|
0
|
1 <tool id="augustus" name="Augustus" version="0.1">
|
|
|
2 <description>gen prediction for eukaryotic genomes</description>
|
|
|
3 <command>augustus
|
|
|
4 --strand=$strand
|
|
|
5 $noInFrameStop
|
|
|
6 $gff
|
|
|
7 $protein
|
|
|
8 $introns
|
|
|
9 $start
|
|
|
10 $stop
|
|
|
11 $cds
|
|
|
12 $codingseq
|
|
|
13 $singlestrand
|
|
|
14 $input_genome
|
|
|
15 --genemodel=$genemodel
|
|
|
16 --species=$organism
|
|
|
17 --outfile=$output
|
|
|
18
|
|
|
19 #please set export AUGUSTUS_CONFIG_PATH=/path_to_augustus/augustus/config
|
|
|
20 #or use the --AUGUSTUS_CONFIG_PATH=path switch
|
|
|
21
|
|
|
22 </command>
|
|
|
23 <inputs>
|
|
|
24 <param name="input_genome" type="data" format="fasta" label="Genome Sequence"/>
|
|
|
25 <param name="noInFrameStop" type="boolean" label="Don't report transcripts with in-frame stop codons. Otherwise, intron-spanning stop codons could occur" truevalue="--noInFrameStop=true" falsevalue="--noInFrameStop=false" checked="false" />
|
|
|
26 <param name="gff" type="boolean" label="GFF formated output, standard is GTF" truevalue="--gff3=on" falsevalue="--gff3=off" checked="false" />
|
|
|
27 <param name="protein" type="boolean" label="Output predicted protein sequences" truevalue="--protein=on" falsevalue="--protein=off" checked="false" />
|
|
|
28 <param name="introns" type="boolean" label="Output predicted intron sequences" truevalue="--introns=on" falsevalue="--introns=off" checked="false" />
|
|
|
29 <param name="start" type="boolean" label="Output predicted start codons" truevalue="--start=on" falsevalue="--start=off" checked="false" />
|
|
|
30 <param name="stop" type="boolean" label="Output predicted stop codons" truevalue="--stop=on" falsevalue="--stop=off" checked="false" />
|
|
|
31 <param name="cds" type="boolean" label="Output CDS region" truevalue="--cds=on" falsevalue="--cds=off" checked="true" />
|
|
|
32 <param name="codingseq" type="boolean" label="Output coding sequence as comment in the output file" truevalue="--codingseq=on" falsevalue="--codingseq=off" checked="false" />
|
|
|
33
|
|
|
34 <param name="singlestrand" type="boolean" label="Predict genes independently on each strand, allow overlapping genes on opposite strands" truevalue="--singlestrand=true" falsevalue="--singlestrand=false" checked="false" />
|
|
|
35
|
|
|
36 <param name="organism" label="Model Organism" type="select" multiple="false" format="text" help="Choose a specialised trainingset.">
|
|
|
37 <option value="human">Homo sapiens</option>
|
|
|
38 <option value="fly">Drosophila melanogaster</option>
|
|
|
39 <option value="arabidopsis">Arabidopsis thaliana</option>
|
|
|
40 <option value="brugia ">Brugia malayi</option>
|
|
|
41 <option value="aedes">Aedes aegypti</option>
|
|
|
42 <option value="tribolium">Tribolium castaneum</option>
|
|
|
43 <option value="schistosoma">Schistosoma mansoni</option>
|
|
|
44 <option value="tetrahymena">Tetrahymena thermophila</option>
|
|
|
45 <option value="galdieria">Galdieria sulphuraria</option>
|
|
|
46 <option value="maize">Zea mays</option>
|
|
|
47 <option value="toxoplasma ">Toxoplasma gondii</option>
|
|
|
48 <option value="caenorhabditis ">Caenorhabditis elegans</option>
|
|
|
49 <option value="aspergillus_fumigatus">Aspergillus fumigatus</option>
|
|
|
50 <option value="aspergillus_nidulans ">Aspergillus nidulans</option>
|
|
|
51 <option value="aspergillus_oryzae ">Aspergillus oryzae</option>
|
|
|
52 <option value="aspergillus_terreus">Aspergillus terreus</option>
|
|
|
53 <option value="botrytis_cinerea ">Botrytis cinerea</option>
|
|
|
54 <option value="candida_albicans ">Candida albicans</option>
|
|
|
55 <option value="candida_guilliermondii ">Candida guilliermondii</option>
|
|
|
56 <option value="candida_tropicalis ">Candida tropicalis</option>
|
|
|
57 <option value="chaetomium_globosum">Chaetomium globosum</option>
|
|
|
58 <option value="coccidioides_immitis ">Coccidioides immitis</option>
|
|
|
59 <option value="coprinus ">Coprinus cinereus</option>
|
|
|
60 <option value="coprinus_cinereus">Coprinus cinereus</option>
