Mercurial > repos > davidvanzessen > shm_csr
annotate gene_identification.py @ 97:fbc6307dd83b draft
planemo upload commit 91fd26f19cb20fc2ee4d87d7edbc9ce6099752b0
| author | rhpvorderman |
|---|---|
| date | Mon, 08 Jan 2024 08:50:07 +0000 |
| parents | cf8ad181628f |
| children |
| rev | line source |
|---|---|
|
92
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
1 #!/usr/bin/env python3 |
| 81 | 2 |
|
92
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
3 import argparse |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
4 import re |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
5 from typing import Dict, Iterator, List, Tuple |
| 81 | 6 |
| 7 | |
|
92
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
8 def generate_sequence_and_id_from_summary(summary_file: str |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
9 ) -> Iterator[Tuple[str, str]]: |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
10 with open(summary_file, "rt") as summary: |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
11 header = next(summary) |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
12 column_names = header.strip("\n").split("\t") |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
13 id_column = column_names.index("Sequence ID") |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
14 sequence_column = column_names.index("Sequence") |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
15 for line in summary: |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
16 values = line.strip("\n").split("\t") |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
17 id = values[id_column] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
18 try: |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
19 sequence = values[sequence_column] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
20 except IndexError: # weird rows without a sequence |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
21 sequence = "" |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
22 yield id, sequence |
| 81 | 23 |
| 24 | |
|
92
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
25 # old cm sequence: gggagtgcatccgccccaacccttttccccctcgtctcctgtgagaattccc |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
26 # old cg sequence: ctccaccaagggcccatcggtcttccccctggcaccctcctccaagagcacctctg |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
27 # ggggcacagcggccctgggctgcctggtcaaggactacttccccgaaccggtgacggtgtcgtggaactcagg |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
28 # cgccctgaccag |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
29 SEARCHSTRINGS = {"ca": "catccccgaccagccccaaggtcttcccgctgagcctctgcagcacccagccag" |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
30 "atgggaacgtggtcatcgcctgcctgg", |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
31 "cg": "ctccaccaagggcccatcggtcttccccctggcaccctcctccaagagcacctc" |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
32 "tgggggcacagcggcc", |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
33 "ce": "gcctccacacagagcccatccgtcttccccttgacccgctgctgcaaaaacatt" |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
34 "ccctcc", |
| 81 | 35 "cm": "gggagtgcatccgccccaacc"} #new (shorter) cm sequence |
| 36 | |
|
92
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
37 #lambda/kappa referesearchstringsnce sequence variable nucleotides |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
38 CA1_MUTATIONS = {38: 't', 39: 'g', 48: 'a', 49: 'g', 51: 'c', 68: 'a', 73: 'c'} |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
39 CA2_MUTATIONS = {38: 'g', 39: 'a', 48: 'c', 49: 'c', 51: 'a', 68: 'g', 73: 'a'} |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
40 CG1_MUTATIONS = {0: 'c', 33: 'a', 38: 'c', 44: 'a', 54: 't', 56: 'g', 58: 'g', 66: 'g', 132: 'c'} |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
41 CG2_MUTATIONS = {0: 'c', 33: 'g', 38: 'g', 44: 'g', 54: 'c', 56: 'a', 58: 'a', 66: 'g', 132: 't'} |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
42 CG3_MUTATIONS = {0: 't', 33: 'g', 38: 'g', 44: 'g', 54: 't', 56: 'g', 58: 'g', 66: 'g', 132: 'c'} |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
43 CG4_MUTATIONS = {0: 't', 33: 'g', 38: 'g', 44: 'g', 54: 'c', 56: 'a', 58: 'a', 66: 'c', 132: 'c'} |
| 81 | 44 |
| 45 #remove last snp for shorter cg sequence --- note, also change varsInCG | |
|
92
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
46 del CG1_MUTATIONS[132] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
47 del CG2_MUTATIONS[132] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
48 del CG3_MUTATIONS[132] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
49 del CG4_MUTATIONS[132] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
50 |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
51 # reference sequences are cut into smaller parts of 'chunklength' length, |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
52 # and with 'chunklength' / 2 overlap |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
53 CHUNK_LENGTH = 8 |
| 81 | 54 |
|
92
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
55 |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
56 def create_compiled_regexes() -> Dict[str, List[Tuple[re.Pattern, int]]]: |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
57 |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
58 compiledregex: Dict[str, List[Tuple[re.Pattern, int]]] = { |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
59 "ca": [], |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
