Mercurial > repos > bvalot > in_sillico_pcr

comparison qpcr_search.xml @ 0:1f4836da4a14 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bvalot/galaxy commit d57c24d4b2c0c741d572af9ca0d09f8b82689640
author bvalot
date Tue, 14 Jun 2022 08:52:22 +0000
parents
children
comparison
equal deleted inserted replaced
-1:000000000000 0:1f4836da4a14
1 <tool id="qpcr_search_wrapper" name="qPCR Search" version="0.1">
2 <description></description>
3 <requirements>
4 <requirement type="package" version="1.28">gassst</requirement>
5 <requirement type="package" version="1.78">biopython</requirement>
6 </requirements>
7 <stdio>
8 <exit_code range="1:" level="fatal" />
9 </stdio>
10 <version_command>$__tool_directory__/qpcr_search.py -v</version_command>
11 <command>
12 $__tool_directory__/qpcr_search.py -o $output
13 #if str($error)
14 -e $error
15 #end if
16 #if str($min)
17 -m $min
18 #end if
19 #if str($max)
20 -M $max
21 #end if
22 #if $taxo
23 -t
24 #end if
25 $forward $probe $reverse $database 2> $logfile
26 </command>
27
28 <inputs>
29 <param name="database" type="data" format="fasta" label="Database to search on fasta" help="FASTA format" />
30 <param name="forward" type="text" value="" optional="false" size="50"
31 label="Forward primer sequence"
32 help="DNA sequence, letters corresponding to multiple nucleotide allowed" />
33 <param name="probe" type="text" value="" optional="false" size="50"
34 label="Probe sequence"
35 help="DNA sequence, letters corresponding to multiple nucleotide allowed" />
36 <param name="reverse" type="text" value="" optional="false" size="50"
37 label="Reverse primer sequence"
38 help="DNA sequence, letters corresponding to multiple nucleotide allowed" />
39 <param name="error" type="integer" value="1" optional="true"
40 label="Maximun error allowed on match" help="Number of mismatch allowed for each primer" />
41 <param name="min" type="integer" value="50" optional="true"
42 label="Min len amplicon size" help="Only amplicon with this minimun length were reported" />
43 <param name="max" type="integer" value="200" optional="true"
44 label="Max len amplicon size" help="Only amplicon with this maximun length were reported" />
45 <param name="taxo" type="boolean" checked="false"
46 label="If set, parse description to report species only" />
47 </inputs>
48
49 <outputs>
50 <data name="logfile" format="txt" label="${tool.name} on ${on_string}: log" />
51 <data name="output" format="txt" label="${tool.name} on ${on_string}: search" />
52 </outputs>
53 <tests>
54 <test expect_num_outputs="2">
55 <param name="database" value="input.fasta" />
56 <param name="forward" value="TTCAACTTCGGCGACTTCC" />
57 <param name="probe" value="CGGTGCGCCCGATCGCCGGTACCCG" />
58 <param name="reverse" value="TCTTCGTTGATCCCGCGC" />
59 <param name="error" value="2" />
60 <output name="output" file="qpcr.txt" ftype="txt" />
61 </test>
62 </tests>
63 <help>
64 **What it does**
65
66 Search qPCR primer/probe on database and return position and errors.
67
68 **License and citation**
69
70 This Galaxy tool is Copyright © 2018 `B. Valot` and is released under the `GPL3 license`.
71
72 This tool uses Gassst, which is licensed separately.
73 Please cite: Rizk G. and Dominique Lavenier D. (2010) GASSST: global alignment short sequence search tool. *Bioinformatics* 26(20), 2534-2540.
74 http://www.irisa.fr/symbiose/projects/gassst/
75 </help>
76 <citations>
77 <citation type="doi">10.1093/bioinformatics/btq485</citation>
78 </citations>
79 </tool>