Mercurial > repos > cpt > cpt_fasta_remove_id

comparison fasta_remove_id.xml @ 3:03414db20efc draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload commit 94b0cd1fff0826c6db3e7dc0c91c0c5a8be8bb0c
author cpt
date Mon, 05 Jun 2023 02:41:42 +0000
parents
children 90f549221976
comparison
equal deleted inserted replaced
2:78222649a59a 3:03414db20efc
1 <tool id="edu.tamu.cpt.fasta.remove_desc" name="Remove Description" version="19.1.0.0">
2 <description>from fasta file</description>
3 <macros>
4 <import>macros.xml</import>
5 <import>cpt-macros.xml</import>
6 </macros>
7 <expand macro="requirements"/>
8 <command detect_errors="aggressive"><![CDATA[
9 '$__tool_directory__/fasta_remove_id.py'
10 @SEQUENCE@
11 > '$out' ]]>
12 </command>
13 <inputs>
14 <expand macro="input/fasta"/>
15 </inputs>
16 <outputs>
17 <data format="fasta" name="out"/>
18 </outputs>
19 <tests>
20 <test>
21 <param name="sequences" value="T7_RemIDIn.fasta"/>
22 <output name="out" file="T7_RemIDOut.fasta"/>
23 </test>
24 </tests>
25 <help>
26 **What it does**
27
28 From an input FASTA file, removes the "description" field (all characters after
29 the first space in the top line until a return) after the FASTA ID (from the &gt;
30 to the first space).
31
32 This is a permanent removal of the description. It is useful for tools that
33 behave in unexpected ways if it is present, e.g. Glimmer/GeneMarkS.
34
35 **Example Input/Output**
36
37 For an input FASTA file::
38
39 &gt;1|random sequence|A: 0.25|C: 0.25|G: 0.25|T: 0.25|length: 288 bp
40 acttacgcggagagatgagaccaacgctcgcctaggggcacgcttgtaattgacttatct
41 &gt;2|random sequence|A: 0.25|C: 0.25|G: 0.25|T: 0.25|length: 232 bp
42 gttggggacccacctatcagggagtgtagtagtataagactgtccaataccccccaacat
43
44 The resulting FASTA will contain only IDs without a description::
45
46 &gt;1|random
47 acttacgcggagagatgagaccaacgctcgcctaggggcacgcttgtaattgacttatct
48 &gt;2|random
49 gttggggacccacctatcagggagtgtagtagtataagactgtccaataccccccaacat
50 </help>
51 <expand macro="citations"/>
52 </tool>