fhs{2}->{CHG},"| cat > $chg_ctob") or die "Failed to write to $chg_ctob $!\n" unless($mbias_only); | |
| 5436 # open ($fhs{2}->{CHG},'>',$chg_ctob) or die "Failed to write to $chg_ctob $!\n" unless($mbias_only); | |
| 5437 } | |
| 5438 | |
| 5439 warn "Writing result file containing methylation information for C in CHG context from the complementary to original bottom strand to $chg_ctob\n" unless($mbias_only); | |
| 5440 push @sorting_files,$chg_ctob; | |
| 5441 | |
| 5442 unless($no_header){ | |
| 5443 print {$fhs{2}->{CHG}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5444 } | |
| 5445 | |
| 5446 $chg_ob =~ s/^/CHG_OB_/; | |
| 5447 $chg_ob =~ s/sam$/txt/; | |
| 5448 $chg_ob =~ s/bam$/txt/; | |
| 5449 $chg_ob =~ s/$/.txt/ unless ($chg_ob =~ /\.txt$/); | |
| 5450 $chg_ob = $output_dir . $chg_ob; | |
| 5451 | |
| 5452 if ($gzip){ | |
| 5453 $chg_ob .= '.gz'; | |
| 5454 open ($fhs{3}->{CHG},"| gzip -c - > $chg_ob") or die "Failed to write to $chg_ob $!\n" unless($mbias_only); | |
| 5455 } | |
| 5456 else{ | |
| 5457 open ($fhs{3}->{CHG},"| cat > $chg_ob") or die "Failed to write to $chg_ob $!\n" unless($mbias_only); | |
| 5458 # open ($fhs{3}->{CHG},'>',$chg_ob) or die "Failed to write to $chg_ob $!\n" unless($mbias_only); | |
| 5459 } | |
| 5460 | |
| 5461 warn "Writing result file containing methylation information for C in CHG context from the original bottom strand to $chg_ob\n\n" unless($mbias_only); | |
| 5462 push @sorting_files,$chg_ob; | |
| 5463 | |
| 5464 unless($no_header){ | |
| 5465 print {$fhs{3}->{CHG}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5466 } | |
| 5467 | |
| 5468 ### For cytosines in CHH context | |
| 5469 my $chh_ot = my $chh_ctot = my $chh_ctob = my $chh_ob = $output_filename; | |
| 5470 | |
| 5471 $chh_ot =~ s/^/CHH_OT_/; | |
| 5472 $chh_ot =~ s/sam$/txt/; | |
| 5473 $chh_ot =~ s/bam$/txt/; | |
| 5474 $chh_ot =~ s/$/.txt/ unless ($chh_ot =~ /\.txt$/); | |
| 5475 $chh_ot = $output_dir . $chh_ot; | |
| 5476 | |
| 5477 if ($gzip){ | |
| 5478 $chh_ot .= '.gz'; | |
| 5479 open ($fhs{0}->{CHH},"| gzip -c - > $chh_ot") or die "Failed to write to $chh_ot $!\n" unless($mbias_only); | |
| 5480 } | |
| 5481 else{ | |
| 5482 open ($fhs{0}->{CHH},"| cat > $chh_ot") or die "Failed to write to $chh_ot $!\n" unless($mbias_only); | |
| 5483 # open ($fhs{0}->{CHH},'>',$chh_ot) or die "Failed to write to $chh_ot $!\n" unless($mbias_only); | |
| 5484 } | |
| 5485 | |
| 5486 warn "Writing result file containing methylation information for C in CHH context from the original top strand to $chh_ot\n" unless($mbias_only); | |
| 5487 push @sorting_files,$chh_ot; | |
| 5488 | |
| 5489 unless($no_header){ | |
| 5490 print {$fhs{0}->{CHH}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5491 } | |
| 5492 | |
| 5493 $chh_ctot =~ s/^/CHH_CTOT_/; | |
| 5494 $chh_ctot =~ s/sam$/txt/; | |
| 5495 $chh_ctot =~ s/bam$/txt/; | |
| 5496 $chh_ctot =~ s/$/.txt/ unless ($chh_ctot =~ /\.txt$/); | |
| 5497 $chh_ctot = $output_dir . $chh_ctot; | |
| 5498 | |
| 5499 if ($gzip){ | |
| 5500 $chh_ctot .= '.gz'; | |
| 5501 open ($fhs{1}->{CHH},"| gzip -c - > $chh_ctot") or die "Failed to write to $chh_ctot $!\n" unless($mbias_only); | |
| 5502 } | |
| 5503 else{ | |
| 5504 open ($fhs{1}->{CHH},"| cat > $chh_ctot") or die "Failed to write to $chh_ctot $!\n" unless($mbias_only); | |
| 5505 # open ($fhs{1}->{CHH},'>',$chh_ctot) or die "Failed to write to $chh_ctot $!\n" unless($mbias_only); | |
| 5506 } | |
| 5507 | |
