Mercurial > repos > brenninc > xdirectory_reader_limited_by_data_table
changeset 0:ccabef3f7d5f draft
Uploaded first version
| author | brenninc |
|---|---|
| date | Sun, 08 May 2016 11:01:03 -0400 |
| parents | |
| children | b2c1bf6f0f86 |
| files | README data_reader.xml directory_copier.py test-data/other.csv test-data/other.fa test-data/other.fasta test-data/other.fasta.gz test-data/sample1.bmp test-data/sample1.csv test-data/sample1.fa test-data/sample1.fasta test-data/sample1.fasta.gz test-data/sample1.fastq test-data/sample1.fastq.gz test-data/sample1.fq test-data/sample1.jpeg test-data/sample1.jpg test-data/sample1.png test-data/sample1.ps test-data/sample1.sam test-data/sample1.tabular test-data/sample1.text test-data/sample1.tiff test-data/sample1.tsv test-data/sample1.txt test-data/sample1.xls test-data/sample1.xlsx test-data/sample2.txt tool-data/black-list.ini tool-data/white-list.ini |
| diffstat | 30 files changed, 1040 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/README Sun May 08 11:01:03 2016 -0400 @@ -0,0 +1,32 @@ +This tool will lookup files on the Galaxy server machine, including mounted directories. + +The user aspects of the tool are explained in the help section of data_reader.xml + +Only directories that are included in the white list and not in the black list are allowed. + +The white and black lists can be changed without the requirement to restart the server as these are read from the tools install directory each time the tool is run. + +==== + +The white list is tool-data/white-list.ini + +Any directory that starts with any entry from this file will be considered to have passed. + +The default file includes a single / so all absolute paths will pass. + +==== + +The black list is tool-data/black-list.ini + +Any directory that contains any of the blacklisted strings anywhere in the path are excluded. + +The default file excludes most of the standard linux systems directories where data is unlikely to be found. + +It also excludes the /galaxy/ pattern to avoid users getting access to galaxy files. + +Also .. and ~ are excluded for security reasons. + + + + +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/data_reader.xml Sun May 08 11:01:03 2016 -0400 @@ -0,0 +1,428 @@ +<tool id="directory_data_reader" name="Directory Data Finder" version="0.2"> + <description>Reads a particular data type from a directory on the server</description> + <command interpreter="python"> +<![CDATA[ + directory_copier.py + #if $results.required=="data" + --ending .${results.extension.file_type} + --link + #if $results.start + --start $results.start + #end if + #if $results.last + --last $results.last + #end if + #if $results.extension.file_type=="fa" + --new_ending .fasta + #end if + #if $results.extension.file_type=="fq" + --new_ending .fastq + #end if + #if $results.extension.file_type=="text" + --new_ending .txt + #end if + #if $results.extension.file_type=="tsv" + --new_ending .tabular + #end if + #if $results.extension.file_type in ["fasta.gz"] + --decompress + --new_ending .fasta + #end if + #if $results.extension.file_type=="fastq" + --new_ending .$results.extension.new_galaxy.new_ending + #end if + #if $results.extension.file_type=="fastq.gz" + --decompress + --new_ending .${results.extension.new_galaxy.new_ending} + #end if + #else + --ending bam + --ending csv + --ending fa + --ending fasta + --ending fasta.gz + --ending fastq + --ending fastq.gz + --ending fasta + --ending fq + --ending sam + --ending tabular + --ending text + --ending tsv + --ending txt + --ending xls + --ending xlsx + #end if + #if $directory.startswith('/'): + --path ${directory} + #else + --path $__tool_directory__/${directory} + #end if + --list ${listing} +]]> + </command> + <inputs> + <param name="directory" type="text" label="Directory to read data from." /> + <param name="list_name" type="text" size="25" label="output name" value="input data"/> + <conditional name="results"> + <param name="required" type="select" label="Download data or just directory listing" help="Select type of action required."