Mercurial > repos > bgruening > canu

changeset 5:e05f5ee0ffb9 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/canu commit 0bc8bb039501406bc71e8faf9bb7ad0de44cbda9
author bgruening
date Thu, 31 Jul 2025 09:31:50 +0000
parents 86f150c8019d
children
files canu.xml test-data/ecoli_canu_contigs_result1.fa
diffstat 2 files changed, 20 insertions(+), 14 deletions(-) [+]
line wrap: on
line diff
--- a/canu.xml	Wed Nov 03 16:10:37 2021 +0000
+++ b/canu.xml	Thu Jul 31 09:31:50 2025 +0000
@@ -1,12 +1,12 @@
-<tool id="canu" name="Canu assembler" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@">
+<tool id="canu" name="Canu assembler" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="24.0">
     <description>Assembler optimized for long error-prone reads such as PacBio, Oxford Nanopore</description>
+    <macros>
+        <token name="@TOOL_VERSION@">2.3</token>
+        <token name="@VERSION_SUFFIX@">0</token>
+    </macros>
     <xrefs>
         <xref type="bio.tools">canu</xref>
     </xrefs>
-    <macros>
-        <token name="@TOOL_VERSION@">2.2</token>
-        <token name="@VERSION_SUFFIX@">0</token>
-    </macros>
     <requirements>
         <requirement type="package" version="@TOOL_VERSION@">canu</requirement>
     </requirements>
@@ -101,7 +101,14 @@
         <param name="inputs" type="data" format="fasta,fasta.gz,fastq,fastq.gz" multiple="true" label="Input reads"/>
         <repeat name="haplotypes" min="0" max="2" title="Haplotypes for Trio Binning Assembly" help="Canu has support for using parental short-read sequencing to classify and bin">
             <param name="haplotype_input" type="data" format="fasta,fastq" multiple="true" label="Haplotype input reads"/>
-            <param name="haplotype_name" type="text" label="Shot name to identify your haplotype"/>
+            <param name="haplotype_name" type="text" label="Shot name to identify your haplotype" help="Only letters, numbers and underscore are used">
+                <sanitizer invalid_char="">
+                    <valid initial="string.ascii_letters,string.digits">
+                        <add value="_" />
+                        <add value="." />
+                    </valid>
+                </sanitizer>
+            </param>
         </repeat>
         <param name="technology" type="select" label="Technology">
             <option value="-nanopore" selected="true">Nanopore</option>
@@ -169,7 +176,7 @@
             <output name="trimmed_reads" ftype="fasta.gz" decompress="True" file="ecoli_canu_trimmed_reads_result1.fa.gz"/>
             <output name="report">
                 <assert_contents>
-                    <has_n_lines n="486"/>
+                    <has_n_lines n="450" delta="50"/>
                     <has_text_matching expression="[UNITIGGING/CONTIGS]"/>
                     <has_text_matching expression="-- Contig sizes based on genome size 20kbp:"/>
                 </assert_contents>
@@ -192,7 +199,7 @@
             <output name="trimmed_reads" ftype="fasta.gz" decompress="True" file="ecoli_canu_trimmed_reads_result2.fa.gz"/>
             <output name="report">
                 <assert_contents>
-                    <has_n_lines n="456"/>
+                    <has_n_lines n="450" delta="50"/>
                     <has_text_matching expression="[UNITIGGING/CONTIGS]"/>
                     <has_text_matching expression="-- Contig sizes based on genome size 20kbp:"/>
                 </assert_contents>
@@ -208,7 +215,7 @@
             <output name="corrected_reads" ftype="fasta.gz" decompress="True" file="ecoli_canu_corrected_reads_result3.fa.gz"/>
             <output name="report">
                 <assert_contents>
-                    <has_n_lines n="189"/>
+                    <has_n_lines n="200" delta="50"/>
                     <has_text_matching expression="[TRIMMING/READS]"/>
                     <has_text_matching expression="--   Found 93 reads."/>
                 </assert_contents>
@@ -226,9 +233,9 @@
             <output name="report">
                 <assert_contents>
                     <has_text_matching expression="[TRIMMING/READS]"/>
-                    <has_n_lines n="209"/>
-		    <has_text_matching expression="Found 112 reads."/><!-- before trimming -->
-		    <has_text_matching expression="Found 61 reads."/><!-- after trimming -->
+                    <has_n_lines n="200" delta="50"/>
+		            <has_text_matching expression="Found 112 reads."/><!-- before trimming -->
+		            <has_text_matching expression="Found 61 reads."/><!-- after trimming -->
                 </assert_contents>
             </output>
         </test>
--- a/test-data/ecoli_canu_contigs_result1.fa	Wed Nov 03 16:10:37 2021 +0000
+++ b/test-data/ecoli_canu_contigs_result1.fa	Thu Jul 31 09:31:50 2025 +0000
@@ -1,4 +1,4 @@
->tig00000001 len=15501 reads=78 class=contig suggestRepeat=no suggestBubble=no suggestCircular=no trim=0-15501
+>tig00000001 len=15500 reads=78 class=contig suggestRepeat=no suggestBubble=no suggestCircular=no trim=0-15500
 TGAATCACGCGGGCGGCTAAATCGACGGTAACATCGGAAAATTTTACCAGCGGATCGGGCGCGGTGGTGGCAGAGTGGCGGCGTAATGCGACGCGCAGAC
 GGGCCTGCAATTCGCCATGCCAAACGGCTTACTCAGATAATCATCCGCTCCGGCATCCAGCGCGGCGATTTTGTCGCTCTTCTGCTGCGTGCGGAAAGCA
 ATCACCGGCACCGCGCTCCACTGGCGCAGGTCGCGGATAAACTCAATCCCATCACCATCGGGCAGGCCGAGATCGAGAATAATCAAATCTGGCTTACGGG
@@ -154,4 +154,3 @@
 GGGAAACATCTCGATTTTTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACCATTGCCAGAGTTGTATCAGGAAAGATCACGTAAC
 GCTACTTTTTGTACTAAATAATTCGCATTTTATGTTTAAAAATTGAGATATTCCTTATTACCTAAAGCTGTTTTTCATAGCTTATACATGATCAAATACT
 CCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTCTATTATTCCCGATTACAGATAAGCCTGGAAAGTAGAGCATAAATTG
-T