| 5508 warn "Writing result file containing methylation information for C in CHH context from the complementary to original top strand to $chh_ctot\n" unless($mbias_only); | |
| 5509 push @sorting_files,$chh_ctot; | |
| 5510 | |
| 5511 unless($no_header){ | |
| 5512 print {$fhs{1}->{CHH}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5513 } | |
| 5514 | |
| 5515 $chh_ctob =~ s/^/CHH_CTOB_/; | |
| 5516 $chh_ctob =~ s/sam$/txt/; | |
| 5517 $chh_ctob =~ s/bam$/txt/; | |
| 5518 $chh_ctob =~ s/$/.txt/ unless ($chh_ctob =~ /\.txt$/); | |
| 5519 $chh_ctob = $output_dir . $chh_ctob; | |
| 5520 | |
| 5521 if ($gzip){ | |
| 5522 $chh_ctob .= '.gz'; | |
| 5523 open ($fhs{2}->{CHH},"| gzip -c - > $chh_ctob") or die "Failed to write to $chh_ctob $!\n" unless($mbias_only); | |
| 5524 } | |
| 5525 else{ | |
| 5526 open ($fhs{2}->{CHH},"| cat > $chh_ctob") or die "Failed to write to $chh_ctob $!\n" unless($mbias_only); | |
| 5527 # open ($fhs{2}->{CHH},'>',$chh_ctob) or die "Failed to write to $chh_ctob $!\n" unless($mbias_only); | |
| 5528 } | |
| 5529 | |
| 5530 warn "Writing result file containing methylation information for C in CHH context from the complementary to original bottom strand to $chh_ctob\n" unless($mbias_only); | |
| 5531 push @sorting_files,$chh_ctob; | |
| 5532 | |
| 5533 unless($no_header){ | |
| 5534 print {$fhs{2}->{CHH}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5535 } | |
| 5536 | |
| 5537 $chh_ob =~ s/^/CHH_OB_/; | |
| 5538 $chh_ob =~ s/sam$/txt/; | |
| 5539 $chh_ob =~ s/bam$/txt/; | |
| 5540 $chh_ob =~ s/$/.txt/ unless ($chh_ob =~ /\.txt$/); | |
| 5541 $chh_ob = $output_dir . $chh_ob; | |
| 5542 | |
| 5543 if ($gzip){ | |
| 5544 $chh_ob .= '.gz'; | |
| 5545 open ($fhs{3}->{CHH},"| gzip -c - > $chh_ob") or die "Failed to write to $chh_ob $!\n" unless($mbias_only); | |
| 5546 } | |
| 5547 else{ | |
| 5548 open ($fhs{3}->{CHH},"| cat > $chh_ob") or die "Failed to write to $chh_ob $!\n" unless($mbias_only); | |
| 5549 # open ($fhs{3}->{CHH},'>',$chh_ob) or die "Failed to write to $chh_ob $!\n" unless($mbias_only); | |
| 5550 } | |
| 5551 | |
| 5552 warn "Writing result file containing methylation information for C in CHH context from the original bottom strand to $chh_ob\n\n" unless($mbias_only); | |
| 5553 push @sorting_files,$chh_ob; | |
| 5554 | |
| 5555 unless($no_header){ | |
| 5556 print {$fhs{3}->{CHH}} "Bismark methylation extractor version $version\n" unless($mbias_only); | |
| 5557 } | |
| 5558 } | |
| 5559 return $report_filename; | |
| 5560 } | |
| 5561 | |
| 5562 sub isBam{ | |
| 5563 | |
| 5564 my $filename = shift; | |
| 5565 | |
| 5566 # reading the first line of the input file to see if it is a BAM file in disguise (i.e. a BAM file that does not end in *.bam which may be produced by Galaxy) | |
| 5567 open (DISGUISE,"zcat $filename |") or die "Failed to open filehandle DISGUISE for $filename\n\n"; | |
| 5568 | |
| 5569 ### when BAM files read through a zcat stream they start with BAM... | |
| 5570 my $bam_in_disguise = <DISGUISE>; | |
| 5571 # warn "BAM in disguise: $bam_in_disguise\n\n"; | |
| 5572 | |
| 5573 if ($bam_in_disguise){ | |
| 5574 if ($bam_in_disguise =~ /^BAM/){ | |
| 5575 close (DISGUISE) or warn "Had trouble closing filehandle BAM in disguise: $!\n"; | |
| 5576 return 1; | |
| 5577 } | |
| 5578 else{ | |
| 5579 close (DISGUISE) or warn "Had trouble closing filehandle BAM in disguise: $!\n"; | |
| 5580 return 0; | |
| 5581 } | |
| 5582 } | |
| 5583 else{ | |
| 5584 close (DISGUISE) or warn "Had trouble closing filehandle BAM in disguise: $!\n"; | |
| 5585 return 0; | |