|
|
|
61 <option value="cryptococcus_neoformans_gattii ">Cryptococcus neoformans gattii</option>
|
|
|
62 <option value="cryptococcus_neoformans_neoformans_B ">Cryptococcus neoformans neoformans</option>
|
|
|
63 <option value="cryptococcus_neoformans_neoformans_JEC21 ">Cryptococcus neoformans neoformans</option>
|
|
|
64 <option value="debaryomyces_hansenii">Debaryomyces hansenii</option>
|
|
|
65 <option value="encephalitozoon_cuniculi_GB">Encephalitozoon cuniculi</option>
|
|
|
66 <option value="eremothecium_gossypii">Eremothecium gossypii</option>
|
|
|
67 <option value="fusarium_graminearum ">Fusarium graminearum</option>
|
|
|
68 <option value="histoplasma_capsulatum ">Histoplasma capsulatum</option>
|
|
|
69 <option value="(histoplasma)">Histoplasma capsulatum</option>
|
|
|
70 <option value="kluyveromyces_lactis ">Kluyveromyces lactis</option>
|
|
|
71 <option value="laccaria_bicolor ">Laccaria bicolor</option>
|
|
|
72 <option value="lamprey">Petromyzon marinus</option>
|
|
|
73 <option value="leishmania_tarentolae">Leishmania tarentolae</option>
|
|
|
74 <option value="lodderomyces_elongisporus">Lodderomyces elongisporus</option>
|
|
|
75 <option value="magnaporthe_grisea ">Magnaporthe grisea</option>
|
|
|
76 <option value="neurospora_crassa">Neurospora crassa</option>
|
|
|
77 <option value="phanerochaete_chrysosporium">Phanerochaete chrysosporium</option>
|
|
|
78 <option value="pichia_stipitis">Pichia stipitis</option>
|
|
|
79 <option value="rhizopus_oryzae">Rhizopus oryzae</option>
|
|
|
80 <option value="saccharomyces_cerevisiae_S288C ">Saccharomyces cerevisiae</option>
|
|
|
81 <option value="saccharomyces_cerevisiae_rm11-1a_1 ">Saccharomyces cerevisiae</option>
|
|
|
82 <option value="(saccharomyces)">Saccharomyces cerevisiae</option>
|
|
|
83 <option value="schizosaccharomyces_pombe">Schizosaccharomyces pombe</option>
|
|
|
84 <option value="trichinella">Trichinella spiralis</option>
|
|
|
85 <option value="ustilago_maydis">Ustilago maydis</option>
|
|
|
86 <option value="yarrowia_lipolytica">Yarrowia lipolytica</option>
|
|
|
87 <option value="nasonia">Nasonia vitripennis</option>
|
|
|
88 <option value="tomato ">Solanum lycopersicum</option>
|
|
|
89 <option value="chlamydomonas">Chlamydomonas reinhardtii</option>
|
|
|
90 <option value="amphimedon ">Amphimedon queenslandica</option>
|
|
|
91 <option value="pneumocystis ">Pneumocystis jirovecii</option>
|
|
|
92 </param>
|
|
|
93
|
|
|
94 <param name="strand" type="select" multiple="false" format="text" help="Report predicted genes on both strands, just the forward or just the backward strand.">
|
|
|
95 <option value="both">both</option>
|
|
|
96 <option value="forward">forward</option>
|
|
|
97 <option value="backward">backward</option>
|
|
|
98 </param>
|
|
|
99
|
|
|
100 <param name="genemodel" label="Gene Model" type="select" multiple="false" format="text" help="Gene Model to predict, for more information please refere to the help.">
|
|
|
101 <option value="complete">complete</option>
|
|
|
102 <option value="partial">partial</option>
|
|
|
103 <option value="intronless">intronless</option>
|
|
|
104 <option value="atleastone">atleastone</option>
|
|
|
105 <option value="exactlyone">exactlyone</option>
|
|
|
106 </param>
|
|
|
107
|
|
|
108 </inputs>
|
|
|
109 <outputs>
|
|
|
110 <data format="gtf" name="output">
|
|
|
111 <change_format>
|
|
|
112 <when input="gff" value="--gff3=on" format="gff" />
|
|
|
113 </change_format>
|
|
|
114 </data>
|
|
|
115 </outputs>
|
|
|
116 <requirements>
|
|
|
117 <requirement type="binary">augustus</requirement>
|
|
|
118 </requirements>
|
|
|
119 <help>
|
|
|
120
|
|
|
121 **What it does**
|
|
|
122
|
|
|
123 AUGUSTUS is a gene prediction program for eukaryotes written by Mario Stanke and Oliver Keller.
|
|
|
124 It can be used as an ab initio program, which means it bases its prediction purely on the
|
|
|
125 sequence. AUGUSTUS may also incorporate hints on the gene structure coming from extrinsic sources
|
|
|
126 such as EST, MS/MS, protein alignments and synthenic genomic alignments.
