Mercurial > repos > bjoern-gruening > augustus
annotate augustus.xml @ 4:796814f16b12
Add tool_dependencies.xml and update to new augustus version. Thanks to James Johnson for the patch.
| author | bjoern-gruening |
|---|---|
| date | Tue, 30 Oct 2012 06:29:50 -0400 |
| parents | d5d5999ff4f1 |
| children | a4fab0c1ae1a |
| rev | line source |
|---|---|
|
4
796814f16b12
Add tool_dependencies.xml and update to new augustus version. Thanks to James Johnson for the patch.
bjoern-gruening
parents:
2
diff
changeset
|
1 <tool id="augustus" name="Augustus" version="0.2"> |
|
796814f16b12
Add tool_dependencies.xml and update to new augustus version. Thanks to James Johnson for the patch.
bjoern-gruening
parents:
2
diff
changeset
|
2 <description>gene prediction for eukaryotic genomes</description> |
|
796814f16b12
Add tool_dependencies.xml and update to new augustus version. Thanks to James Johnson for the patch.
bjoern-gruening
parents:
2
diff
changeset
|
3 <requirements> |
|
796814f16b12
Add tool_dependencies.xml and update to new augustus version. Thanks to James Johnson for the patch.
bjoern-gruening
parents:
2
diff
changeset
|
4 <requirement type="package" version="2.6.1">augustus</requirement> |
|
796814f16b12
Add tool_dependencies.xml and update to new augustus version. Thanks to James Johnson for the patch.
bjoern-gruening
parents:
2
diff
changeset
|
5 </requirements> |
| 0 | 6 <command>augustus |
| 7 --strand=$strand | |
| 8 $noInFrameStop | |
| 9 $gff | |
| 10 $protein | |
| 11 $introns | |
| 12 $start | |
| 13 $stop | |
| 14 $cds | |
| 15 $codingseq | |
| 16 $singlestrand | |
| 17 $input_genome | |
| 18 --genemodel=$genemodel | |
| 19 --species=$organism | |
| 20 --outfile=$output | |
| 21 | |
| 22 #please set export AUGUSTUS_CONFIG_PATH=/path_to_augustus/augustus/config | |
| 23 #or use the --AUGUSTUS_CONFIG_PATH=path switch | |
| 24 | |
| 25 </command> | |
| 26 <inputs> | |
| 27 <param name="input_genome" type="data" format="fasta" label="Genome Sequence"/> | |
| 28 <param name="noInFrameStop" type="boolean" label="Don't report transcripts with in-frame stop codons. Otherwise, intron-spanning stop codons could occur" truevalue="--noInFrameStop=true" falsevalue="--noInFrameStop=false" checked="false" /> | |
| 29 <param name="gff" type="boolean" label="GFF formated output, standard is GTF" truevalue="--gff3=on" falsevalue="--gff3=off" checked="false" /> | |
| 30 <param name="protein" type="boolean" label="Output predicted protein sequences" truevalue="--protein=on" falsevalue="--protein=off" checked="false" /> | |
| 31 <param name="introns" type="boolean" label="Output predicted intron sequences" truevalue="--introns=on" falsevalue="--introns=off" checked="false" /> | |
| 32 <param name="start" type="boolean" label="Output predicted start codons" truevalue="--start=on" falsevalue="--start=off" checked="false" /> | |
| 33 <param name="stop" type="boolean" label="Output predicted stop codons" truevalue="--stop=on" falsevalue="--stop=off" checked="false" /> | |
| 34 <param name="cds" type="boolean" label="Output CDS region" truevalue="--cds=on" falsevalue="--cds=off" checked="true" /> | |
| 35 <param name="codingseq" type="boolean" label="Output coding sequence as comment in the output file" truevalue="--codingseq=on" falsevalue="--codingseq=off" checked="false" /> | |
| 36 | |
| 37 <param name="singlestrand" type="boolean" label="Predict genes independently on each strand, allow overlapping genes on opposite strands" truevalue="--singlestrand=true" falsevalue="--singlestrand=false" checked="false" /> | |
| 38 | |
| 39 <param name="organism" label="Model Organism" type="select" multiple="false" format="text" help="Choose a specialised trainingset."> | |
| 40 <option value="human">Homo sapiens</option> | |
| 41 <option value="fly">Drosophila melanogaster</option> | |
| 42 <option value="arabidopsis">Arabidopsis thaliana</option> | |
| 43 <option value="brugia ">Brugia malayi</option> | |
| 44 <option value="aedes">Aedes aegypti</option> | |
| 45 <option value="tribolium">Tribolium castaneum</option> | |
| 46 <option value="schistosoma">Schistosoma mansoni</option> | |