| 5586 } | |
| 5587 } | |
| 5588 | |
| 5589 | |
| 5590 sub print_helpfile{ | |
| 5591 | |
| 5592 print << 'HOW_TO'; | |
| 5593 | |
| 5594 | |
| 5595 DESCRIPTION | |
| 5596 | |
| 5597 The following is a brief description of all options to control the Bismark | |
| 5598 methylation extractor. The script reads in a bisulfite read alignment results file | |
| 5599 produced by the Bismark bisulfite mapper and extracts the methylation information | |
| 5600 for individual cytosines. This information is found in the methylation call field | |
| 5601 which can contain the following characters: | |
| 5602 | |
| 5603 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ | |
| 5604 ~~~ X for methylated C in CHG context ~~~ | |
| 5605 ~~~ x for not methylated C CHG ~~~ | |
| 5606 ~~~ H for methylated C in CHH context ~~~ | |
| 5607 ~~~ h for not methylated C in CHH context ~~~ | |
| 5608 ~~~ Z for methylated C in CpG context ~~~ | |
| 5609 ~~~ z for not methylated C in CpG context ~~~ | |
| 5610 ~~~ U for methylated C in Unknown context (CN or CHN ~~~ | |
| 5611 ~~~ u for not methylated C in Unknown context (CN or CHN) ~~~ | |
| 5612 ~~~ . for any bases not involving cytosines ~~~ | |
| 5613 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ | |
| 5614 | |
| 5615 The methylation extractor outputs result files for cytosines in CpG, CHG and CHH | |
| 5616 context (this distinction is actually already made in Bismark itself). As the methylation | |
| 5617 information for every C analysed can produce files which easily have tens or even hundreds of | |
| 5618 millions of lines, file sizes can become very large and more difficult to handle. The C | |
| 5619 methylation info additionally splits cytosine methylation calls up into one of the four possible | |
| 5620 strands a given bisulfite read aligned against: | |
| 5621 | |
| 5622 OT original top strand | |
| 5623 CTOT complementary to original top strand | |
| 5624 | |
| 5625 OB original bottom strand | |
| 5626 CTOB complementary to original bottom strand | |
| 5627 | |
| 5628 Thus, by default twelve individual output files are being generated per input file (unless | |
| 5629 --comprehensive is specified, see below). The output files can be imported into a genome | |
| 5630 viewer, such as SeqMonk, and re-combined into a single data group if desired (in fact | |
| 5631 unless the bisulfite reads were generated preserving directionality it doesn't make any | |
| 5632 sense to look at the data in a strand-specific manner). Strand-specific output files can | |
| 5633 optionally be skipped, in which case only three output files for CpG, CHG or CHH context | |
| 5634 will be generated. For both the strand-specific and comprehensive outputs there is also | |
| 5635 the option to merge both non-CpG contexts (CHG and CHH) into one single non-CpG context. | |
| 5636 | |
| 5637 | |
| 5638 The output files are in the following format (tab delimited): | |
| 5639 | |
| 5640 <sequence_id> <strand> <chromosome> <position> <methylation call> | |
| 5641 | |
| 5642 | |
| 5643 USAGE: methylation_extractor [options] <filenames> | |
| 5644 | |
| 5645 | |
| 5646 ARGUMENTS: | |
| 5647 ========== | |
| 5648 | |
| 5649 <filenames> A space-separated list of Bismark result files in SAM format from | |
| 5650 which methylation information is extracted for every cytosine in | |
| 5651 the reads. For alignment files in the older custom Bismark output | |
| 5652 see option '--vanilla'. | |
| 5653 | |
| 5654 OPTIONS: | |
| 5655 | |
