<tool id="qpcr_search_wrapper" name="qPCR Search" version="0.1">
  <description></description>
  <requirements>
    <requirement type="package" version="1.28">gassst</requirement>
	<requirement type="package" version="1.78">biopython</requirement>
  </requirements>
  <stdio>
    <exit_code range="1:" level="fatal" />
  </stdio>
  <version_command>$__tool_directory__/qpcr_search.py -v</version_command>
  <command>
    $__tool_directory__/qpcr_search.py -o $output 
    #if str($error)
      -e $error
    #end if
    #if str($min)
      -m $min
    #end if
    #if str($max)
      -M $max
    #end if
    #if $taxo
      -t
    #end if
    $forward $probe $reverse $database 2> $logfile
  </command>

  <inputs>
    <param name="database" type="data" format="fasta" label="Database to search on fasta" help="FASTA format" />
	<param name="forward" type="text" value="" optional="false" size="50"
		   label="Forward primer sequence"
		   help="DNA sequence, letters corresponding to multiple nucleotide allowed" />
	<param name="probe" type="text" value="" optional="false" size="50"
		   label="Probe sequence"
		   help="DNA sequence, letters corresponding to multiple nucleotide allowed" />
	<param name="reverse" type="text" value="" optional="false" size="50"
		   label="Reverse primer sequence"
		   help="DNA sequence, letters corresponding to multiple nucleotide allowed" />
    <param name="error" type="integer" value="1" optional="true"
		   label="Maximun error allowed on match" help="Number of mismatch allowed for each primer" />
    <param name="min" type="integer" value="50" optional="true"
		   label="Min len amplicon size" help="Only amplicon with this minimun length were reported" />
    <param name="max" type="integer" value="200" optional="true"
		   label="Max len amplicon size" help="Only amplicon with this maximun length were reported" />
    <param name="taxo" type="boolean" checked="false"
		   label="If set, parse description to report species only" />
  </inputs>

  <outputs>
    <data name="logfile" format="txt" label="${tool.name} on ${on_string}: log" />
    <data name="output" format="txt" label="${tool.name} on ${on_string}: search" />
  </outputs>
  <tests>
	<test expect_num_outputs="2">
      <param name="database" value="input.fasta" />
      <param name="forward" value="TTCAACTTCGGCGACTTCC" />
      <param name="probe" value="CGGTGCGCCCGATCGCCGGTACCCG" />
      <param name="reverse" value="TCTTCGTTGATCCCGCGC" />
      <param name="error" value="2" />
      <output name="output" file="qpcr.txt" ftype="txt" />
    </test>
  </tests>
  <help>
**What it does**

Search qPCR primer/probe on database and return position and errors.

**License and citation**

This Galaxy tool is Copyright © 2018 `B. Valot` and is released under the `GPL3 license`.

This tool uses Gassst, which is licensed separately.
Please cite: Rizk G. and Dominique Lavenier D. (2010) GASSST: global alignment short sequence search tool. *Bioinformatics* 26(20), 2534-2540.
http://www.irisa.fr/symbiose/projects/gassst/
  </help>
  <citations>
	<citation type="doi">10.1093/bioinformatics/btq485</citation>
  </citations>
</tool>