| 47 <option value="tetrahymena">Tetrahymena thermophila</option> | |
| 48 <option value="galdieria">Galdieria sulphuraria</option> | |
| 49 <option value="maize">Zea mays</option> | |
| 50 <option value="toxoplasma ">Toxoplasma gondii</option> | |
| 51 <option value="caenorhabditis ">Caenorhabditis elegans</option> | |
| 52 <option value="aspergillus_fumigatus">Aspergillus fumigatus</option> | |
| 53 <option value="aspergillus_nidulans ">Aspergillus nidulans</option> | |
| 54 <option value="aspergillus_oryzae ">Aspergillus oryzae</option> | |
| 55 <option value="aspergillus_terreus">Aspergillus terreus</option> | |
| 56 <option value="botrytis_cinerea ">Botrytis cinerea</option> | |
| 57 <option value="candida_albicans ">Candida albicans</option> | |
| 58 <option value="candida_guilliermondii ">Candida guilliermondii</option> | |
| 59 <option value="candida_tropicalis ">Candida tropicalis</option> | |
| 60 <option value="chaetomium_globosum">Chaetomium globosum</option> | |
| 61 <option value="coccidioides_immitis ">Coccidioides immitis</option> | |
| 62 <option value="coprinus ">Coprinus cinereus</option> | |
| 63 <option value="coprinus_cinereus">Coprinus cinereus</option> | |
| 64 <option value="cryptococcus_neoformans_gattii ">Cryptococcus neoformans gattii</option> | |
| 65 <option value="cryptococcus_neoformans_neoformans_B ">Cryptococcus neoformans neoformans</option> | |
| 66 <option value="cryptococcus_neoformans_neoformans_JEC21 ">Cryptococcus neoformans neoformans</option> | |
| 67 <option value="debaryomyces_hansenii">Debaryomyces hansenii</option> | |
| 68 <option value="encephalitozoon_cuniculi_GB">Encephalitozoon cuniculi</option> | |
| 69 <option value="eremothecium_gossypii">Eremothecium gossypii</option> | |
| 70 <option value="fusarium_graminearum ">Fusarium graminearum</option> | |
| 71 <option value="histoplasma_capsulatum ">Histoplasma capsulatum</option> | |
| 72 <option value="(histoplasma)">Histoplasma capsulatum</option> | |
| 73 <option value="kluyveromyces_lactis ">Kluyveromyces lactis</option> | |
| 74 <option value="laccaria_bicolor ">Laccaria bicolor</option> | |
| 75 <option value="lamprey">Petromyzon marinus</option> | |
| 76 <option value="leishmania_tarentolae">Leishmania tarentolae</option> | |
| 77 <option value="lodderomyces_elongisporus">Lodderomyces elongisporus</option> | |
| 78 <option value="magnaporthe_grisea ">Magnaporthe grisea</option> | |
| 79 <option value="neurospora_crassa">Neurospora crassa</option> | |
| 80 <option value="phanerochaete_chrysosporium">Phanerochaete chrysosporium</option> | |
| 81 <option value="pichia_stipitis">Pichia stipitis</option> | |
| 82 <option value="rhizopus_oryzae">Rhizopus oryzae</option> | |
| 83 <option value="saccharomyces_cerevisiae_S288C ">Saccharomyces cerevisiae</option> | |
| 84 <option value="saccharomyces_cerevisiae_rm11-1a_1 ">Saccharomyces cerevisiae</option> | |
| 85 <option value="(saccharomyces)">Saccharomyces cerevisiae</option> | |
| 86 <option value="schizosaccharomyces_pombe">Schizosaccharomyces pombe</option> | |
| 87 <option value="trichinella">Trichinella spiralis</option> | |
| 88 <option value="ustilago_maydis">Ustilago maydis</option> | |
| 89 <option value="yarrowia_lipolytica">Yarrowia lipolytica</option> | |
| 90 <option value="nasonia">Nasonia vitripennis</option> | |
| 91 <option value="tomato ">Solanum lycopersicum</option> | |
| 92 <option value="chlamydomonas">Chlamydomonas reinhardtii</option> | |
| 93 <option value="amphimedon ">Amphimedon queenslandica</option> | |
| 94 <option value="pneumocystis ">Pneumocystis jirovecii</option> | |
| 95 </param> | |
| 96 | |
| 97 <param name="strand" type="select" multiple="false" format="text" help="Report predicted genes on both strands, just the forward or just the backward strand."> | |
| 98 <option value="both">both</option> | |
| 99 <option value="forward">forward</option> | |
| 100 <option value="backward">backward</option> | |
| 101 </param> | |
| 102 | |
| 103 <param name="genemodel" label="Gene Model" type="select" multiple="false" format="text" help="Gene Model to predict, for more information please refere to the help."> | |