| 5656 -s/--single-end Input file(s) are Bismark result file(s) generated from single-end | |
| 5657 read data. Specifying either --single-end or --paired-end is | |
| 5658 mandatory. | |
| 5659 | |
| 5660 -p/--paired-end Input file(s) are Bismark result file(s) generated from paired-end | |
| 5661 read data. Specifying either --paired-end or --single-end is | |
| 5662 mandatory. | |
| 5663 | |
| 5664 --vanilla The Bismark result input file(s) are in the old custom Bismark format | |
| 5665 (up to version 0.5.x) and not in SAM format which is the default as | |
| 5666 of Bismark version 0.6.x or higher. Default: OFF. | |
| 5667 | |
| 5668 --no_overlap For paired-end reads it is theoretically possible that read_1 and | |
| 5669 read_2 overlap. This option avoids scoring overlapping methylation | |
| 5670 calls twice (only methylation calls of read 1 are used for in the process | |
| 5671 since read 1 has historically higher quality basecalls than read 2). | |
| 5672 Whilst this option removes a bias towards more methylation calls | |
| 5673 in the center of sequenced fragments it may de facto remove a sizable | |
| 5674 proportion of the data. This option is on by default for paired-end data | |
| 5675 but can be disabled using --include_overlap. Default: ON. | |
| 5676 | |
| 5677 --include_overlap For paired-end data all methylation calls will be extracted irrespective of | |
| 5678 of whether they overlap or not. Default: OFF. | |
| 5679 | |
| 5680 --ignore <int> Ignore the first <int> bp from the 5' end of Read 1 (or single-end alignment | |
| 5681 files) when processing the methylation call string. This can remove e.g. a | |
| 5682 restriction enzyme site at the start of each read or any other source of | |
| 5683 bias (such as PBAT-Seq data). | |
| 5684 | |
| 5685 --ignore_r2 <int> Ignore the first <int> bp from the 5' end of Read 2 of paired-end sequencing | |
| 5686 results only. Since the first couple of bases in Read 2 of BS-Seq experiments | |
| 5687 show a severe bias towards non-methylation as a result of end-repairing | |
| 5688 sonicated fragments with unmethylated cytosines (see M-bias plot), it is | |
| 5689 recommended that the first couple of bp of Read 2 are removed before | |
| 5690 starting downstream analysis. Please see the section on M-bias plots in the | |
| 5691 Bismark User Guide for more details. | |
| 5692 | |
| 5693 --ignore_3prime <int> Ignore the last <int> bp from the 3' end of Read 1 (or single-end alignment | |
| 5694 files) when processing the methylation call string. This can remove unwanted | |
| 5695 biases from the end of reads. | |
| 5696 | |
| 5697 --ignore_3prime_r2 <int> Ignore the last <int> bp from the 3' end of Read 2 of paired-end sequencing | |
| 5698 results only. This can remove unwanted biases from the end of reads. | |
| 5699 | |
| 5700 --comprehensive Specifying this option will merge all four possible strand-specific | |
| 5701 methylation info into context-dependent output files. The default | |
| 5702 | |
| 5703 contexts are: | |
| 5704 - CpG context | |
| 5705 - CHG context | |
| 5706 - CHH context | |
| 5707 | |
| 5708 --merge_non_CpG This will produce two output files (in --comprehensive mode) or eight | |
| 5709 strand-specific output files (default) for Cs in | |
| 5710 - CpG context | |
| 5711 - non-CpG context | |
| 5712 | |
| 5713 --report Prints out a short methylation summary as well as the paramaters used to run | |
| 5714 this script. Default: ON. | |
| 5715 | |
| 5716 --no_header Suppresses the Bismark version header line in all output files for more convenient | |