> + <option value="data" selected="true">Data and listing of selected type</option> + <option value="listing">Get listing of selected file types </option> + </param> + <when value="data"> + <param name="start" type="text" value="" label="String which must be at the start of each file name" /> + <param name="last" type="text" value="" label="String which must be at the end of the file name (excluding the file type)" /> + <conditional name="extension"> + <param name="file_type" type="select" label="File Type" help="File Type."> + <option value="bam">*.bam files</option> + <option value="csv">*.csv files</option> + <option value="fa">*.fa files Files saved as *.fasta for galaxy</option> + <option value="fasta">*.fasta files</option> + <option value="fasta.gz">*.fasta.gz files</option> + <option value="fastq">*.fastq files</option> + <option value="fastq.gz">*.fastq.gz files</option> + <option value="fastq">*.fastq files</option> + <option value="fastq.gz">*.fastq.gz files</option> + <option value="fq">*.fq files Files saved as *.fastq for galaxy</option> + <option value="sam">*.sam files</option> + <option value="tabular">*.tabular Files</option> + <option value="text">*.text Files saved as *.txt for galaxy</option> + <option value="tsv">*.tsv files saved as *.tabular for galaxy</option> + <option value="txt">*.txt Files</option> + <option value="xls">*.xls files</option> + <option value="xlsx">*.xlsx files</option> + </param> + <when value="bam" /> + <when value="csv" /> + <when value="fa" /> + <when value="fasta" /> + <when value="fasta.gz" /> + <when value="fastq" > + <conditional name="new_galaxy"> + <param name="new_ending" type="select" label="Ending to be used for Galaxy" help="Will determine which down stream tools can be used."> + <option value="fastq" selected="true">Keep data as general fastq format</option> + <option value="fastqsanger">Tag data as fastq sanger in galaxy</option> + <option value="fastqsolexa">Tag data as fastq solexa in galaxy</option> + <option value="fastqillumina">Tag data as fastq illumina in galaxy</option> + </param> + <when value="fastq" /> + <when value="fastqsanger" /> + <when value="fastqsolexa" /> + <when value="fastqillumina" /> + </conditional> + </when> + <when value="fastq.gz" > + <conditional name="new_galaxy"> + <param name="new_ending" type="select" label="Ending to be used for Galaxy" help="Will determine which down stream tools can be used."> + <option value="fastq" selected="true" >Keep data as general fastq format</option> + <option value="fastqsanger">Tag data as fastq sanger in galaxy</option> + <option value="fastqsolexa">Tag data as fastq solexa in galaxy</option> + <option value="fastqillumina">Tag data as fastq illumina in galaxy</option> + </param> + <when value="fastq" /> + <when value="fastqsanger" /> + <when value="fastqsolexa" /> + <when value="fastqillumina" /> + </conditional> + </when> + <when value="fq" /> + <when value="sam" /> + <when value="tabular" /> + <when value="text" /> + <when value="tsv" /> + <when value="txt" /> + <when value="xls" /> + <when value="xlsx" /> + </conditional> + </when> + <when value="listing"> + </when> + </conditional> + </inputs> + <outputs> + <data format="txt" name="listing" label="List of files in $list_name"> + </data> + <!-- Ideally galaxy can get the type based on the file extensions. If so just add the type here --> + <collection type="list" label="$list_name" name="data_collection"> + <filter>(results['required'] == 'data')</filter> + <discover_datasets pattern="__designation_and_ext__" directory="output" visible="true" /> + </collection> + </outputs> + <tests> + <test> + <param name="directory" value="test-data" /> + <param name="list_name" value="csv_files" /> + <param name="results|extension|file_type" value="csv"/> + <output name="listing"> + <assert_contents> + <has_line line="sample1.csv" /> + </assert_contents> + </output> + <output_collection name="data_collection" type="list"> + <element name="sample1" ftype="csv" file="sample1.csv" /> + </output_collection> + </test> + <test> + <param name="directory" value="test-data" /> + <param name="results|extension|file_type" value="fa"/> + <output name="listing"> + <assert_contents> + <has_line line="sample1.fasta" /> + <has_line line="other.fasta" /> + </assert_contents> + </output> + <output_collection name="data_collection" type="list"> + <element name="sample1" ftype="fasta" file="sample1.fasta" /> + <element name="other" ftype="fasta" file="sample1.fasta" /> + </output_collection> + </test> + <test> + <param name="directory" value="test-data" /> + <param