|
|
|
127
|
|
|
128 -----
|
|
|
129
|
|
|
130 **Parameters**
|
|
|
131
|
|
|
132 Gene Model::
|
|
|
133
|
|
|
134 partial : allow prediction of incomplete genes at the sequence boundaries (default)
|
|
|
135 intronless : only predict single-exon genes like in prokaryotes and some eukaryotes
|
|
|
136 complete : only predict complete genes
|
|
|
137 atleastone : predict at least one complete gene
|
|
|
138 exactlyone : predict exactly one complete gene
|
|
|
139
|
|
|
140
|
|
|
141
|
|
|
142 **Example**
|
|
|
143
|
|
|
144 Suppose you have the following DNA formatted sequences::
|
|
|
145
|
|
|
146 >Seq1
|
|
|
147 cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg
|
|
|
148 ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag
|
|
|
149 cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc
|
|
|
150 cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc
|
|
|
151 ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg
|
|
|
152
|
|
|
153 Running this tool will produce this::
|
|
|
154
|
|
|
155 # ----- prediction on sequence number 1 (length = 1992969, name = scaffold1|size1992969) -----
|
|
|
156 #
|
|
|
157 # Constraints/Hints:
|
|
|
158 # (none)
|
|
|
159 # Predicted genes for sequence number 1 on both strands
|
|
|
160 # start gene g1
|
|
|
161 scaffold1|size1992969 AUGUSTUS gene 17453 19382 0.11 + . g6
|
|
|
162 scaffold1|size1992969 AUGUSTUS transcript 17453 19382 0.11 + . g6.t1
|
|
|
163 scaffold1|size1992969 AUGUSTUS start_codon 17453 17455 . + 0 transcript_id "g6.t1"; gene_id "g6";
|
|
|
164 scaffold1|size1992969 AUGUSTUS intron 17615 17660 0.38 + . transcript_id "g6.t1"; gene_id "g6";
|
|
|
165 scaffold1|size1992969 AUGUSTUS intron 17708 17772 0.54 + . transcript_id "g6.t1"; gene_id "g6";
|
|
|
166 scaffold1|size1992969 AUGUSTUS intron 17902 18035 0.58 + . transcript_id "g6.t1"; gene_id "g6";
|
|
|
167 scaffold1|size1992969 AUGUSTUS intron 18313 18367 0.99 + . transcript_id "g6.t1"; gene_id "g6";
|
|
|
168 scaffold1|size1992969 AUGUSTUS intron 19014 19080 0.44 + . transcript_id "g6.t1"; gene_id "g6";
|
|
|
169 scaffold1|size1992969 AUGUSTUS CDS 17453 17614 0.55 + 0 transcript_id "g6.t1"; gene_id "g6";
|
|
|
170 scaffold1|size1992969 AUGUSTUS CDS 17661 17707 0.38 + 0 transcript_id "g6.t1"; gene_id "g6";
|
|
|
171 scaffold1|size1992969 AUGUSTUS CDS 17773 17901 0.54 + 1 transcript_id "g6.t1"; gene_id "g6";
|
|
|
172 scaffold1|size1992969 AUGUSTUS CDS 18036 18312 0.52 + 1 transcript_id "g6.t1"; gene_id "g6";
|
|
|
173 scaffold1|size1992969 AUGUSTUS CDS 18368 19013 0.99 + 0 transcript_id "g6.t1"; gene_id "g6";
|
|
|
174 scaffold1|size1992969 AUGUSTUS CDS 19081 19379 0.31 + 2 transcript_id "g6.t1"; gene_id "g6";
|
|
|
175 scaffold1|size1992969 AUGUSTUS stop_codon 19380 19382 . + 0 transcript_id "g6.t1"; gene_id "g6";
|
|
|
176
|
|
|
177
|
|
1
|
178 **References**
|
|
|
179
|
|
|
180 Mario Stanke and Stephan Waack (2003)
|
|
|
181 Gene Prediction with a Hidden-Markov Model and a new Intron Submodel.
|
|
|
182 Bioinformatics, Vol. 19, Suppl. 2, pages ii215-ii225
|
|
|
183
|
|
0
|
184
|
|
|
185 </help>
|
|
|
186 </tool>
|