| 5717 batch processing. | |
| 5718 | |
| 5719 -o/--output DIR Allows specification of a different output directory (absolute or relative | |
| 5720 path). If not specified explicitely, the output will be written to the current directory. | |
| 5721 | |
| 5722 --samtools_path The path to your Samtools installation, e.g. /home/user/samtools/. Does not need to be specified | |
| 5723 explicitly if Samtools is in the PATH already. | |
| 5724 | |
| 5725 --gzip The methylation extractor files (CpG_OT_..., CpG_OB_... etc) will be written out in | |
| 5726 a GZIP compressed form to save disk space. This option does not work on bedGraph and | |
| 5727 genome-wide cytosine reports as they are 'tiny' anyway. | |
| 5728 | |
| 5729 --version Displays version information. | |
| 5730 | |
| 5731 -h/--help Displays this help file and exits. | |
| 5732 | |
| 5733 --mbias_only The methylation extractor will read the entire file but only output the M-bias table and plots as | |
| 5734 well as a report (optional) and then quit. Default: OFF. | |
| 5735 | |
| 5736 --mbias_off The methylation extractor will process the entire file as usual but doesn't write out any M-bias report. | |
| 5737 Only recommended for users who deliberately want to keep an earlier version of the M-bias report. | |
| 5738 Default: OFF. | |
| 5739 | |
| 5740 --multicore <int> Sets the number of cores to be used for the methylation extraction process. If system resources | |
| 5741 are plentiful this is a viable option to speed up the extraction process (we observed a near linear | |
| 5742 speed increase for up to 10 cores used). Please note that a typical process of extracting a BAM file | |
| 5743 and writing out '.gz' output streams will in fact use ~3 cores per value of --multicore <int> | |
| 5744 specified (1 for the methylation extractor itself, 1 for a Samtools stream, 1 for GZIP stream), so | |
| 5745 --multicore 10 is likely to use around 30 cores of system resources. This option has no bearing | |
| 5746 on the bismark2bedGraph or genome-wide cytosine report processes. | |
| 5747 | |
| 5748 | |
| 5749 | |
| 5750 | |
| 5751 bedGraph specific options: | |
| 5752 ========================== | |
| 5753 | |
| 5754 --bedGraph After finishing the methylation extraction, the methylation output is written into a | |
| 5755 sorted bedGraph file that reports the position of a given cytosine and its methylation | |
| 5756 state (in %, see details below). The methylation extractor output is temporarily split up into | |
| 5757 temporary files, one per chromosome (written into the current directory or folder | |
| 5758 specified with -o/--output); these temp files are then used for sorting and deleted | |
| 5759 afterwards. By default, only cytosines in CpG context will be sorted. The option | |
| 5760 '--CX_context' may be used to report all cytosines irrespective of sequence context | |
| 5761 (this will take MUCH longer!). The default folder for temporary files during the sorting | |
| 5762 process is the output directory. The bedGraph conversion step is performed by the external | |
| 5763 module 'bismark2bedGraph'; this script needs to reside in the same folder as the | |
| 5764 bismark_methylation_extractor itself. | |
| 5765 | |
| 5766 --zero_based Write out an additional coverage file (ending in .zero.cov) that uses 0-based genomic start | |
| 5767 and 1-based genomic end coordinates (zero-based, half-open), like used in the bedGraph file, | |
