Mercurial > repos > davide-albanese > qiime_1_6_0
annotate check_id_map.xml @ 3:3e5da170ffdd draft
check_id_map: version fixed
| author | Davide Albanese <davide.albanese@gmail.com> |
|---|---|
| date | Sat, 09 Mar 2013 22:05:13 +0100 |
| parents | 2280c43de0e2 |
| children | 51eb500d6526 |
| rev | line source |
|---|---|
| 0 | 1 <?xml version="1.0" ?> |
|
3
3e5da170ffdd
check_id_map: version fixed
Davide Albanese <davide.albanese@gmail.com>
parents:
2
diff
changeset
|
2 <tool id="check_id_map" name="Check ID Map" version="1.6.0-1"> |
| 0 | 3 <description> |
| 4 Checks user's metadata mapping file for required data, valid | |
| 5 format | |
| 6 </description> | |
| 7 <requirements> | |
| 8 <requirement type="package">qiime</requirement> | |
| 9 </requirements> | |
| 10 <command>check_id_map.py | |
| 11 | |
| 12 -m $mapping_fp | |
| 13 | |
| 14 #if str($char_replace): | |
| 15 -c $char_replace | |
| 16 #end if | |
| 17 | |
| 18 #if $not_barcoded: | |
| 19 -b | |
| 20 #end if | |
| 21 | |
| 22 #if $variable_len_barcodes: | |
| 23 -B | |
| 24 #end if | |
| 25 | |
| 26 #if $disable_primer_check: | |
| 27 -p | |
| 28 #end if | |
| 29 | |
| 30 #if str($added_demultiplex_field): | |
| 31 -j $added_demultiplex_field | |
| 32 #end if | |
| 33 ; | |
| 34 rm `basename $mapping_fp .txt`'.html' | |
| 35 ; | |
| 36 rm overlib.js | |
| 37 ; | |
| 38 mv `basename $mapping_fp .txt`'.log' $out_log | |
| 39 ; | |
| 40 mv `basename $mapping_fp .txt`'_corrected.txt' $out_txt | |
| 41 </command> | |
| 42 <inputs> | |
| 43 <param name="mapping_fp" label="Metadata mapping file" optional="False" type="data" format="tabular"/> | |
| 44 | |
| 45 <param name="char_replace" value="_" label="Character used to replace invalid characters found in the mapping file. Must be a valid character (alphanumeric, period, or underscore)" optional="False" type="text"/> | |
| 46 | |
| 47 <param name="not_barcoded" label="Set if barcodes are not present. BarcodeSequence header still required" selected="False" type="boolean"/> | |
| 48 | |
| 49 <param name="variable_len_barcodes" label="Set if variable length barcodes are present to suppress warnings about barcodes of unequal length" selected="False" type="boolean"/> | |
| 50 | |
| 51 <param name="disable_primer_check" label="Set to disable checks for primers. LinkerPrimerSequence header still required" selected="False" type="boolean"/> | |
| 52 | |
| 53 <param name="added_demultiplex_field" label="Use to add a field to use in the mapping file as additional demultiplexing (can be used with or without barcodes). All combinations of barcodes/primers and the these fields must be unique. The fields must contain values that can be parsed from the fasta labels such as 'plate=R_2008_12_09'. In this case, 'plate' would be the column header and 'R_2008_12_09' would be the field data (minus quotes) in the mapping file. To use the run prefix from the fasta label, such as '>FLP3FBN01ELBSX', where 'FLP3FBN01' is generated from the run ID, use '-j run_prefix' and set the run prefix to be used as the data under the column header 'run_prefix'" optional="False" type="text" value=""/> | |
| 54 </inputs> | |
| 55 <outputs> | |
| 56 <data format="txt" name="out_log" label="${tool.name} on ${mapping_fp.name}"/> | |
| 57 <data format="tabular" name="out_txt" label="Corrected ${mapping_fp.name}"/> | |
| 58 </outputs> | |
| 59 <help> | |
| 60 | |
|
2
2280c43de0e2
check_id_map 1.6.1
Davide Albanese <davide.albanese@gmail.com>
parents:
0
diff
changeset
|
61 Check ID Map checks:: |
| 0 | 62 |
| 63 1. The BarcodeSequence, LinkerPrimerSequences, and ReversePrimer fields | |
| 64 have valid IUPAC DNA characters, and BarcodeSequence characters | |
| 65 are non-degenerate (error) | |
| 66 | |
| 67 2. The SampleID, BarcodeSequence, LinkerPrimerSequence, and Description | |
| 68 headers are present (error) | |
| 69 | |
| 70 3. There are not duplicate header fields (error) | |
| 71 | |
| 72 4. There are not duplicate barcodes (error) | |
| 73 | |
| 74 5. Barcodes are of the same length. Suppressed when | |
| 75 variable_len_barcode flag is passed (warning) | |
| 76 | |
| 77 6. The headers do not contain invalid characters (alphanumeric and | |
| 78 underscore only) (warning) | |
| 79 | |
| 80 7. The data fields do not contain invalid characters (alphanumeric, | |
| 81 underscore, space, and +-%./:,; characters) (warning) | |
| 82 | |
| 83 8. SampleID fields are MIENS compliant (only alphanumeric | |
| 84 and . characters). (warning) | |
| 85 | |
| 86 9. There are no duplicates when the primer and variable length | |
| 87 barcodes are appended (error) | |
| 88 | |
| 89 10. There are no duplicates when barcodes and added demultiplex | |
| 90 fields (-j option) are combined (error) | |
| 91 | |
| 92 11. Data fields are not found beyond the Description column (warning) | |
| 93 | |
| 94 Details about the metadata mapping file format can be found here: | |
| 95 http://www.qiime.org/documentation/file_formats.html#metadata-mapping-files | |
| 96 | |
| 97 Errors and warnings are saved to a log file. Errors can be caused | |
| 98 by problems with the headers, invalid characters in barcodes or | |
| 99 primers, or by duplications in SampleIDs or barcodes. | |
| 100 | |
| 101 Warnings can arise from invalid characters and variable length | |
| 102 barcodes that are not specified with the --variable_len_barcode. | |
| 103 Warnings will contain a reference to the cell (row,column) that | |
| 104 the warning arose from. | |
| 105 | |
| 106 In addition to the log file, a 'corrected_mapping' file will be | |
| 107 created. Any invalid characters will be replaced with '.' | |
| 108 characters in the SampleID fields (to enforce MIENS compliance) | |
| 109 and text in other data fields will be replaced with the character | |
| 110 specified by the -c parameter, which is an underscore '_' by | |
| 111 default. | |
| 112 | |
| 113 If pooled primers are used, separate with a comma. For instance, | |
| 114 a pooled set of three 27f primers (used to increase taxonomic | |
| 115 coverage) could be specified in the LinkerPrimerSequence fields as | |
| 116 such: | |
| 117 AGGGTTCGATTCTGGCTCAG,AGAGTTTGATCCTGGCTTAG,AGAATTTGATCTTGGTTCAG | |
| 118 </help> | |
| 119 </tool> |