Mercurial > repos > davide-albanese > qiime_1_6_0

changeset 5:60b88c61566f draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
check_id_map: doc fixed
author Davide Albanese <davide.albanese@gmail.com>
date Sat, 09 Mar 2013 22:49:17 +0100
parents 51eb500d6526
children 27a2d07f4d53
files check_id_map.xml
diffstat 1 files changed, 77 insertions(+), 77 deletions(-) [+]
line wrap: on
line diff
--- a/check_id_map.xml	Sat Mar 09 22:27:31 2013 +0100
+++ b/check_id_map.xml	Sat Mar 09 22:49:17 2013 +0100
@@ -1,6 +1,6 @@
 <!-- Author: Davide Albanese - Fondazione Edmud Mach, 2013 -->
 
-<tool id="check_id_map" name="Check ID Map" version="1.6.0-2">
+<tool id="check_id_map" name="Check ID Map" version="1.6.0-3">
   <description>
     Checks user's metadata mapping file for required data, valid
     format
@@ -9,41 +9,41 @@
     <requirement type="binary">check_id_map.py</requirement>
   </requirements>
   <command>
-    check_id_map.py
-    
-    -m $mapping_fp
-    
-    #if str($char_replace):
-    -c $char_replace
-    #end if
-    
-    #if $not_barcoded:
-    -b
-    #end if
-    
-    #if $variable_len_barcodes:
-    -B
-    #end if
-    
-    #if $disable_primer_check:
-    -p
-    #end if
-    
-    #if str($added_demultiplex_field):
-    -j $added_demultiplex_field
-    #end if
-    ;
-    rm `basename $mapping_fp .txt`'.html'
-    ;
-    rm overlib.js
-    ;
-    mv `basename $mapping_fp .txt`'.log' $out_log
-    ;
-    mv `basename $mapping_fp .txt`'_corrected.txt' $out_txt
+check_id_map.py
+
+-m $mapping_fp
+
+#if str($char_replace):
+-c $char_replace
+#end if
+
+#if $not_barcoded:
+-b
+#end if
+
+#if $variable_len_barcodes:
+-B
+#end if
+
+#if $disable_primer_check:
+-p
+#end if
+
+#if str($added_demultiplex_field):
+-j $added_demultiplex_field
+#end if
+;
+rm `basename $mapping_fp .txt`'.html'
+;
+rm overlib.js
+;
+mv `basename $mapping_fp .txt`'.log' $out_log
+;
+mv `basename $mapping_fp .txt`'_corrected.txt' $out_txt
   </command>
   <inputs>
     <param name="mapping_fp" label="Metadata mapping file" optional="False" type="data" format="tabular"/>
-  
+    
     <param name="char_replace" value="_" label="Character used to replace invalid characters found in the mapping file. Must be a valid character (alphanumeric, period, or underscore)" optional="False" type="text"/>
     
     <param name="not_barcoded" label="Set if barcodes are not present. BarcodeSequence header still required" selected="False" type="boolean"/>
@@ -59,62 +59,62 @@
     <data format="tabular" name="out_txt" label="Corrected ${mapping_fp.name}"/>
   </outputs>
   <help>
-    Check ID Map checks::
-    
-    1. The BarcodeSequence, LinkerPrimerSequences, and ReversePrimer fields 
-       have valid IUPAC DNA characters, and BarcodeSequence characters
-       are non-degenerate (error)
+Check ID Map checks:
+
+1. The BarcodeSequence, LinkerPrimerSequences, and ReversePrimer fields 
+   have valid IUPAC DNA characters, and BarcodeSequence characters
+   are non-degenerate (error)
 
-    2. The SampleID, BarcodeSequence, LinkerPrimerSequence, and Description
-       headers are present (error)
+2. The SampleID, BarcodeSequence, LinkerPrimerSequence, and Description
+   headers are present (error)
 
