--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/aragorn_tansl-table-1_tmRNA_tRNA.txt	Wed Jul 26 10:14:05 2017 -0400
@@ -0,0 +1,70 @@
+------------------------------
+ARAGORN v1.2.36   Dean Laslett
+------------------------------
+
+Please reference the following paper if you use this
+program as part of any published research.
+
+Laslett, D. and Canback, B. (2004) ARAGORN, a
+program for the detection of transfer RNA and
+transfer-messenger RNA genes in nucleotide sequences.
+Nucleic Acids Research, 32;11-16.
+
+
+Searching for tRNA genes with no introns
+Searching for tmRNA genes
+Assuming circular topology, search wraps around ends
+Searching both strands
+Using standard genetic code
+
+
+gi|240255695:23036500-23037000 Arabidopsis thaliana chromosome 3, complete sequence
+501 nucleotides in sequence
+Mean G+C content = 43.1%
+ 
+1.
+ 
+ 
+ 
+               a
+             g-c
+             g-c
+             g+t
+             g-c
+             a-t
+             t-a
+             g-c     tt
+            t   gtccc  a
+     ta    a    !!!!!  g
+    a  ctcg     caggg  c
+   t   !!!!    a     tt
+   g   gagc     c
+    gta    g     g
+            c-gag
+            t-a
+            c-g
+            g-c
+            c-g
+           t   t
+           t   a
+            tgc
+ 
+ 
+ 
+    tRNA-Ala(tgc)
+    73 bases, %GC = 56.2
+    Sequence [381,453]
+ 
+
+
+>tRNA-Ala(tgc) [381,453]
+ggggatgtagctcatatggtagagcgctcgctttgcatgcgagaggcaca
+gggttcgattccctgcatctcca
+
+
+
+
+Number of tmRNA genes = 0
+
+
+Configuration: aragorn /tmp/tmpx1qAPk/files/000/dataset_3.dat -gc1 -m -t -c -o /tmp/tmpx1qAPk/files/000/dataset_4.dat -fasta