name="results|extension|file_type" value="fasta"/> + <param name="results|start" value="sam" /> + <output name="listing"> + <assert_contents> + <has_line line="sample1.fasta" /> + <not_has_text text="other.fasta" /> + </assert_contents> + </output> + <output_collection name="data_collection" type="list"> + <element name="sample1" ftype="fasta" file="sample1.fasta" /> + </output_collection> + </test> + <test> + <param name="directory" value="test-data" /> + <param name="results|extension|file_type" value="fasta.gz"/> + <param name="results|last" value="le1" /> + <output name="listing"> + <assert_contents> + <has_line line="sample1.fasta" /> + <not_has_text text="other.fasta" /> + </assert_contents> + </output> + <output_collection name="data_collection" type="list"> + <element name="sample1" ftype="fasta" file="sample1.fasta" /> + </output_collection> + </test> + <test> + <param name="directory" value="test-data" /> + <param name="results|extension|file_type" value="fq"/> + <output name="listing"> + <assert_contents> + <has_line line="sample1.fastq" /> + </assert_contents> + </output> + <output_collection name="data_collection" type="list"> + <element name="sample1" ftype="fastq" file="sample1.fastq" /> + </output_collection> + </test> + <test> + <param name="directory" value="test-data" /> + <param name="results|extension|file_type" value="fastq"/> + <output name="listing"> + <assert_contents> + <has_line line="sample1.fastq" /> + </assert_contents> + </output> + <output_collection name="data_collection" type="list"> + <element name="sample1" ftype="fastq" file="sample1.fastq" /> + </output_collection> + </test> + <test> + <param name="directory" value="test-data" /> + <param name="results|extension|file_type" value="fastq"/> + <param name="results|extension|new_galaxy|new_ending" value="fastqsanger"/> + <output name="listing"> + <assert_contents> + <has_line line="sample1.fastqsanger" /> + </assert_contents> + </output> + <output_collection name="data_collection" type="list"> + <element name="sample1" ftype="fastqsanger" file="sample1.fastq" /> + </output_collection> + </test> + <test> + <param name="directory" value="test-data" /> + <param name="results|extension|file_type" value="fastq.gz"/> + <output name="data_collection"> + <assert_contents> + <has_line line="sample1.fastq" /> + </assert_contents> + </output> + <output_collection name="data_collection" type="list"> + <element name="sample1" ftype="fastq" file="sample1.fastq" /> + </output_collection> + </test> + <test> + <param name="directory" value="test-data" /> + <param name="results|extension|file_type" value="fastq.gz"/> + <param name="results|extension|new_galaxy|new_ending" value="fastqsanger"/> + <output name="listing_fastq_gz"> + <assert_contents> + <has_line line="sample1.fastqsanger" /> + </assert_contents> + </output> + <output_collection name="data_collection" type="list"> + <element name="sample1" ftype="fastqsanger" file="sample1.fastq" /> + </output_collection> + </test> + <test> + <param name="directory" value="test-data" /> + <param name="results|extension|file_type" value="sam"/> + <output name="listing"> + <assert_contents> + <has_line line="sample1.sam" /> + </assert_contents> + </output> + <output_collection name="data_collection" type="list"> + <element name="sample1" ftype="sam" file="sample1.sam" /> + </output_collection> + </test> + <test> + <param name="directory" value="test-data" /> + <param name="results|extension|file_type" value="tabular"/> + <output name="listing"> + <assert_contents> + <has_line line="sample1.tabular" /> + </assert_contents> + </output> + <output_collection name="data_collection" type="list"> + <element name="sample1" ftype="tabular" file="sample1.tabular" /> + </output_collection> + </test> + <test> + <param name="directory" value="test-data" /> + <param name="results|extension|file_type" value="text"/> + <output name="listing_text"> + <assert_contents> + <has_line line="sample1.txt" /> + </assert_contents> + </output> + <output_collection name="data_collection" type="list"> + <element name="sample1" ftype="txt" file="sample1.text" /> + </output_collection> + </test> + <test> + <param name="directory" value="test-data" /> + <param name="results|extension|file_type" value="tsv"/> + <output name="data_collection"> + <assert_contents> + <has_line