Mercurial > repos > bgruening > rnaz

comparison rnaz.xml @ 4:58fd61a8362e draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_team/rnaz commit d261ddb93500e1ea309845fa3989c87c6312583d-dirty
author bgruening
date Wed, 30 Jan 2019 04:13:28 -0500
parents 580ee1e91801
children
comparison
equal deleted inserted replaced
3:3c43015da1d8 4:58fd61a8362e
1 <tool id="rnaz" name="RNAz" version="2.1.1"> 1 <tool id="rnaz" name="RNAz" version="2.1.1">
2 <description>predicting structurally conserved and thermodynamically stable RNA secondary structures</description> 2 <description>predicting structurally conserved and thermodynamically stable RNA secondary structures</description>
3
4 <requirements> 3 <requirements>
5 <requirement type="package" version="2.1">rnaz</requirement> 4 <requirement type="package" version="2.1">rnaz</requirement>
6 </requirements> 5 </requirements>
7
8 <stdio> 6 <stdio>
9 <exit_code range="1:" level="fatal" description="Error occurred. Please check Tool Standard Error" /> 7 <exit_code range="1:" level="fatal" description="Error occurred. Please check Tool Standard Error" />
10 <exit_code range=":-1" level="fatal" description="Error occurred. Please check Tool Standard Error" /> 8 <exit_code range=":-1" level="fatal" description="Error occurred. Please check Tool Standard Error" />
11 </stdio> 9 </stdio>
12
13 <version_command>RNAz --version</version_command> 10 <version_command>RNAz --version</version_command>
14 <command> 11 <command><![CDATA[
15 <![CDATA[ 12 RNAz
16 RNAz '$input' 13 $forward_or_reverse
17 --$forward_or_reverse
18 $zscore 14 $zscore
19 $locarnate 15 $locarnate
20 $noshuffle 16 $noshuffle
21 #if $cutoff != -1.0: 17 #if $cutoff != -1.0:
22 --cutoff=$cutoff 18 --cutoff=$cutoff
23 #end if 19 #end if
24 > temp.txt && 20 '$input'
25 grep -v -E "^ |^#|^$" temp.txt > '$outfile' && 21 > '$output'
26 grep -E "^ |^#|^$" temp.txt 22 ]]>
27 ]]>
28 </command> 23 </command>
29 <inputs> 24 <inputs>
30 <param format="txt" name="input" type="data" label="Input Alignment File" /> 25 <param format="txt" name="input" type="data" label="Input Alignment File" />
31 <param name="forward_or_reverse" type="select" label="Scored strand"> 26 <param name="forward_or_reverse" type="select" label="Scored strand">
32 <option value="forward">Score forward strand (-f)</option> 27 <option value="--forward">Score forward strand (-f)</option>
33 <option value="reverse">Score reverse strand (-r)</option> 28 <option value="--reverse">Score reverse strand (-r)</option>
34 <option value="both-strands">Score both strands (-b)</option> 29 <option value="--both-strands" selected="true">Score both strands (-b)</option>
35 </param> 30 </param>
36 <param name="zscore" type="select" label="Which type of z-scores"> 31 <param name="zscore" type="select" label="Which type of z-scores">
37 <option value="--mononucleotide">Use mononucleotide shuffled z-scores</option> 32 <option value="--mononucleotide">Use mononucleotide shuffled z-scores</option>
38 <option value="--dinucleotide" selected="true">Use dinucleotide shuffled z-scores</option> 33 <option value="--dinucleotide" selected="true">Use dinucleotide shuffled z-scores</option>
39 </param> 34 </param>
40 <param argument="--cutoff" label="Probability cutoff" type="float" value="-1.0" help="-1.0 to deactivate"/> 35 <param argument="--cutoff" label="Probability cutoff" type="float" value="-1.0" help="-1.0 to deactivate"/>
41 <param argument="--locarnate" type="boolean" checked="false" truevalue="--locarnate" falsevalue="" label="Use decision model for structural alignments" /> 36 <param argument="--locarnate" type="boolean" checked="false" truevalue="--locarnate" falsevalue="" label="Use decision model for structural alignments" />
42 <param argument="--no-shuffle" name="noshuffle" type="boolean" checked="false" truevalue="--no-shuffle" falsevalue="" label="Never fall back to shuffling" /> 37 <param argument="--no-shuffle" name="noshuffle" type="boolean" checked="false" truevalue="--no-shuffle" falsevalue="" label="Never fall back to shuffling" />
43 </inputs> 38 </inputs>
44 <outputs> 39 <outputs>
45 <data name="outfile" format="fasta" /> 40 <data name="output" format="txt" />
46 </outputs> 41 </outputs>
47 <tests> 42 <tests>
48 <test> 43 <test>
49 <param name="input" value="rnaz_input_trna.aln"/> 44 <param name="input" value="unknown.aln.window"/>
50 <output name="outfile" file="rnaz_result_trna.fasta"/> 45 <output name="output" file="unknown.rnaz"/>
51 </test> 46 </test>
52 <test> 47 <test>
53 <param name="input" value="rnaz_test_input2.aln"/> 48 <param name="input" value="tRNA.maf.window"/>
54 <output name="outfile" file="rnaz_result2.fasta"/> 49 <output name="output" file="tRNA.rnaz"/>
55 </test> 50 </test>
56 </tests> 51 </tests>
57 <help> 52 <help>
58 <![CDATA[ 53 <![CDATA[
59 54
60 **What it does** 55 **What it does**
61 56
62 RNAz is a program for predicting structurally conserved and thermodynamically stable RNA secondary structures in multiple sequence alignments. It can be used in genome wide screens to detect functional RNA structures, as found in noncoding RNAs and cis-acting regulatory elements of mRNAs. 57 RNAz is a program for predicting structurally conserved and thermodynamically stable RNA secondary structures in multiple sequence alignments. It can be used in genome wide screens to detect functional RNA structures, as found in noncoding RNAs and cis-acting regulatory elements of mRNAs.
