--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/fasta_remove_id.xml	Mon Jun 05 02:41:42 2023 +0000
@@ -0,0 +1,52 @@
+<tool id="edu.tamu.cpt.fasta.remove_desc" name="Remove Description" version="19.1.0.0">
+    <description>from fasta file</description>
+    <macros>
+        <import>macros.xml</import>
+        <import>cpt-macros.xml</import>
+    </macros>
+    <expand macro="requirements"/>
+    <command detect_errors="aggressive"><![CDATA[
+'$__tool_directory__/fasta_remove_id.py'
+@SEQUENCE@
+> '$out' ]]>
+</command>
+    <inputs>
+        <expand macro="input/fasta"/>
+    </inputs>
+    <outputs>
+        <data format="fasta" name="out"/>
+    </outputs>
+    <tests>
+        <test>
+            <param name="sequences" value="T7_RemIDIn.fasta"/>
+            <output name="out" file="T7_RemIDOut.fasta"/>
+        </test>
+    </tests>
+    <help>
+**What it does**
+
+From an input FASTA file, removes the "description" field (all characters after
+the first space in the top line until a return) after the FASTA ID (from the &gt; 
+to the first space).
+		
+This is a permanent removal of the description. It is useful for tools that 
+behave in unexpected ways if it is present, e.g. Glimmer/GeneMarkS.
+
+**Example Input/Output**
+
+For an input FASTA file::
+
+	&gt;1|random sequence|A: 0.25|C: 0.25|G: 0.25|T: 0.25|length: 288 bp
+	acttacgcggagagatgagaccaacgctcgcctaggggcacgcttgtaattgacttatct
+	&gt;2|random sequence|A: 0.25|C: 0.25|G: 0.25|T: 0.25|length: 232 bp
+	gttggggacccacctatcagggagtgtagtagtataagactgtccaataccccccaacat
+
+The resulting FASTA will contain only IDs without a description::
+
+	&gt;1|random
+	acttacgcggagagatgagaccaacgctcgcctaggggcacgcttgtaattgacttatct
+	&gt;2|random
+	gttggggacccacctatcagggagtgtagtagtataagactgtccaataccccccaacat
+	</help>
+    <expand macro="citations"/>
+</tool>