line="sample1.tabular" /> + </assert_contents> + </output> + <output_collection name="data_collection" type="list"> + <element name="sample1" ftype="tabular" file="sample1.tsv" /> + </output_collection> + </test> + <test> + <param name="directory" value="test-data" /> + <param name="results|extension|file_type" value="txt" /> + <output name="listing"> + <assert_contents> + <has_line line="sample1.txt" /> + </assert_contents> + </output> + <output_collection name="data_collection" type="list"> + <element name="sample1" ftype="txt" file="sample1.txt" /> + <element name="sample2" ftype="txt" file="sample2.txt" /> + </output_collection> + </test> + <test> + <param name="directory" value="test-data" /> + <param name="results|extension|file_type" value="xls"/> + <output name="listing"> + <assert_contents> + <has_line line="sample1.xls" /> + </assert_contents> + </output> + <output_collection name="data_collection" type="list"> + <element name="sample1" ftype="xls" file="sample1.xls" /> + </output_collection> + </test> + <test> + <param name="directory" value="test-data" /> + <param name="results|extension|file_type" value="xlsx"/> + <output name="listing"> + <assert_contents> + <has_line line="sample1.xlsx" /> + </assert_contents> + </output> + <output_collection name="data_collection" type="list"> + <element name="sample1" ftype="xlsx" file="sample1.xlsx" /> + </output_collection> + </test> + <test> + <param name="directory" value="test-data" /> + <param name="results|required" value="listing"/> + <output name="listing_all"> + <assert_contents> + <has_line line="sample1.csv" /> + <has_line line="sample1.fasta" /> + <has_line line="sample1.fasta.gz" /> + <has_line line="sample1.fastq" /> + <has_line line="sample1.fastq.gz" /> + <has_line line="sample1.sam" /> + <has_line line="sample1.tabular" /> + <has_line line="sample1.text" /> + <has_line line="sample1.tsv" /> + <has_line line="sample1.txt" /> + <has_line line="sample1.xls" /> + <has_line line="sample1.xlsx" /> + </assert_contents> + </output> + </test> + + </tests> + + <help> +<![CDATA[ +This tool will lookup files on the Galaxy server machine, including mounted directories. + +Only directories that are included in the white list and not in the black list are allowed. +If the directory you require does not pass the white list or blacklist test please contact the local galaxy admin. +(Admins see README) + +This tool only supports a limited set of types and file extenstions. +No other files are ever returned either by data or listing. +These endings are case senitive. + +==== + +The data options will look for all files that have a particular ending in the selected directory. + +The tool will return two things. + +1. A Dataset collection of all the detected files. + +2. A file with the names of all the detected files. These will be sorted in the same order as galaxy builds the dataset collection. + +The files can be filtered by setting a specific start strinf for the file name. +Only files that start with this string (case senstive) will be included. + +Files can also be filter for the last part before the file extsentions. + +Assuming the directory has: +C01_R1_001.fasta C01_R2_001.fatsa C02_R1_001.fasta C02_R2_001.fatsa + +Setting start C01 will return just the C01 files: C01_R1_001.fasta C01_R2_001.fatsa + +Setting last R1_001 will return the read1 files: C01_R1_001.fasta C02_R1_001.fasta + +As Galaxy detects the file type based on the extension this tool will change the exstension for supported alternative file ends. + This includes (manually) setting the exstension to fastqsanger, fastqsolexa, fastqillumina for tools that specify one of these. + +This tool will unzip gz files. + +==== + +The listing option will return a txt file with all the files found with any of the supported endings. Other files in that directory are not included. + +The file exstensions are left as in the directory. + +File start and last filters are not supported in this mode. +]]> + </help> + <citations> + </citations> + +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/directory_copier.py Sun May 08 11:01:03 2016 -0400 @@ -0,0 +1,138 @@ +import gzip +import optparse # using optparse as hydra still python 2.6 +import os.path +import shutil +import sys + +def