--- a/rnaz.xml	Thu Sep 28 11:57:06 2017 -0400
+++ b/rnaz.xml	Wed Jan 30 04:13:28 2019 -0500
@@ -1,37 +1,32 @@
 <tool id="rnaz" name="RNAz" version="2.1.1">
     <description>predicting structurally conserved and thermodynamically stable RNA secondary structures</description>
-
     <requirements>
         <requirement type="package" version="2.1">rnaz</requirement>
     </requirements>
-
     <stdio>
         <exit_code range="1:" level="fatal" description="Error occurred. Please check Tool Standard Error" />
         <exit_code range=":-1" level="fatal" description="Error occurred. Please check Tool Standard Error" />
     </stdio>
-
     <version_command>RNAz --version</version_command>
-    <command>
-<![CDATA[
-    RNAz '$input'
-        --$forward_or_reverse
+    <command><![CDATA[
+    RNAz 
+        $forward_or_reverse
         $zscore
         $locarnate
         $noshuffle
         #if $cutoff != -1.0:
-        --cutoff=$cutoff
+            --cutoff=$cutoff
         #end if
-        > temp.txt &&
-        grep -v -E "^ |^#|^$" temp.txt > '$outfile' &&
-        grep -E "^ |^#|^$" temp.txt 
-]]>
+        '$input'
+    > '$output'
+    ]]>
     </command>
     <inputs>
         <param format="txt" name="input" type="data" label="Input Alignment File" />
         <param name="forward_or_reverse" type="select" label="Scored strand">
-            <option value="forward">Score forward strand (-f)</option>
-            <option value="reverse">Score reverse strand (-r)</option>
-            <option value="both-strands">Score both strands (-b)</option>
+            <option value="--forward">Score forward strand (-f)</option>
+            <option value="--reverse">Score reverse strand (-r)</option>
+            <option value="--both-strands" selected="true">Score both strands (-b)</option>
         </param>
         <param name="zscore" type="select" label="Which type of z-scores">
             <option value="--mononucleotide">Use mononucleotide shuffled z-scores</option>
@@ -42,20 +37,20 @@
         <param argument="--no-shuffle" name="noshuffle"  type="boolean" checked="false" truevalue="--no-shuffle" falsevalue="" label="Never fall back to shuffling"  />
     </inputs>
     <outputs>
-        <data name="outfile" format="fasta" />
+        <data name="output" format="txt" />
     </outputs>
     <tests>
         <test>
-            <param name="input" value="rnaz_input_trna.aln"/>
-            <output name="outfile" file="rnaz_result_trna.fasta"/> 
+            <param name="input" value="unknown.aln.window"/>
+            <output name="output" file="unknown.rnaz"/> 
         </test>
         <test>
-            <param name="input" value="rnaz_test_input2.aln"/>
-            <output name="outfile" file="rnaz_result2.fasta"/> 
+            <param name="input" value="tRNA.maf.window"/>
+            <output name="output" file="tRNA.rnaz"/> 
         </test>
     </tests>
     <help>
-<![CDATA[
+        <![CDATA[
 
 **What it does**
 
@@ -78,36 +73,36 @@
 
 sacCas          GCTTCAGTAGCTCAGTCGGAAGAGCGTCAGTCTCATAATCTGAAGGTCGAGAGTTCGAAC
 
-                \** *   * \** \** \**\** \** \**\**  * *\** \**\**\*  *\**\*    * \**\**\** *
+\** *   * \** \** \**\** \** \**\**  * *\** \**\**\*  *\**\*    * \**\**\** *
 
 
 **Output**
 
-In Galaxy RNAz gives you 2 output files: a summary file and a result file. For the example input they look like this:
+RNAz returns an output file consisting of a summary header section and analyzed seuqence windows. For example they look like this:
 
-Summary:
+Header:
 
- Sequences: 4
- Columns: 60
- Reading direction: forward
- Mean pairwise identity:  82.50
- Shannon entropy: 0.28395
- G+C content: 0.51667
- Mean single sequence MFE: -16.67
- Consensus MFE: -15.59
- Energy contribution: -15.53
- Covariance contribution:  -0.06
- Combinations/Pair:   1.26
- Mean z-score:  -0.66
- Structure conservation index:   0.93
- Background model: mononucleotide
- Decision model: sequence based alignment quality
- SVM decision value:  -0.64
- SVM RNA-class probability: 0.238023
- Prediction: OTHER
- 
- 
-Result file:
+Sequences: 4
+Columns: 60
+Reading direction: forward
+Mean pairwise identity:  82.50
+Shannon entropy: 0.28395
+G+C content: 0.51667
+Mean single sequence MFE: -16.67
+Consensus MFE: -15.59
+Energy contribution: -15.53
+Covariance contribution:  -0.06
+Combinations/Pair:   1.26
+Mean z-score:  -0.66
+Structure conservation index:   0.93
+Background model: mononucleotide
+Decision model: sequence based alignment quality
+SVM decision value:  -0.64
+SVM RNA-class probability: 0.238023
+Prediction: OTHER
+
+
+Windows:
 
 >sacCer1
 
@@ -140,16 +135,12 @@
 ..((((...((((........))))....(((((((((((....))))))))))))))). (-15.59 = -15.53 +  -0.06) 
 
 
-
-
+Usually this is output serves as input to rnazCluster.pl to reassemble sequences from windows often followed by rnazFilter.pl and rnazSort.pl to select regions of interest.
 
-
-]]>
+        ]]>
 
     </help>
-
     <citations>
         <citation type="doi">10.1142/9789814295291_0009</citation>
-    </citations>    
-    
+    </citations>
 </tool>