Mercurial > repos > bgruening > rnaz
view rnaz.xml @ 2:580ee1e91801 draft
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rnaz commit e85474d72b07c70ca061f51b7165951038a06a6c
author | bgruening |
---|---|
date | Thu, 28 Sep 2017 11:21:09 -0400 |
parents | e23c455f8335 |
children | 58fd61a8362e |
line wrap: on
line source
<tool id="rnaz" name="RNAz" version="2.1.1"> <description>predicting structurally conserved and thermodynamically stable RNA secondary structures</description> <requirements> <requirement type="package" version="2.1">rnaz</requirement> </requirements> <stdio> <exit_code range="1:" level="fatal" description="Error occurred. Please check Tool Standard Error" /> <exit_code range=":-1" level="fatal" description="Error occurred. Please check Tool Standard Error" /> </stdio> <version_command>RNAz --version</version_command> <command> <![CDATA[ RNAz '$input' --$forward_or_reverse $zscore $locarnate $noshuffle #if $cutoff != -1.0: --cutoff=$cutoff #end if > temp.txt && grep -v -E "^ |^#|^$" temp.txt > '$outfile' && grep -E "^ |^#|^$" temp.txt ]]> </command> <inputs> <param format="txt" name="input" type="data" label="Input Alignment File" /> <param name="forward_or_reverse" type="select" label="Scored strand"> <option value="forward">Score forward strand (-f)</option> <option value="reverse">Score reverse strand (-r)</option> <option value="both-strands">Score both strands (-b)</option> </param> <param name="zscore" type="select" label="Which type of z-scores"> <option value="--mononucleotide">Use mononucleotide shuffled z-scores</option> <option value="--dinucleotide" selected="true">Use dinucleotide shuffled z-scores</option> </param> <param argument="--cutoff" label="Probability cutoff" type="float" value="-1.0" help="-1.0 to deactivate"/> <param argument="--locarnate" type="boolean" checked="false" truevalue="--locarnate" falsevalue="" label="Use decision model for structural alignments" /> <param argument="--no-shuffle" name="noshuffle" type="boolean" checked="false" truevalue="--no-shuffle" falsevalue="" label="Never fall back to shuffling" /> </inputs> <outputs> <data name="outfile" format="fasta" /> </outputs> <tests> <test> <param name="input" value="rnaz_input_trna.aln"/> <output name="outfile" file="rnaz_result_trna.fasta"/> </test> <test> <param name="input" value="rnaz_test_input2.aln"/> <output name="outfile" file="rnaz_result2.fasta"/> </test> </tests> <help> <![CDATA[ **What it does** RNAz is a program for predicting structurally conserved and thermodynamically stable RNA secondary structures in multiple sequence alignments. It can be used in genome wide screens to detect functional RNA structures, as found in noncoding RNAs and cis-acting regulatory elements of mRNAs. **Input** Input is a multiple sequence alignment file. Currently the the following alignment formats can be read: CLUSTALW, FASTA, PHYLIP,NEXUS, MAF, and XMFA. Alignments can be generated by any sequence based alignment program. Sequence alignment tools can be found in Galaxy too (e.g. ClustalW). Example: CLUSTAL 2.1 multiple sequence alignment sacCer1 GCCTTGTTGGCGCAATCGGTAGCGCGTATGACTCTTAATCATAAGGTTAGGGGTTCGAGC sacKlu GCCTTGTTGGCGCAATCGGTAGCGCGTATGACTCTTAATCATAAGGCTAGGGGTTCGAGC sacBay GCCTTGTTGGCGCAATCGGTAGCGCGTATGACTCTTAATCATAAGGTTAGGGGTTCGAGC sacCas GCTTCAGTAGCTCAGTCGGAAGAGCGTCAGTCTCATAATCTGAAGGTCGAGAGTTCGAAC \** * * \** \** \**\** \** \**\** * *\** \**\**\* *\**\* * \**\**\** * **Output** In Galaxy RNAz gives you 2 output files: a summary file and a result file. For the example input they look like this: Summary: Sequences: 4 Columns: 60 Reading direction: forward Mean pairwise identity: 82.50 Shannon entropy: 0.28395 G+C content: 0.51667 Mean single sequence MFE: -16.67 Consensus MFE: -15.59 Energy contribution: -15.53 Covariance contribution: -0.06 Combinations/Pair: 1.26 Mean z-score: -0.66 Structure conservation index: 0.93 Background model: mononucleotide Decision model: sequence based alignment quality SVM decision value: -0.64 SVM RNA-class probability: 0.238023 Prediction: OTHER Result file: >sacCer1 GCCUUGUUGGCGCAAUCGGUAGCGCGUAUGACUCUUAAUCAUAAGGUUAGGGGUUCGAGC ..((((...((((........))))....(((((((((((....))))))))))))))). ( -19.00, z-score = -1.44, R) >sacKlu GCCUUGUUGGCGCAAUCGGUAGCGCGUAUGACUCUUAAUCAUAAGGCUAGGGGUUCGAGC ..((((...((((........))))....((((((((..(....)..)))))))))))). ( -16.00, z-score = -0.11, R) >sacBay GCCUUGUUGGCGCAAUCGGUAGCGCGUAUGACUCUUAAUCAUAAGGUUAGGGGUUCGAGC ..((((...((((........))))....(((((((((((....))))))))))))))). ( -19.00, z-score = -1.44, R) >sacCas GCUUCAGUAGCUCAGUCGGAAGAGCGUCAGUCUCAUAAUCUGAAGGUCGAGAGUUCGAAC .((((((..((((........))))..............)))))).(((......))).. ( -12.69, z-score = 0.35, R) >consensus GCCUUGUUGGCGCAAUCGGUAGCGCGUAUGACUCUUAAUCAUAAGGUUAGGGGUUCGAGC ..((((...((((........))))....(((((((((((....))))))))))))))). (-15.59 = -15.53 + -0.06) ]]> </help> <citations> <citation type="doi">10.1142/9789814295291_0009</citation> </citations> </tool>