Mercurial > repos > bgruening > trna_prediction
view aragorn.xml @ 2:358f58401cd6 draft default tip
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/trna_prediction commit cfb19d75629f02e0dea4475c16c016ed5510eb44
author | bgruening |
---|---|
date | Wed, 26 Jul 2017 10:14:05 -0400 |
parents | d788d1abe238 |
children |
line wrap: on
line source
<tool id="aragorn_trna" name="tRNA and tmRNA" version="0.6"> <description>prediction (Aragorn)</description> <requirements> <requirement type="package" version="1.2.36">aragorn</requirement> <requirement type="package" version="2.7">python</requirement> </requirements> <command><![CDATA[ #if not $gff3_output: aragorn '$input' -gc$genbank_gencode $tmRNA $tRNA $mtRNA $mam_mtRNA $topology -o '$output' $secondary_structure $introns #end if #if $gff3_output: aragorn '$input' -gc$genbank_gencode $tmRNA $tRNA $mtRNA $mam_mtRNA $topology $introns -w | python '$__tool_directory__/aragorn_out_to_gff3.py' $gff3_model > '$gff3_output_file' #end if ]]> </command> <inputs> <param name="input" type="data" format="fasta" label="Genome Sequence"/> <param name="genbank_gencode" type="select" label="Genetic code"> <option value="1" selected="true">1. Standard</option> <option value="2">2. Vertebrate Mitochondrial</option> <option value="3">3. Yeast Mitochondrial</option> <option value="4">4. Mold, Protozoan, and Coelenterate Mitochondrial Code and the Mycoplasma/Spiroplasma Code</option> <option value="5">5. Invertebrate Mitochondrial</option> <option value="6">6. Ciliate, Dasycladacean and Hexamita Nuclear Code</option> <option value="9">9. Echinoderm Mitochondrial</option> <option value="10">10. Euplotid Nuclear</option> <option value="11">11. Bacteria and Archaea</option> <option value="12">12. Alternative Yeast Nuclear</option> <option value="13">13. Ascidian Mitochondrial</option> <option value="14">14. Flatworm Mitochondrial</option> <option value="15">15. Blepharisma Macronuclear</option> <option value="16">16. Chlorophycean Mitochondrial</option> <option value="21">21. Trematode Mitochondrial</option> <option value="22">22. Scenedesmus obliquus mitochondrial</option> <option value="23">23. Thraustochytrium Mitochondrial</option> <option value="24">24. Pterobranchia mitochondrial</option> </param> <param name="topology" type="select" label="Topology"> <option value="-c">Assume that each sequence has a circular topology</option> <option value="-l">Assume that each sequence has a linear topology</option> </param> <param name='tmRNA' type='boolean' label='Search for tmRNA genes' truevalue='-m' falsevalue='' checked="true" help='(-m)' /> <param name='tRNA' type='boolean' label='Search for tRNA genes' truevalue='-t' falsevalue='' checked="true" help='(-t)' /> <param name='mtRNA' type='boolean' label='Search for Metazoan mitochondrial tRNA genes' truevalue='-mt' falsevalue='' checked="false" help='-i switch will be ignored. Composite Metazoan mitochondrial genetic code used. (-mt)' /> <param name='mam_mtRNA' type='boolean' label='Search for Mammalian mitochondrial tRNA genes' truevalue='-mtmam' falsevalue='' checked="false" help='-i switch will be ignored. Mammalian mitochondrial genetic code used. (-mtmam)' /> <param name='introns' type='boolean' label='Search for tRNA genes with introns in anticodon loop' truevalue='-i' falsevalue='' checked="false" help='With a maximum length of 3000 bases. (-i).' /> <param name='secondary_structure' type='boolean' label='Print out secondary structure' truevalue='-fasta' falsevalue='-fon' checked="false" help='(-fasta,-fon)' /> <param name="gff3_output" type='boolean' label='Convert output to GFF3' truevalue='True' falsevalue='' checked="false" help='' /> <param name="gff3_model" type='boolean' label='Full gene model for GFF3 data' truevalue='--full' checked='false' help='' /> </inputs> <outputs> <data name="output" format="fasta"> <change_format> <when input="secondary_structure" value="-fasta" format="txt"/> </change_format> </data> <data format="gff3" name="gff3_output_file" > <filter>gff3_output</filter> </data> </outputs> <tests> <test> <param name="input" value="trna_arabidopsis.fasta" ftype="fasta" /> <param name="genbank_gencode" value="1" /> <param name="topology" value="-c" /> <param name="tmRNA" value="True" /> <param name="tRNA" value="True" /> <param name="mtRNA" value="False" /> <param name="mam_mtRNA" value="False" /> <param name="introns" value="False" /> <param name="secondary_structure" value="-fon" /> <param name="gff3_output" value="false" /> <output