-    3. There are not duplicate header fields (error)
-    
-    4. There are not duplicate barcodes (error)
+3. There are not duplicate header fields (error)
+
+4. There are not duplicate barcodes (error)
 
-    5. Barcodes are of the same length.  Suppressed when
-       variable_len_barcode flag is passed (warning)
+5. Barcodes are of the same length.  Suppressed when
+   variable_len_barcode flag is passed (warning)
 
-    6. The headers do not contain invalid characters (alphanumeric and 
-       underscore only) (warning)
+6. The headers do not contain invalid characters (alphanumeric and 
+   underscore only) (warning)
 
-    7. The data fields do not contain invalid characters (alphanumeric, 
-       underscore, space, and +-%./:,; characters) (warning)
+7. The data fields do not contain invalid characters (alphanumeric, 
+   underscore, space, and +-%./:,; characters) (warning)
 
-    8. SampleID fields are MIENS compliant (only alphanumeric
-       and . characters). (warning)
+8. SampleID fields are MIENS compliant (only alphanumeric
+   and . characters). (warning)
 
-    9. There are no duplicates when the primer and variable length 
-       barcodes are appended (error)
+9. There are no duplicates when the primer and variable length 
+   barcodes are appended (error)
 
-    10. There are no duplicates when barcodes and added demultiplex 
-       fields (-j option) are combined (error)
+10. There are no duplicates when barcodes and added demultiplex 
+    fields (-j option) are combined (error)
+
+11. Data fields are not found beyond the Description column (warning)
 
-    11. Data fields are not found beyond the Description column (warning)
+Details about the metadata mapping file format can be found here:
+http://www.qiime.org/documentation/file_formats.html#metadata-mapping-files
 
-    Details about the metadata mapping file format can be found here:
-    http://www.qiime.org/documentation/file_formats.html#metadata-mapping-files
+Errors and warnings are saved to a log file.  Errors can be caused
+by problems with the headers, invalid characters in barcodes or
+primers, or by duplications in SampleIDs or barcodes.
 
-    Errors and warnings are saved to a log file.  Errors can be caused
-    by problems with the headers, invalid characters in barcodes or
-    primers, or by duplications in SampleIDs or barcodes.
-    
-    Warnings can arise from invalid characters and variable length
-    barcodes that are not specified with the --variable_len_barcode.
-    Warnings will contain a reference to the cell (row,column) that
-    the warning arose from.
+Warnings can arise from invalid characters and variable length
+barcodes that are not specified with the --variable_len_barcode.
+Warnings will contain a reference to the cell (row,column) that
+the warning arose from.
 
-    In addition to the log file, a 'corrected_mapping' file will be
-    created.  Any invalid characters will be replaced with '.'
-    characters in the SampleID fields (to enforce MIENS compliance)
-    and text in other data fields will be replaced with the character
-    specified by the -c parameter, which is an underscore '_' by
-    default.
+In addition to the log file, a 'corrected_mapping' file will be
+created.  Any invalid characters will be replaced with '.'
+characters in the SampleID fields (to enforce MIENS compliance)
+and text in other data fields will be replaced with the character
+specified by the -c parameter, which is an underscore '_' by
+default.
 
-    If pooled primers are used, separate with a comma. For instance,
-    a pooled set of three 27f primers (used to increase taxonomic
-    coverage) could be specified in the LinkerPrimerSequence fields as
-    such:
-    AGGGTTCGATTCTGGCTCAG,AGAGTTTGATCCTGGCTTAG,AGAATTTGATCTTGGTTCAG
+If pooled primers are used, separate with a comma. For instance,
+a pooled set of three 27f primers (used to increase taxonomic
+coverage) could be specified in the LinkerPrimerSequence fields as
+such:
+AGGGTTCGATTCTGGCTCAG,AGAGTTTGATCCTGGCTTAG,AGAATTTGATCTTGGTTCAG
   </help>
 </tool>