view aragorn.xml @ 2:358f58401cd6 draft default tip

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/trna_prediction commit cfb19d75629f02e0dea4475c16c016ed5510eb44
author bgruening
date Wed, 26 Jul 2017 10:14:05 -0400
parents d788d1abe238
children
line wrap: on
line source

<tool id="aragorn_trna" name="tRNA and tmRNA" version="0.6">
    <description>prediction (Aragorn)</description>
    <requirements>
        <requirement type="package" version="1.2.36">aragorn</requirement>
        <requirement type="package" version="2.7">python</requirement>
    </requirements>
    <command><![CDATA[
        #if not $gff3_output:
            aragorn
                '$input'
                -gc$genbank_gencode
                $tmRNA
                $tRNA
                $mtRNA
                $mam_mtRNA
                $topology
                -o '$output'
                $secondary_structure
                $introns
        #end if
   
        #if $gff3_output:
            aragorn
                '$input'
                -gc$genbank_gencode
                $tmRNA
                $tRNA
                $mtRNA
                $mam_mtRNA
                $topology
                $introns
                -w
            | python '$__tool_directory__/aragorn_out_to_gff3.py' $gff3_model > '$gff3_output_file'
        #end if
		]]>
    </command>
    <inputs>
        <param name="input" type="data" format="fasta" label="Genome Sequence"/>
        <param name="genbank_gencode" type="select" label="Genetic code">
            <option value="1" selected="true">1. Standard</option>
            <option value="2">2. Vertebrate Mitochondrial</option>
            <option value="3">3. Yeast Mitochondrial</option>
            <option value="4">4. Mold, Protozoan, and Coelenterate Mitochondrial Code and the Mycoplasma/Spiroplasma Code</option>
            <option value="5">5. Invertebrate Mitochondrial</option>
            <option value="6">6. Ciliate, Dasycladacean and Hexamita Nuclear Code</option>
            <option value="9">9. Echinoderm Mitochondrial</option>
            <option value="10">10. Euplotid Nuclear</option>
            <option value="11">11. Bacteria and Archaea</option>
            <option value="12">12. Alternative Yeast Nuclear</option>
            <option value="13">13. Ascidian Mitochondrial</option>
            <option value="14">14. Flatworm Mitochondrial</option>
            <option value="15">15. Blepharisma Macronuclear</option>
            <option value="16">16. Chlorophycean Mitochondrial</option>
            <option value="21">21. Trematode Mitochondrial</option>
            <option value="22">22. Scenedesmus obliquus mitochondrial</option>
            <option value="23">23. Thraustochytrium Mitochondrial</option>
            <option value="24">24. Pterobranchia mitochondrial</option>
        </param>
        <param name="topology" type="select" label="Topology">
            <option value="-c">Assume that each sequence has a circular topology</option>
            <option value="-l">Assume that each sequence has a linear topology</option>
        </param>
        <param name='tmRNA' type='boolean' label='Search for tmRNA genes'
            truevalue='-m' falsevalue='' checked="true" help='(-m)' />
        <param name='tRNA' type='boolean' label='Search for tRNA genes'
            truevalue='-t' falsevalue='' checked="true" help='(-t)' />
        <param name='mtRNA' type='boolean' label='Search for Metazoan mitochondrial tRNA genes' truevalue='-mt' falsevalue='' checked="false"
            help='-i switch will be ignored. Composite Metazoan mitochondrial genetic code used. (-mt)' />
        <param name='mam_mtRNA' type='boolean' label='Search for Mammalian mitochondrial tRNA genes'
            truevalue='-mtmam' falsevalue='' checked="false" help='-i switch will be ignored. Mammalian mitochondrial genetic code used. (-mtmam)' />
        <param name='introns' type='boolean' label='Search for tRNA genes with introns in anticodon loop'
            truevalue='-i' falsevalue='' checked="false" help='With a maximum length of 3000 bases. (-i).' />
        <param name='secondary_structure' type='boolean' label='Print out secondary structure'
            truevalue='-fasta' falsevalue='-fon' checked="false" help='(-fasta,-fon)' />
        <param name="gff3_output" type='boolean' label='Convert output to GFF3' truevalue='True' falsevalue='' checked="false" help='' />
        <param name="gff3_model" type='boolean' label='Full gene model for GFF3 data' truevalue='--full' checked='false' help='' />
    </inputs>
    <outputs>
        <data name="output" format="fasta">
            <change_format>
               <when input="secondary_structure" value="-fasta" format="txt"/>
             </change_format>
        </data>
        <data format="gff3" name="gff3_output_file" >
            <filter>gff3_output</filter>
        </data>
    </outputs>
    <tests>
        <test>
            <param name="input" value="trna_arabidopsis.fasta" ftype="fasta" />
            <param name="genbank_gencode" value="1" />
            <param name="topology" value="-c" />
            <param name="tmRNA" value="True" />
            <param name="tRNA" value="True" />
            <param name="mtRNA" value="False" />
            <param name="mam_mtRNA" value="False" />
            <param name="introns" value="False" />
            <param name="secondary_structure" value="-fon" />
            <param name="gff3_output" value="false" />
            <output name="output" file="aragorn_tansl-table-1_tmRNA_tRNA.fasta" ftype="fasta" />
        </test>
		