| 5768 instead of using 1-based coordinates throughout. Default: OFF. | |
| 5769 | |
| 5770 | |
| 5771 --cutoff [threshold] The minimum number of times a methylation state has to be seen for that nucleotide | |
| 5772 before its methylation percentage is reported. Default: 1. | |
| 5773 | |
| 5774 --remove_spaces Replaces whitespaces in the sequence ID field with underscores to allow sorting. | |
| 5775 | |
| 5776 --CX/--CX_context The sorted bedGraph output file contains information on every single cytosine that was covered | |
| 5777 in the experiment irrespective of its sequence context. This applies to both forward and | |
| 5778 reverse strands. Please be aware that this option may generate large temporary and output files | |
| 5779 and may take a long time to sort (up to many hours). Default: OFF. | |
| 5780 (i.e. Default = CpG context only). | |
| 5781 | |
| 5782 --buffer_size <string> This allows you to specify the main memory sort buffer when sorting the methylation information. | |
| 5783 Either specify a percentage of physical memory by appending % (e.g. --buffer_size 50%) or | |
| 5784 a multiple of 1024 bytes, e.g. 'K' multiplies by 1024, 'M' by 1048576 and so on for 'T' etc. | |
| 5785 (e.g. --buffer_size 20G). For more information on sort type 'info sort' on a command line. | |
| 5786 Defaults to 2G. | |
| 5787 | |
| 5788 --scaffolds/--gazillion Users working with unfinished genomes sporting tens or even hundreds of thousands of | |
| 5789 scaffolds/contigs/chromosomes frequently encountered errors with pre-sorting reads to | |
| 5790 individual chromosome files. These errors were caused by the operating system's limit | |
| 5791 of the number of filehandle that can be written to at any one time (typically 1024; to | |
| 5792 find out this limit on Linux, type: ulimit -a). | |
| 5793 To bypass the limitation of open filehandles, the option --scaffolds does not pre-sort | |
| 5794 methylation calls into individual chromosome files. Instead, all input files are | |
| 5795 temporarily merged into a single file (unless there is only a single file), and this | |
| 5796 file will then be sorted by both chromosome AND position using the Unix sort command. | |
| 5797 Please be aware that this option might take a looooong time to complete, depending on | |
| 5798 the size of the input files, and the memory you allocate to this process (see --buffer_size). | |
| 5799 Nevertheless, it seems to be working. | |
| 5800 | |
| 5801 --ample_memory Using this option will not sort chromosomal positions using the UNIX 'sort' command, but will | |
| 5802 instead use two arrays to sort methylated and unmethylated calls. This may result in a faster | |
| 5803 sorting process of very large files, but this comes at the cost of a larger memory footprint | |
| 5804 (two arrays of the length of the largest human chromosome 1 (~250M bp) consume around 16GB | |
| 5805 of RAM). Due to overheads in creating and looping through these arrays it seems that it will | |
| 5806 actually be *slower* for small files (few million alignments), and we are currently testing at | |
| 5807 which point it is advisable to use this option. Note that --ample_memory is not compatible | |
| 5808 with options '--scaffolds/--gazillion' (as it requires pre-sorted files to begin with). | |
| 5809 | |
| 5810 | |
| 5811 | |
| 5812 Genome-wide cytosine methylation report specific options: | |
| 5813 ========================================================= | |
| 5814 | |
| 5815 --cytosine_report After the conversion to bedGraph has completed, the option '--cytosine_report' produces a | |