name="output" file="aragorn_tansl-table-1_tmRNA_tRNA.fasta" ftype="fasta" /> </test> <test> <param name="input" value="trna_arabidopsis.fasta" ftype="fasta" /> <param name="genbank_gencode" value="1" /> <param name="topology" value="-c" /> <param name="tmRNA" value="True" /> <param name="tRNA" value="True" /> <param name="mtRNA" value="False" /> <param name="mam_mtRNA" value="False" /> <param name="introns" value="False" /> <param name="secondary_structure" value="-fasta" /> <param name="gff3_output" value="false" /> <output name="output" file="aragorn_tansl-table-1_tmRNA_tRNA.txt" ftype="txt" lines_diff="2" /> </test> <test> <param name="input" value="trna_arabidopsis.fasta" ftype="fasta" /> <param name="genbank_gencode" value="1" /> <param name="topology" value="-c" /> <param name="tmRNA" value="True" /> <param name="tRNA" value="True" /> <param name="mtRNA" value="False" /> <param name="mam_mtRNA" value="False" /> <param name="introns" value="False" /> <param name="gff3_output" value="True" /> <output name="gff3_output_file" file="aragorn_tansl-table-1_tmRNA_tRNA.gff3" ftype="gff3" /> </test> <test> <param name="input" value="genome_with_introns.fa" ftype="fasta" /> <param name="genbank_gencode" value="11" /> <param name="topology" value="-c" /> <param name="tmRNA" value="True" /> <param name="tRNA" value="True" /> <param name="mtRNA" value="False" /> <param name="mam_mtRNA" value="False" /> <param name="introns" value="True" /> <param name="gff3_output" value="True" /> <param name="gff3_model" value="True" /> <output name="gff3_output_file" file="aragorn_tansl-table-11_introns.gff3" ftype="gff3" /> </test> </tests> <help> <![CDATA[ **What it does** Aragorn_ predicts tRNA (and tmRNA) in nucleotide sequences. .. _Aragorn: http://mbio-serv2.mbioekol.lu.se/ARAGORN/ **Input** As input a genome sequence FASTA file is needed. Select the right genetic code and the topology for your organism and choose what you want to have analyzed. By default, ARAGORN assumes that each sequence has a circular topology (search wraps around ends), that both strands should be searched, that the progress of the search is not reported, both tRNA and tmRNA genes are detected, and tRNA genes containing C‐loop introns are not detected. **Output** The output of Aragorn reports the proposed tRNA secondary structure and, for tmRNA genes, the secondary structure of the tRNA domain, the tmRNA gene sequence, the tag peptide and a list of organisms with matching tmRNA peptide tags. Optionally, your output can be converted to GFF3. **Example** Suppose you have the following nucleotide sequences:: >SQ Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other; cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg .... Running this tool can produce a FASTA file with all detected RNAs or a more detailed text file like the following:: c c a g-c g-c g-c c-g g-c a-t t-a ca t tgacc a ga a !!!!! g t ctcg actgg c g !!!! c tt g gagc t aa g g c-gag t-a t-a c-g g-c t c t a cac tRNA-Val(cac) 74 bases, %GC = 58.1 Sequence [6669703,6669776] tRNA Anticodon Frequency AAA Phe GAA Phe 1 CAA Leu 1 TAA Leu 1 AGA Ser GGA Ser 1 CGA Ser 2 TGA Ser 1 ACA Cys GCA Cys 2 CCA Trp 2 TCA seC ATA Tyr GTA Tyr 1 CTA Pyl TTA Stop AAG Leu GAG Leu 3 CAG Leu 1 TAG Leu 2 AGG Pro GGG Pro 2 CGG Pro 2 TGG Pro 2 ACG Arg 1 GCG Arg 2 CCG Arg 1 TCG Arg ATG His GTG His 2 CTG Gln 2 TTG Gln 1 AAC Val GAC Val 3 CAC Val 2 TAC Val 1 AGC Ala GGC Ala 2 CGC Ala 3 TGC Ala 1 ACC Gly GCC Gly 5 CCC Gly 1 TCC Gly 2 ATC Asp GTC Asp 3 CTC Glu 2 TTC Glu 2 AAT Ile GAT Ile 3 CAT Met 6 TAT Ile AGT Thr GGT Thr 2 CGT Thr 1 TGT Thr 2 ACT Ser GCT Ser 1 CCT Arg 1 TCT Arg 1 ATT Asn GTT Asn 3 CTT Lys 3 TTT Lys 2 Ambiguous: 1 tRNA Codon Frequency TTT Phe TTC Phe 1 TTG Leu 1 TTA Leu 1 TCT Ser TCC Ser 1 TCG Ser 2 TCA Ser 1 TGT Cys TGC Cys 2 TGG Trp 2 TGA seC TAT Tyr TAC Tyr 1 TAG Pyl TAA Stop CTT Leu CTC Leu 3 CTG Leu 1 CTA Leu 2 CCT Pro CCC Pro 2 CCG Pro 2 CCA Pro 2 CGT Arg 1 CGC Arg 2 CGG Arg 1 CGA Arg CAT His CAC His 2 CAG Gln 2 CAA Gln 1 GTT Val GTC Val 3 GTG Val 2 GTA Val 1 GCT Ala GCC Ala 2 GCG Ala 3 GCA Ala 1 GGT Gly GGC Gly 5 GGG Gly 1 GGA Gly 2 GAT Asp GAC Asp 3 GAG Glu 2 GAA Glu 2 ATT Ile ATC Ile 3 ATG Met 6 ATA Ile ACT Thr ACC Thr 2 ACG Thr 1 ACA Thr 2 AGT Ser AGC Ser 1 AGG Arg 1 AGA Arg 1 AAT Asn AAC Asn 3 AAG Lys 3 AAA Lys 2 Ambiguous: 1 Number of tRNA genes = 86 tRNA GC range = 50.0% to 85.1% Number of tmRNA genes = 1 ]]> </help> <citations> <citation type="doi">10.1093/nar/gkh152</citation> </citations> </tool>