60 "cg": [], |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
61 "ce": [], |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
62 "cm": [] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
63 } |
| 81 | 64 |
|
92
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
65 for i in range(0, len(SEARCHSTRINGS["ca"]) - CHUNK_LENGTH, CHUNK_LENGTH // 2): |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
66 pos = i |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
67 chunk = SEARCHSTRINGS["ca"][i:i + CHUNK_LENGTH] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
68 result = "" |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
69 varsInResult = 0 |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
70 for c in chunk: |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
71 if pos in list(CA1_MUTATIONS.keys()): |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
72 varsInResult += 1 |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
73 result += "[" + CA1_MUTATIONS[pos] + CA2_MUTATIONS[pos] + "]" |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
74 else: |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
75 result += c |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
76 pos += 1 |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
77 compiledregex["ca"].append((re.compile(result), varsInResult)) |
| 81 | 78 |
|
92
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
79 for i in range(0, len(SEARCHSTRINGS["cg"]) - CHUNK_LENGTH, CHUNK_LENGTH // 2): |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
80 pos = i |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
81 chunk = SEARCHSTRINGS["cg"][i:i + CHUNK_LENGTH] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
82 result = "" |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
83 varsInResult = 0 |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
84 for c in chunk: |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
85 if pos in list(CG1_MUTATIONS.keys()): |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
86 varsInResult += 1 |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
87 result += "[" + "".join(set([CG1_MUTATIONS[pos], CG2_MUTATIONS[pos], CG3_MUTATIONS[pos], CG4_MUTATIONS[pos]])) + "]" |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
88 else: |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
89 result += c |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
90 pos += 1 |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
91 compiledregex["cg"].append((re.compile(result), varsInResult)) |
| 81 | 92 |
|
92
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
93 for i in range(0, len(SEARCHSTRINGS["cm"]) - CHUNK_LENGTH, CHUNK_LENGTH // 2): |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
94 compiledregex["cm"].append((re.compile(SEARCHSTRINGS["cm"][i:i + CHUNK_LENGTH]), 0)) |
| 81 | 95 |
|
92
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
96 for i in range(0, len(SEARCHSTRINGS["ce"]) - CHUNK_LENGTH + 1, CHUNK_LENGTH // 2): |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
97 compiledregex["ce"].append((re.compile(SEARCHSTRINGS["ce"][i:i + CHUNK_LENGTH]), 0)) |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
98 |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
99 return compiledregex |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
100 |
| 81 | 101 |
| 102 def removeAndReturnMaxIndex(x): #simplifies a list comprehension | |
| 103 m = max(x) | |
| 104 index = x.index(m) | |
| 105 x[index] = 0 | |
| 106 return index | |
|
92
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
107 |
| 81 | 108 |
|
92
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
109 def match_sequence(seq, compiledregex): |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
110 currentIDHits = {"ca_hits": 0, "cg_hits": 0, "cm_hits": 0, "ce_hits": 0, |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
111 "ca1": 0, "ca2": 0, "cg1": 0, "cg2": 0, "cg3": 0, "cg4": 0} |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
112 alltotal = 0 |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
113 start_location = dict() |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
114 for key in compiledregex: # for ca/cg/cm/ce |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
115 regularexpressions = compiledregex[key] |
|
83
729738462297
"planemo upload commit c0ffc68aec5836d5b20b543106493056a87edf57"
rhpvorderman
parents:
81
diff
changeset
|
116 lastindex = 0 |
|
92
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
117 start_zero = len(SEARCHSTRINGS[key]) #allows the reference sequence to start before search sequence (start_locations of < 0) |
|
83
729738462297
"planemo upload commit c0ffc68aec5836d5b20b543106493056a87edf57"
rhpvorderman
parents:
81
diff
changeset
|
118 start = [0] * (len(seq) + start_zero) |
|
729738462297
"planemo upload commit c0ffc68aec5836d5b20b543106493056a87edf57"
rhpvorderman
parents:
81
diff
changeset
|
119 for i, regexp in enumerate(regularexpressions): #for every regular expression |
|
92
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
120 relativeStartLocation = lastindex - (CHUNK_LENGTH // 2) * i |
|
83
729738462297
"planemo upload commit c0ffc68aec5836d5b20b543106493056a87edf57"
rhpvorderman
parents:
81
diff
changeset
|
121 if relativeStartLocation >= len(seq): |
|
729738462297
"planemo upload commit c0ffc68aec5836d5b20b543106493056a87edf57"
rhpvorderman
parents:
81
diff
changeset
|
122 break |
|
729738462297
"planemo upload commit c0ffc68aec5836d5b20b543106493056a87edf57"