report_error(*args): + sys.stderr.write(' '.join(map(str,args)) + '\n') + sys.stderr.flush() + sys.exit(1) + + +def get_tool_data(name): + root_dir = os.path.dirname((os.path.realpath(__file__))) + path = os.path.join(root_dir,"tool-data",name) + if not(os.path.isfile(path)): + report_error(name,"file not found in tool's tool-data folder. Please ask you galaxy admin to add it back") + return path + + +def check_white_list(path_to_check): + white_list = get_tool_data("white-list.ini") + with open(white_list, 'r') as white_list_file: + for line in white_list_file: + line = line.strip() + if len(line) >= 1 and path_to_check.startswith(line): + return True + report_error(path_to_check,"has not been included in the white list. Please contact the local galaxy admin to add it.") + + +def check_black_list(path_to_check): + black_list = get_tool_data("black-list.ini") + with open(black_list, 'r') as black_list_file: + for line in black_list_file: + line = line.strip() + if len(line) >= 1 and line in path_to_check: + report_error(line,"has been black list so",path_to_check,"is not allowed. Please contact the local galaxy admin to change that, or add a symlink.") + return True + + +def check_pattern_get_new_name(a_file, ending, options): + if options.start: + if not(a_file.startswith(options.start)): + return None + if options.last: + if ending[0] == ".": + last = options.last + ending + else: + if options.last[-1] == ".": + last = options.last + ending + else: + last = options.last + "." + ending + if not(a_file.endswith(last)): + return None + if options.new_ending: + name = a_file[:-len(ending)] + if options.new_ending[0] ==".": + if name[-1] == ".": + name = name[:-1] + return name + options.new_ending + if options.decompress: + if a_file.endswith(".gz"): + return a_file[:-3] + return a_file + + +def check_and_get_new_name(a_file, options): + for ending in options.endings: + if a_file.endswith(ending): + return check_pattern_get_new_name (a_file, ending, options) + return None + + +def link(a_file, new_name, path): + file_path = os.path.join(os.path.realpath(path), a_file) + sym_path = os.path.join(os.path.realpath("output"), new_name) + #if not(os.path.exists(sym_path)): + os.link(file_path, sym_path) + + +def decompress(a_file, new_name, path): + file_path = os.path.join(os.path.realpath(path), a_file) + target_path = os.path.join(os.path.realpath("output"), new_name) + with gzip.open(file_path, 'rb') as f_in, open(target_path, 'wb') as f_out: + shutil.copyfileobj(f_in, f_out) + + +def copy_and_link(path, options): + os.mkdir("output") + with open(options.list, 'w') as list_file: + files = os.listdir(path) + files.sort() + for a_file in files: + new_name = check_and_get_new_name(a_file, options) + if new_name: + list_file.write(new_name) + list_file.write("\n") + if options.decompress: + if a_file.endswith(".gz"): + decompress(a_file, new_name,path) + else: + link(a_file, new_name, path) + elif options.link: + link(a_file, new_name, path) + + +if __name__ == '__main__': + parser = optparse.OptionParser() + parser.add_option("--path", action="store", type="string", + help="Path of directory to check. ") + parser.add_option("--ending", action="append", type="string", dest="endings", + help="Ending that can be listed and if requested linked or decompressed. ") + parser.add_option("--start", action="store", type="string", + help="String that must be at the start of the file name ") + parser.add_option("--last", action="store", type="string", + help="String that must be the last bit of the file name before the endings") + parser.add_option("--new_ending", action="store", type="string", + help="New ending to replace any previous ending in list and if required links or decompressions. Note: If not set decompression will auto remove the compressioned part of the ending") + #parser.add_option("--regex", action="store", type="string", + # help="Regex pattern the file name (less . ending) must match before the endings") + parser.add_option("--list", action="store", type="string", + help="Path to where all files should be listed. ") + parser.add_option("--link", action="store_true", default=False, + help="If set will cause links to be added in output directory. ") + parser.add_option("--decompress", action="store_true", default=False, + help="If set will cause gz files to be decompressed or if not a supported decompression