| 5816 genome-wide methylation report for all cytosines in the genome. By default, the output uses 1-based | |
| 5817 chromosome coordinates (zero-based start coords are optional) and reports CpG context only (all | |
| 5818 cytosine context is optional). The output considers all Cs on both forward and reverse strands and | |
| 5819 reports their position, strand, trinucleotide content and methylation state (counts are 0 if not | |
| 5820 covered). The cytosine report conversion step is performed by the external module | |
| 5821 'coverage2cytosine'; this script needs to reside in the same folder as the bismark_methylation_extractor | |
| 5822 itself. | |
| 5823 | |
| 5824 --CX/--CX_context The output file contains information on every single cytosine in the genome irrespective of | |
| 5825 its context. This applies to both forward and reverse strands. Please be aware that this will | |
| 5826 generate output files with > 1.1 billion lines for a mammalian genome such as human or mouse. | |
| 5827 Default: OFF (i.e. Default = CpG context only). | |
| 5828 | |
| 5829 --zero_based Uses 0-based genomic coordinates instead of 1-based coordinates. Default: OFF. | |
| 5830 | |
| 5831 --genome_folder <path> Enter the genome folder you wish to use to extract sequences from (full path only). Accepted | |
| 5832 formats are FastA files ending with '.fa' or '.fasta'. Specifying a genome folder path is mandatory. | |
| 5833 | |
| 5834 --split_by_chromosome Writes the output into individual files for each chromosome instead of a single output file. Files | |
| 5835 will be named to include the input filename and the chromosome number. | |
| 5836 | |
| 5837 | |
| 5838 | |
| 5839 OUTPUT: | |
| 5840 | |
| 5841 The bismark_methylation_extractor output is in the form: | |
| 5842 ======================================================== | |
| 5843 <seq-ID> <methylation state*> <chromosome> <start position (= end position)> <methylation call> | |
| 5844 | |
| 5845 * Methylated cytosines receive a '+' orientation, | |
| 5846 * Unmethylated cytosines receive a '-' orientation. | |
| 5847 | |
| 5848 | |
| 5849 | |
| 5850 The bedGraph output (optional) looks like this (tab-delimited; 0-based start coords, 1-based end coords): | |
| 5851 ========================================================================================================= | |
| 5852 | |
| 5853 track type=bedGraph (header line) | |
| 5854 | |
| 5855 <chromosome> <start position> <end position> <methylation percentage> | |
| 5856 | |
| 5857 | |
| 5858 | |
| 5859 The coverage output looks like this (tab-delimited, 1-based genomic coords; zero-based half-open coordinates available with '--zero_based'): | |
| 5860 ============================================================================================================================================ | |
| 5861 | |
| 5862 <chromosome> <start position> <end position> <methylation percentage> <count methylated> <count non-methylated> | |
| 5863 | |
| 5864 | |
| 5865 | |
| 5866 The genome-wide cytosine methylation output file is tab-delimited in the following format: | |
| 5867 ========================================================================================== | |
| 5868 <chromosome> <position> <strand> <count methylated> <count non-methylated> <C-context> <trinucleotide context> | |
| 5869 | |
| 5870 | |
| 5871 | |
| 5872 This script was last modified on 22 April 2015. | |
| 5873 | |
| 5874 HOW_TO | |
| 5875 } |