| 104 <option value="complete">complete</option> | |
| 105 <option value="partial">partial</option> | |
| 106 <option value="intronless">intronless</option> | |
| 107 <option value="atleastone">atleastone</option> | |
| 108 <option value="exactlyone">exactlyone</option> | |
| 109 </param> | |
| 110 | |
| 111 </inputs> | |
| 112 <outputs> | |
| 113 <data format="gtf" name="output"> | |
| 114 <change_format> | |
| 115 <when input="gff" value="--gff3=on" format="gff" /> | |
| 116 </change_format> | |
| 117 </data> | |
| 118 </outputs> | |
| 119 <help> | |
| 120 | |
| 121 **What it does** | |
| 122 | |
| 123 AUGUSTUS is a gene prediction program for eukaryotes written by Mario Stanke and Oliver Keller. | |
| 124 It can be used as an ab initio program, which means it bases its prediction purely on the | |
| 125 sequence. AUGUSTUS may also incorporate hints on the gene structure coming from extrinsic sources | |
| 126 such as EST, MS/MS, protein alignments and synthenic genomic alignments. | |
| 127 | |
| 128 ----- | |
| 129 | |
| 130 **Parameters** | |
| 131 | |
| 132 Gene Model:: | |
| 133 | |
| 134 partial : allow prediction of incomplete genes at the sequence boundaries (default) | |
| 135 intronless : only predict single-exon genes like in prokaryotes and some eukaryotes | |
| 136 complete : only predict complete genes | |
| 137 atleastone : predict at least one complete gene | |
| 138 exactlyone : predict exactly one complete gene | |
| 139 | |
| 140 | |
| 141 | |
| 142 **Example** | |
| 143 | |
| 144 Suppose you have the following DNA formatted sequences:: | |
| 145 | |
| 146 >Seq1 | |
| 147 cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg | |
| 148 ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag | |
| 149 cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc | |
| 150 cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc | |
| 151 ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg | |
| 152 | |
| 153 Running this tool will produce this:: | |
| 154 | |
| 155 # ----- prediction on sequence number 1 (length = 1992969, name = scaffold1|size1992969) ----- | |
| 156 # | |
| 157 # Constraints/Hints: | |
| 158 # (none) | |
| 159 # Predicted genes for sequence number 1 on both strands | |
| 160 # start gene g1 | |
| 161 scaffold1|size1992969 AUGUSTUS gene 17453 19382 0.11 + . g6 | |
| 162 scaffold1|size1992969 AUGUSTUS transcript 17453 19382 0.11 + . g6.t1 | |
| 163 scaffold1|size1992969 AUGUSTUS start_codon 17453 17455 . + 0 transcript_id "g6.t1"; gene_id "g6"; | |
| 164 scaffold1|size1992969 AUGUSTUS intron 17615 17660 0.38 + . transcript_id "g6.t1"; gene_id "g6"; | |
| 165 scaffold1|size1992969 AUGUSTUS intron 17708 17772 0.54 + . transcript_id "g6.t1"; gene_id "g6"; | |
| 166 scaffold1|size1992969 AUGUSTUS intron 17902 18035 0.58 + . transcript_id "g6.t1"; gene_id "g6"; | |
| 167 scaffold1|size1992969 AUGUSTUS intron 18313 18367 0.99 + . transcript_id "g6.t1"; gene_id "g6"; | |
| 168 scaffold1|size1992969 AUGUSTUS intron 19014 19080 0.44 + . transcript_id "g6.t1"; gene_id "g6"; | |
| 169 scaffold1|size1992969 AUGUSTUS CDS 17453 17614 0.55 + 0 transcript_id "g6.t1"; gene_id "g6"; | |
| 170 scaffold1|size1992969 AUGUSTUS CDS 17661 17707 0.38 + 0 transcript_id "g6.t1"; gene_id "g6"; | |
| 171 scaffold1|size1992969 AUGUSTUS CDS 17773 17901 0.54 + 1 transcript_id "g6.t1"; gene_id "g6"; | |
| 172 scaffold1|size1992969 AUGUSTUS CDS 18036 18312 0.52 + 1 transcript_id "g6.t1"; gene_id "g6"; | |
| 173 scaffold1|size1992969 AUGUSTUS CDS 18368 19013 0.99 + 0 transcript_id "g6.t1"; gene_id "g6"; | |
| 174 scaffold1|size1992969 AUGUSTUS CDS 19081 19379 0.31 + 2 transcript_id "g6.t1"; gene_id "g6"; | |
| 175 scaffold1|size1992969 AUGUSTUS stop_codon 19380 19382 . + 0 transcript_id "g6.t1"; gene_id "g6"; | |
| 176 | |
| 177 | |
| 1 | 178 **References** |
| 179 | |
| 180 Mario Stanke and Stephan Waack (2003) | |
| 181 Gene Prediction with a Hidden-Markov Model and a new Intron Submodel. | |
| 182 Bioinformatics, Vol. 19, Suppl. 2, pages ii215-ii225 | |
| 183 | |
| 0 | 184 |
| 185 </help> | |
| 186 </tool> |