ending linked.") + (options, args) = parser.parse_args() + + + path = options.path.strip() + if path[-1] != '/': + path = path + "/" + check_white_list(path) + print path, "white listed" + check_black_list(path) + print path, "not black listed" + copy_and_link(path, options) +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/other.csv Sun May 08 11:01:03 2016 -0400 @@ -0,0 +1,18 @@ +A,top,line,with,fluff,across,many,columns +more,,,,,,, +stuff,,,,,,, +in,,,,,,, +several,,,,,,, +lines,,,,,,, +then blanks,,,,,,, +,,,,,,, +,,,,,,, +An,the,the,more,the,more,, +unimportant,x,y,unimportant,value,more,, +column,axis,axis,stuff,column,fluff,, +asas,alpha,foo,23,2,999,, +dad,alpha,bar,21,3,23,, +sd,beta,foo,21,999,34,, +wwd,gamma,foo,34,3,999,, +sd,gamma,bar,32,5,23,, +sdee,beta,bar,323,5,23,,
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/other.fa Sun May 08 11:01:03 2016 -0400 @@ -0,0 +1,7 @@ +@SRR566546.970 HWUSI-EAS1673_11067_FC7070M:4:1:2299:1109 length=50 +TTGCCTGCCTATCATTTTAGTGCCTGTGAGGTGGAGATGTGAGGATCAGT +@SRR566546.971 HWUSI-EAS1673_11067_FC7070M:4:1:2374:1108 length=50 +GATTTGTATGAAAGTATACAACTAAAACTGCAGGTGGATCAGAGTAAGTC +@SRR566546.972 HWUSI-EAS1673_11067_FC7070M:4:1:2438:1109 length=50 +TGCATGATCTTCAGTGCCAGGACCTTATCAAGCGGTTTGGTCCCTTTGTT +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/other.fasta Sun May 08 11:01:03 2016 -0400 @@ -0,0 +1,7 @@ +@SRR566546.970 HWUSI-EAS1673_11067_FC7070M:4:1:2299:1109 length=50 +TTGCCTGCCTATCATTTTAGTGCCTGTGAGGTGGAGATGTGAGGATCAGT +@SRR566546.971 HWUSI-EAS1673_11067_FC7070M:4:1:2374:1108 length=50 +GATTTGTATGAAAGTATACAACTAAAACTGCAGGTGGATCAGAGTAAGTC +@SRR566546.972 HWUSI-EAS1673_11067_FC7070M:4:1:2438:1109 length=50 +TGCATGATCTTCAGTGCCAGGACCTTATCAAGCGGTTTGGTCCCTTTGTT +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample1.csv Sun May 08 11:01:03 2016 -0400 @@ -0,0 +1,18 @@ +A,top,line,with,fluff,across,many,columns +more,,,,,,, +stuff,,,,,,, +in,,,,,,, +several,,,,,,, +lines,,,,,,, +then blanks,,,,,,, +,,,,,,, +,,,,,,, +An,the,the,more,the,more,, +unimportant,x,y,unimportant,value,more,, +column,axis,axis,stuff,column,fluff,, +asas,alpha,foo,23,2,999,, +dad,alpha,bar,21,3,23,, +sd,beta,foo,21,999,34,, +wwd,gamma,foo,34,3,999,, +sd,gamma,bar,32,5,23,, +sdee,beta,bar,323,5,23,,
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample1.fa Sun May 08 11:01:03 2016 -0400 @@ -0,0 +1,7 @@ +@SRR566546.970 HWUSI-EAS1673_11067_FC7070M:4:1:2299:1109 length=50 +TTGCCTGCCTATCATTTTAGTGCCTGTGAGGTGGAGATGTGAGGATCAGT +@SRR566546.971 HWUSI-EAS1673_11067_FC7070M:4:1:2374:1108 length=50 +GATTTGTATGAAAGTATACAACTAAAACTGCAGGTGGATCAGAGTAAGTC +@SRR566546.972 HWUSI-EAS1673_11067_FC7070M:4:1:2438:1109 length=50 +TGCATGATCTTCAGTGCCAGGACCTTATCAAGCGGTTTGGTCCCTTTGTT +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample1.fasta Sun May 08 11:01:03 2016 -0400 @@ -0,0 +1,7 @@ +@SRR566546.970 HWUSI-EAS1673_11067_FC7070M:4:1:2299:1109 length=50 +TTGCCTGCCTATCATTTTAGTGCCTGTGAGGTGGAGATGTGAGGATCAGT +@SRR566546.971 HWUSI-EAS1673_11067_FC7070M:4:1:2374:1108 length=50 +GATTTGTATGAAAGTATACAACTAAAACTGCAGGTGGATCAGAGTAAGTC +@SRR566546.972 HWUSI-EAS1673_11067_FC7070M:4:1:2438:1109 length=50 +TGCATGATCTTCAGTGCCAGGACCTTATCAAGCGGTTTGGTCCCTTTGTT +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample1.fastq Sun May 08 11:01:03 2016 -0400 @@ -0,0 +1,12 @@ +@SRR566546.970 HWUSI-EAS1673_11067_FC7070M:4:1:2299:1109 length=50 +TTGCCTGCCTATCATTTTAGTGCCTGTGAGGTGGAGATGTGAGGATCAGT ++SRR566546.970 HWUSI-EAS1673_11067_FC7070M:4:1:2299:1109 length=50 +hhhhhhhhhhghhghhhhhfhhhhhfffffe`ee[`X]b[d[ed`[Y[^Y +@SRR566546.971 HWUSI-EAS1673_11067_FC7070M:4:1:2374:1108 length=50 +GATTTGTATGAAAGTATACAACTAAAACTGCAGGTGGATCAGAGTAAGTC ++SRR566546.971 HWUSI-EAS1673_11067_FC7070M:4:1:2374:1108 length=50 +hhhhgfhhcghghggfcffdhfehhhhcehdchhdhahehffffde`bVd +@SRR566546.972 HWUSI-EAS1673_11067_FC7070M:4:1:2438:1109 length=50 +TGCATGATCTTCAGTGCCAGGACCTTATCAAGCGGTTTGGTCCCTTTGTT ++SRR566546.972 HWUSI-EAS1673_11067_FC7070M:4:1:2438:1109 length=50 +dhhhgchhhghhhfhhhhhdhhhhehhghfhhhchfddffcffafhfghe