rhpvorderman
parents:
81
diff
changeset
|
123 regex, hasVar = regexp |
|
729738462297
"planemo upload commit c0ffc68aec5836d5b20b543106493056a87edf57"
rhpvorderman
parents:
81
diff
changeset
|
124 matches = regex.finditer(seq[lastindex:]) |
|
729738462297
"planemo upload commit c0ffc68aec5836d5b20b543106493056a87edf57"
rhpvorderman
parents:
81
diff
changeset
|
125 for match in matches: #for every match with the current regex, only uses the first hit because of the break at the end of this loop |
|
729738462297
"planemo upload commit c0ffc68aec5836d5b20b543106493056a87edf57"
rhpvorderman
parents:
81
diff
changeset
|
126 lastindex += match.start() |
|
729738462297
"planemo upload commit c0ffc68aec5836d5b20b543106493056a87edf57"
rhpvorderman
parents:
81
diff
changeset
|
127 start[relativeStartLocation + start_zero] += 1 |
|
729738462297
"planemo upload commit c0ffc68aec5836d5b20b543106493056a87edf57"
rhpvorderman
parents:
81
diff
changeset
|
128 if hasVar: #if the regex has a variable nt in it |
|
92
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
129 chunkstart = CHUNK_LENGTH // 2 * i #where in the reference does this chunk start |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
130 chunkend = CHUNK_LENGTH // 2 * i + CHUNK_LENGTH #where in the reference does this chunk end |
|
83
729738462297
"planemo upload commit c0ffc68aec5836d5b20b543106493056a87edf57"
rhpvorderman
parents:
81
diff
changeset
|
131 if key == "ca": #just calculate the variable nt score for 'ca', cheaper |
|
92
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
132 currentIDHits["ca1"] += len([1 for x in CA1_MUTATIONS if chunkstart <= x < chunkend and CA1_MUTATIONS[x] == seq[lastindex + x - chunkstart]]) |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
133 currentIDHits["ca2"] += len([1 for x in CA2_MUTATIONS if chunkstart <= x < chunkend and CA2_MUTATIONS[x] == seq[lastindex + x - chunkstart]]) |
|
83
729738462297
"planemo upload commit c0ffc68aec5836d5b20b543106493056a87edf57"
rhpvorderman
parents:
81
diff
changeset
|
134 elif key == "cg": #just calculate the variable nt score for 'cg', cheaper |
|
92
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
135 currentIDHits["cg1"] += len([1 for x in CG1_MUTATIONS if chunkstart <= x < chunkend and CG1_MUTATIONS[x] == seq[lastindex + x - chunkstart]]) |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
136 currentIDHits["cg2"] += len([1 for x in CG2_MUTATIONS if chunkstart <= x < chunkend and CG2_MUTATIONS[x] == seq[lastindex + x - chunkstart]]) |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
137 currentIDHits["cg3"] += len([1 for x in CG3_MUTATIONS if chunkstart <= x < chunkend and CG3_MUTATIONS[x] == seq[lastindex + x - chunkstart]]) |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
138 currentIDHits["cg4"] += len([1 for x in CG4_MUTATIONS if chunkstart <= x < chunkend and CG4_MUTATIONS[x] == seq[lastindex + x - chunkstart]]) |
|
83
729738462297
"planemo upload commit c0ffc68aec5836d5b20b543106493056a87edf57"
rhpvorderman
parents:
81
diff
changeset
|
139 else: #key == "cm" #no variable regions in 'cm' or 'ce' |
|
729738462297
"planemo upload commit c0ffc68aec5836d5b20b543106493056a87edf57"
rhpvorderman
parents:
81
diff
changeset
|
140 pass |
|
729738462297
"planemo upload commit c0ffc68aec5836d5b20b543106493056a87edf57"
rhpvorderman
parents:
81
diff
changeset
|
141 break #this only breaks when there was a match with the regex, breaking means the 'else:' clause is skipped |
|
729738462297
"planemo upload commit c0ffc68aec5836d5b20b543106493056a87edf57"
rhpvorderman
parents:
81
diff
changeset
|
142 else: #only runs if there were no hits |
|
729738462297
"planemo upload commit c0ffc68aec5836d5b20b543106493056a87edf57"
rhpvorderman
parents:
81
diff
changeset
|
143 continue |
|
729738462297
"planemo upload commit c0ffc68aec5836d5b20b543106493056a87edf57"
rhpvorderman
parents:
81
diff
changeset
|
144 #print "found ", regex.pattern , "at", lastindex, "adding one to", (lastindex - chunklength / 2 * i), "to the start array of", ID, "gene", key, "it's now:", start[lastindex - chunklength / 2 * i] |
|
729738462297
"planemo upload commit c0ffc68aec5836d5b20b543106493056a87edf57"
rhpvorderman
parents:
81
diff
changeset
|
145 currentIDHits[key + "_hits"] += 1 |
|
92
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
146 start_location[key] = str([(removeAndReturnMaxIndex(start) + 1 - start_zero) for x in range(5) if len(start) > 0 and max(start) > 1]) |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
147 |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
148 cahits = currentIDHits["ca_hits"] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
149 cghits = currentIDHits["cg_hits"] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
150 cmhits = currentIDHits["cm_hits"] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
151 cehits = currentIDHits["ce_hits"] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
152 if cahits >= cghits and cahits >= cmhits and cahits >= cehits: # its a ca gene |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
153 ca1hits = currentIDHits["ca1"] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
154 ca2hits = currentIDHits["ca2"] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
155 if ca1hits >= ca2hits: |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
156 # TODO: All variants with 0 matched are matched to IGA1 with 0 hits |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