        <test>
            <param name="input" value="trna_arabidopsis.fasta" ftype="fasta" />
            <param name="genbank_gencode" value="1" />
            <param name="topology" value="-c" />
            <param name="tmRNA" value="True" />
            <param name="tRNA" value="True" />
            <param name="mtRNA" value="False" />
            <param name="mam_mtRNA" value="False" />
            <param name="introns" value="False" />
            <param name="secondary_structure" value="-fasta" />
            <param name="gff3_output" value="false" />
            <output name="output" file="aragorn_tansl-table-1_tmRNA_tRNA.txt" ftype="txt" lines_diff="2" />
        </test>
        <test>
            <param name="input" value="trna_arabidopsis.fasta" ftype="fasta" />
            <param name="genbank_gencode" value="1" />
            <param name="topology" value="-c" />
            <param name="tmRNA" value="True" />
            <param name="tRNA" value="True" />
            <param name="mtRNA" value="False" />
            <param name="mam_mtRNA" value="False" />
            <param name="introns" value="False" />
            <param name="gff3_output" value="True" />
            <output name="gff3_output_file" file="aragorn_tansl-table-1_tmRNA_tRNA.gff3" ftype="gff3" />
        </test>
        <test>
            <param name="input" value="genome_with_introns.fa" ftype="fasta" />
            <param name="genbank_gencode" value="11" />
            <param name="topology" value="-c" />
            <param name="tmRNA" value="True" />
            <param name="tRNA" value="True" />
            <param name="mtRNA" value="False" />
            <param name="mam_mtRNA" value="False" />
            <param name="introns" value="True" />
            <param name="gff3_output" value="True" />
            <param name="gff3_model" value="True" />
            <output name="gff3_output_file" file="aragorn_tansl-table-11_introns.gff3" ftype="gff3" />
        </test>
    </tests>
    <help>
<![CDATA[

**What it does**

Aragorn_ predicts tRNA (and tmRNA) in nucleotide sequences.

.. _Aragorn: http://mbio-serv2.mbioekol.lu.se/ARAGORN/

**Input**

As input a genome sequence FASTA file is needed. Select the right genetic code and the topology for your organism and choose what you want to have analyzed.

By default, ARAGORN assumes that each sequence has a circular topology (search wraps around ends), that both strands should be searched, that the progress of the search is not reported, both tRNA and tmRNA genes are detected, and tRNA genes containing C‐loop introns are not detected. 

**Output**

The output of Aragorn reports the proposed tRNA secondary structure and, for tmRNA genes, the secondary structure of the tRNA domain, the tmRNA gene sequence, the tag peptide and a list of organisms with matching tmRNA peptide tags. 