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample1.fq Sun May 08 11:01:03 2016 -0400 @@ -0,0 +1,12 @@ +@SRR566546.970 HWUSI-EAS1673_11067_FC7070M:4:1:2299:1109 length=50 +TTGCCTGCCTATCATTTTAGTGCCTGTGAGGTGGAGATGTGAGGATCAGT ++SRR566546.970 HWUSI-EAS1673_11067_FC7070M:4:1:2299:1109 length=50 +hhhhhhhhhhghhghhhhhfhhhhhfffffe`ee[`X]b[d[ed`[Y[^Y +@SRR566546.971 HWUSI-EAS1673_11067_FC7070M:4:1:2374:1108 length=50 +GATTTGTATGAAAGTATACAACTAAAACTGCAGGTGGATCAGAGTAAGTC ++SRR566546.971 HWUSI-EAS1673_11067_FC7070M:4:1:2374:1108 length=50 +hhhhgfhhcghghggfcffdhfehhhhcehdchhdhahehffffde`bVd +@SRR566546.972 HWUSI-EAS1673_11067_FC7070M:4:1:2438:1109 length=50 +TGCATGATCTTCAGTGCCAGGACCTTATCAAGCGGTTTGGTCCCTTTGTT ++SRR566546.972 HWUSI-EAS1673_11067_FC7070M:4:1:2438:1109 length=50 +dhhhgchhhghhhfhhhhhdhhhhehhghfhhhchfddffcffafhfghe
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample1.ps Sun May 08 11:01:03 2016 -0400 @@ -0,0 +1,284 @@ +%!PS-Adobe-3.0 EPSF-3.0 +%%DocumentNeededResources: font Helvetica +%%+ font Helvetica-Bold +%%+ font Helvetica-Oblique +%%+ font Helvetica-BoldOblique +%%+ font Symbol +%%Title: R Graphics Output +%%Creator: R Software +%%Pages: (atend) +%%BoundingBox: 0 0 720 720 +%%EndComments +%%BeginProlog +/bp { gs sRGB gs } def +% begin .ps.prolog +/gs { gsave } bind def +/gr { grestore } bind def +/ep { showpage gr gr } bind def +/m { moveto } bind def +/l { rlineto } bind def +/np { newpath } bind def +/cp { closepath } bind def +/f { fill } bind def +/o { stroke } bind def +/c { newpath 0 360 arc } bind def +/r { 4 2 roll moveto 1 copy 3 -1 roll exch 0 exch rlineto 0 rlineto -1 mul 0 exch rlineto closepath } bind def +/p1 { stroke } bind def +/p2 { gsave bg fill grestore newpath } bind def +/p3 { gsave bg fill grestore stroke } bind def +/p6 { gsave bg eofill grestore newpath } bind def +/p7 { gsave bg eofill grestore stroke } bind def +/t { 5 -2 roll moveto gsave rotate + 1 index stringwidth pop + mul neg 0 rmoveto show grestore } bind def +/ta { 4 -2 roll moveto gsave rotate show } bind def +/tb { 2 -1 roll 0 rmoveto show } bind def +/cl { grestore gsave newpath 3 index 3 index moveto 1 index + 4 -1 roll lineto exch 1 index lineto lineto + closepath clip newpath } bind def +/rgb { setrgbcolor } bind def +/s { scalefont setfont } bind def +% end .ps.prolog +/sRGB { [ /CIEBasedABC + << /DecodeLMN + [ { dup 0.03928 le + {12.92321 div} + {0.055 add 1.055 div 2.4 exp } + ifelse + } bind dup dup + ] + /MatrixLMN [0.412457 0.212673 0.019334 + 0.357576 0.715152 0.119192 + 0.180437 0.072175 0.950301] + /WhitePoint [0.9505 1.0 1.0890] + >> + ] setcolorspace } bind def +/srgb { setcolor } bind def +%%IncludeResource: font Helvetica +/Helvetica findfont +dup length dict begin + {1 index /FID ne {def} {pop pop} ifelse} forall + /Encoding ISOLatin1Encoding def + currentdict + end +/Font1 exch definefont pop +%%IncludeResource: font Helvetica-Bold +/Helvetica-Bold findfont +dup length dict begin + {1 index /FID ne {def} {pop pop} ifelse} forall + /Encoding ISOLatin1Encoding def + currentdict + end +/Font2 exch definefont pop +%%IncludeResource: font Helvetica-Oblique +/Helvetica-Oblique findfont +dup length dict begin + {1 index /FID ne {def} {pop pop} ifelse} forall + /Encoding ISOLatin1Encoding def + currentdict + end +/Font3 exch definefont pop +%%IncludeResource: font Helvetica-BoldOblique +/Helvetica-BoldOblique findfont +dup length dict begin + {1 index /FID ne {def} {pop pop} ifelse} forall + /Encoding ISOLatin1Encoding def + currentdict + end +/Font4 exch definefont pop +%%IncludeResource: font Symbol +/Symbol findfont +dup length dict begin + {1 index /FID ne {def} {pop pop} ifelse} forall + currentdict + end +/Font5 exch definefont pop +%%EndProlog +%%Page: 1 1 +bp +59.04 433.44 689.76 660.96 cl +0 0 0 srgb +2.25 setlinewidth +[] 0 setdash +0 setlinecap +1 setlinejoin +10.00 setmiterlimit +np +101.87 476.98 m +155.73 0 l +o +0.75 setlinewidth +[ 2.25 3.75] 0 setdash +1 setlinecap +np +179.73 441.87 m +0 0 l +o +np +179.73 512.09 m +0 0 l +o +0.75 setlinewidth +[] 0 setdash +np +140.80 441.87 m +77.87 0 l +o +np +140.80 512.09 m +77.87 0 l +o +np +101.87 441.87 m +155.73 0 l +0 70.22 l +-155.73 0 l +0 -70.22 l +o +2.25 setlinewidth +[] 0 setdash +0 setlinecap +np +296.53 652.53 m +155.74 0 l +o +0.75 setlinewidth +[ 2.25 3.75] 0 setdash +1 setlinecap +np +374.40 652.53 m +0 0 l +o +np +374.40 652.53 m +0 0 l +o +0.75 setlinewidth +[] 0 setdash +np +335.47 652.53 m +77.86 0 l +o +np +335.47 652.53 m +77.86 0 l +o +np +296.53 652.53 m +155.74 0 l +0 0 l +-155.74 0 l +0 0 l +o +2.25 setlinewidth +[] 0 setdash +0 