63 58
76 71
77 sacBay GCCTTGTTGGCGCAATCGGTAGCGCGTATGACTCTTAATCATAAGGTTAGGGGTTCGAGC 72 sacBay GCCTTGTTGGCGCAATCGGTAGCGCGTATGACTCTTAATCATAAGGTTAGGGGTTCGAGC
78 73
79 sacCas GCTTCAGTAGCTCAGTCGGAAGAGCGTCAGTCTCATAATCTGAAGGTCGAGAGTTCGAAC 74 sacCas GCTTCAGTAGCTCAGTCGGAAGAGCGTCAGTCTCATAATCTGAAGGTCGAGAGTTCGAAC
80 75
81 \** * * \** \** \**\** \** \**\** * *\** \**\**\* *\**\* * \**\**\** * 76 \** * * \** \** \**\** \** \**\** * *\** \**\**\* *\**\* * \**\**\** *
82 77
83 78
84 **Output** 79 **Output**
85 80
86 In Galaxy RNAz gives you 2 output files: a summary file and a result file. For the example input they look like this: 81 RNAz returns an output file consisting of a summary header section and analyzed seuqence windows. For example they look like this:
87 82
88 Summary: 83 Header:
89 84
90 Sequences: 4 85 Sequences: 4
91 Columns: 60 86 Columns: 60
92 Reading direction: forward 87 Reading direction: forward
93 Mean pairwise identity: 82.50 88 Mean pairwise identity: 82.50
94 Shannon entropy: 0.28395 89 Shannon entropy: 0.28395
95 G+C content: 0.51667 90 G+C content: 0.51667
96 Mean single sequence MFE: -16.67 91 Mean single sequence MFE: -16.67
97 Consensus MFE: -15.59 92 Consensus MFE: -15.59
98 Energy contribution: -15.53 93 Energy contribution: -15.53
99 Covariance contribution: -0.06 94 Covariance contribution: -0.06
100 Combinations/Pair: 1.26 95 Combinations/Pair: 1.26
101 Mean z-score: -0.66 96 Mean z-score: -0.66
102 Structure conservation index: 0.93 97 Structure conservation index: 0.93
103 Background model: mononucleotide 98 Background model: mononucleotide
104 Decision model: sequence based alignment quality 99 Decision model: sequence based alignment quality
105 SVM decision value: -0.64 100 SVM decision value: -0.64
106 SVM RNA-class probability: 0.238023 101 SVM RNA-class probability: 0.238023
107 Prediction: OTHER 102 Prediction: OTHER
108 103
109 104
110 Result file: 105 Windows:
111 106
112 >sacCer1 107 >sacCer1
113 108
114 GCCUUGUUGGCGCAAUCGGUAGCGCGUAUGACUCUUAAUCAUAAGGUUAGGGGUUCGAGC 109 GCCUUGUUGGCGCAAUCGGUAGCGCGUAUGACUCUUAAUCAUAAGGUUAGGGGUUCGAGC
115 110
138 GCCUUGUUGGCGCAAUCGGUAGCGCGUAUGACUCUUAAUCAUAAGGUUAGGGGUUCGAGC 133 GCCUUGUUGGCGCAAUCGGUAGCGCGUAUGACUCUUAAUCAUAAGGUUAGGGGUUCGAGC
139 134
140 ..((((...((((........))))....(((((((((((....))))))))))))))). (-15.59 = -15.53 + -0.06) 135 ..((((...((((........))))....(((((((((((....))))))))))))))). (-15.59 = -15.53 + -0.06)
141 136
142 137
138 Usually this is output serves as input to rnazCluster.pl to reassemble sequences from windows often followed by rnazFilter.pl and rnazSort.pl to select regions of interest.
143 139
144 140 ]]>
145
146
147 ]]>
148 141
149 </help> 142 </help>
150
151 <citations> 143 <citations>
152 <citation type="doi">10.1142/9789814295291_0009</citation> 144 <citation type="doi">10.1142/9789814295291_0009</citation>
153 </citations> 145 </citations>
154
155 </tool> 146 </tool>