Optionally, your output can be converted to GFF3.

**Example**

Suppose you have the following nucleotide sequences::

    >SQ   Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other;
    cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg
    ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag
    cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc
    cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc
    ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg
    ....

Running this tool can produce a FASTA file with all detected RNAs or a more detailed text file like the following::

                 c
                c
               a
             g-c
             g-c
             g-c
             c-g
             g-c
             a-t
             t-a     ca
            t   tgacc  a
     ga    a    !!!!!  g
    t  ctcg     actgg  c
    g  !!!!    c     tt
    g  gagc     t
     aa    g     g
            c-gag
            t-a
            t-a
            c-g
            g-c
           t   c
           t   a
            cac

    tRNA-Val(cac)
    74 bases, %GC = 58.1
    Sequence [6669703,6669776]


    tRNA Anticodon Frequency
    AAA Phe       GAA Phe  1    CAA Leu  1    TAA Leu  1
    AGA Ser       GGA Ser  1    CGA Ser  2    TGA Ser  1
    ACA Cys       GCA Cys  2    CCA Trp  2    TCA seC
    ATA Tyr       GTA Tyr  1    CTA Pyl       TTA Stop
    AAG Leu       GAG Leu  3    CAG Leu  1    TAG Leu  2
    AGG Pro       GGG Pro  2    CGG Pro  2    TGG Pro  2
    ACG Arg  1    GCG Arg  2    CCG Arg  1    TCG Arg
    ATG His       GTG His  2    CTG Gln  2    TTG Gln  1
    AAC Val       GAC Val  3    CAC Val  2    TAC Val  1
    AGC Ala       GGC Ala  2    CGC Ala  3    TGC Ala  1
    ACC Gly       GCC Gly  5    CCC Gly  1    TCC Gly  2
    ATC Asp       GTC Asp  3    CTC Glu  2    TTC Glu  2
    AAT Ile       GAT Ile  3    CAT Met  6    TAT Ile
    AGT Thr       GGT Thr  2    CGT Thr  1    TGT Thr  2
    ACT Ser       GCT Ser  1    CCT Arg  1    TCT Arg  1
    ATT Asn       GTT Asn  3    CTT Lys  3    TTT Lys  2
    Ambiguous: 1

    tRNA Codon Frequency
    TTT Phe       TTC Phe  1    TTG Leu  1    TTA Leu  1
    TCT Ser       TCC Ser  1    TCG Ser  2    TCA Ser  1
    TGT Cys       TGC Cys  2    TGG Trp  2    TGA seC
    TAT Tyr       TAC Tyr  1    TAG Pyl       TAA Stop
    CTT Leu       CTC Leu  3    CTG Leu  1    CTA Leu  2
    CCT Pro       CCC Pro  2    CCG Pro  2    CCA Pro  2
    CGT Arg  1    CGC Arg  2    CGG Arg  1    CGA Arg
    CAT His       CAC His  2    CAG Gln  2    CAA Gln  1
    GTT Val       GTC Val  3    GTG Val  2    GTA Val  1
    GCT Ala       GCC Ala  2    GCG Ala  3    GCA Ala  1
    GGT Gly       GGC Gly  5    GGG Gly  1    GGA Gly  2
    GAT Asp       GAC Asp  3    GAG Glu  2    GAA Glu  2
    ATT Ile       ATC Ile  3    ATG Met  6    ATA Ile
    ACT Thr       ACC Thr  2    ACG Thr  1    ACA Thr  2
    AGT Ser       AGC Ser  1    AGG Arg  1    AGA Arg  1
    AAT Asn       AAC Asn  3    AAG Lys  3    AAA Lys  2
    Ambiguous: 1

    Number of tRNA genes = 86
    tRNA GC range = 50.0% to 85.1%
    Number of tmRNA genes = 1


]]>
    </help>
    <citations>
        <citation type="doi">10.1093/nar/gkh152</citation>
    </citations>
</tool>