setlinecap +np +491.20 582.31 m +155.73 0 l +o +0.75 setlinewidth +[ 2.25 3.75] 0 setdash +1 setlinecap +np +569.07 512.09 m +0 0 l +o +np +569.07 652.53 m +0 0 l +o +0.75 setlinewidth +[] 0 setdash +np +530.13 512.09 m +77.87 0 l +o +np +530.13 652.53 m +77.87 0 l +o +np +491.20 512.09 m +155.73 0 l +0 140.44 l +-155.73 0 l +0 -140.44 l +o +0.00 0.00 720.00 720.00 cl +0 0 0 srgb +0.75 setlinewidth +[] 0 setdash +1 setlinecap +1 setlinejoin +10.00 setmiterlimit +np +179.73 433.44 m +389.34 0 l +o +np +179.73 433.44 m +0 -7.20 l +o +np +374.40 433.44 m +0 -7.20 l +o +np +569.07 433.44 m +0 -7.20 l +o +/Font1 findfont 7 s +182.25 419.04 (alpha) 1 90 t +376.91 419.04 (beta) 1 90 t +571.58 419.04 (gamma) 1 90 t +np +59.04 441.87 m +0 210.66 l +o +np +59.04 441.87 m +-7.20 0 l +o +np +59.04 476.98 m +-7.20 0 l +o +np +59.04 512.09 m +-7.20 0 l +o +np +59.04 547.20 m +-7.20 0 l +o +np +59.04 582.31 m +-7.20 0 l +o +np +59.04 617.42 m +-7.20 0 l +o +np +59.04 652.53 m +-7.20 0 l +o +44.64 439.35 (2.0) 1 0 t +44.64 474.46 (2.5) 1 0 t +44.64 509.58 (3.0) 1 0 t +44.64 544.69 (3.5) 1 0 t +44.64 579.80 (4.0) 1 0 t +44.64 614.91 (4.5) 1 0 t +44.64 650.02 (5.0) 1 0 t +np +59.04 433.44 m +630.72 0 l +0 227.52 l +-630.72 0 l +0 -227.52 l +o +ep +%%Trailer +%%Pages: 1 +%%EOF
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample1.sam Sun May 08 11:01:03 2016 -0400 @@ -0,0 +1,14 @@ +@SQ SN:ref LN:45 +@SQ SN:ref2 LN:40 +r001 163 ref 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 +r002 0 ref 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * +r003 0 ref 9 30 5H6M * 0 0 AGCTAA * +r004 0 ref 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * +r003 16 ref 29 30 6H5M * 0 0 TAGGC * +r001 83 ref 37 30 9M = 7 -39 CAGCGCCAT * +x1 0 ref2 1 30 20M * 0 0 aggttttataaaacaaataa ???????????????????? +x2 0 ref2 2 30 21M * 0 0 ggttttataaaacaaataatt ????????????????????? +x3 0 ref2 6 30 9M4I13M * 0 0 ttataaaacAAATaattaagtctaca ?????????????????????????? +x4 0 ref2 10 30 25M * 0 0 CaaaTaattaagtctacagagcaac ????????????????????????? +x5 0 ref2 12 30 24M * 0 0 aaTaattaagtctacagagcaact ???????????????????????? +x6 0 ref2 14 30 23M * 0 0 Taattaagtctacagagcaacta ???????????????????????
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample1.tabular Sun May 08 11:01:03 2016 -0400 @@ -0,0 +1,7 @@ +An_unimportant_column the_x_axis the_y_axis stuff the_value_column more_more_fluff +13 asas alpha foo 23 2 999 +14 dad alpha bar 21 3 23 +15 sd beta foo 21 999 34 +16 wwd gamma foo 34 3 999 +17 sd gamma bar 32 5 23 +18 sdee beta bar 323 5 23
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample1.text Sun May 08 11:01:03 2016 -0400 @@ -0,0 +1,1 @@ +text1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample1.tsv Sun May 08 11:01:03 2016 -0400 @@ -0,0 +1,7 @@ +An_unimportant_column the_x_axis the_y_axis stuff the_value_column more_more_fluff +13 asas alpha foo 23 2 999 +14 dad alpha bar 21 3 23 +15 sd beta foo 21 999 34 +16 wwd gamma foo 34 3 999 +17 sd gamma bar 32 5 23 +18 sdee beta bar 323 5 23
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample1.txt Sun May 08 11:01:03 2016 -0400 @@ -0,0 +1,1 @@ +1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample2.txt Sun May 08 11:01:03 2016 -0400 @@ -0,0 +1,1 @@ +2
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/black-list.ini Sun May 08 11:01:03 2016 -0400 @@ -0,0 +1,24 @@ +# This file only works if saved as {tool}/tool-data/black_list.ini +# It may be empty but it must exists + +# Parts of paths that will be blocked even if whitelisted. +# so for example /usr/home/galaxy/ will be blocked if /galaxy/ if nlisted here + +/bin/ +/boot/ +/dev/ +/galaxy/ +/lib/ +/lib32/ +/lib64/ +/media/ +/opt/ +/root/ +/run/ +/sbin/ +/srv/ +/sys/ +/var/ +/usr/ +.. +~
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/white-list.ini Sun May 08 11:01:03 2016 -0400 @@ -0,0 +1,15 @@ +# This file only works if saved as {tool}/tool-data/white_list.ini + +# Start of paths that will be accepted by the directory reader +# No jokers including * currently supported. +# Even files listed here will be checked against the black list + +# To accept all paths just keep line with a single slash +/ + +# Add directories absolulute for example +/home/joe_blog/galaxy_data + +# relative test_data as it only make sense for planemo tests +test-data/ +