157 # TODO: these are later turned into unmatched by the merge_and_filter.R |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
158 # TODO: script |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
159 return "IGA1", ca1hits, cahits, start_location["ca"] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
160 else: |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
161 return "IGA2", ca2hits, cahits, start_location["ca"] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
162 elif cghits >= cahits and cghits >= cmhits and cghits >= cehits: # its a cg gene |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
163 cg1hits = currentIDHits["cg1"] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
164 cg2hits = currentIDHits["cg2"] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
165 cg3hits = currentIDHits["cg3"] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
166 cg4hits = currentIDHits["cg4"] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
167 if cg1hits >= cg2hits and cg1hits >= cg3hits and cg1hits >= cg4hits: # cg1 gene |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
168 return "IGG1", cg1hits, cghits, start_location["cg"] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
169 elif cg2hits >= cg1hits and cg2hits >= cg3hits and cg2hits >= cg4hits: # cg2 gene |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
170 return "IGG2", cg2hits, cghits, start_location["cg"] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
171 elif cg3hits >= cg1hits and cg3hits >= cg2hits and cg3hits >= cg4hits: # cg3 gene |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
172 return "IGG3", cg3hits, cghits, start_location["cg"] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
173 else: # cg4 gene |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
174 return "IGG4", cg4hits, cghits, start_location["cg"] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
175 else: # its a cm or ce gene |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
176 if cmhits >= cehits: |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
177 return "IGM", 0, cmhits, start_location["cm"] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
178 else: |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
179 return "IGE", 0, cehits, start_location["ce"] |
| 81 | 180 |
| 181 | |
|
92
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
182 def main(): |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
183 parser = argparse.ArgumentParser() |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
184 parser.add_argument("--input", |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
185 help="The 1_Summary file from an IMGT zip file") |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
186 parser.add_argument("--output", |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
187 help="The annotated output file to be merged back " |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
188 "with the summary file") |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
189 args = parser.parse_args() |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
190 varsInCA = float(len(list(CA1_MUTATIONS.keys())) * 2) |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
191 varsInCG = float(len(list( |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
192 CG1_MUTATIONS.keys())) * 2) - 2 # -2 because the sliding window doesn't hit the first and last nt twice |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
193 subclass_vars = { |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
194 "IGA1": varsInCA, "IGA2": varsInCA, |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
195 "IGG1": varsInCG, "IGG2": varsInCG, "IGG3": varsInCG, "IGG4": varsInCG, |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
196 "IGE": 0, |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
197 "IGM": 0, |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
198 } |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
199 compiledregex = create_compiled_regexes() |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
200 possibleca = float(len(compiledregex["ca"])) |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
201 possiblecg = float(len(compiledregex["cg"])) |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
202 possiblecm = float(len(compiledregex["cm"])) |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
203 possiblece = float(len(compiledregex["ce"])) |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
204 class_chunks = { |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
205 "IGA1": possibleca, "IGA2": possibleca, |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
206 "IGE": possiblece, |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
207 "IGG1": possiblecg, "IGG2": possiblecg, "IGG3": possiblecg, |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
208 "IGG4": possiblecg, |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
209 "IGM": possiblecm |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
210 } |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
211 with open(args.output, "wt") as output: |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
212 output.write("Sequence ID\tbest_match\tnt_hit_percentage\t" |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
213 "chunk_hit_percentage\tstart_locations\n") |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
214 for id, sequence in generate_sequence_and_id_from_summary(args.input): |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
215 best_match, subclass_hits, class_hits, start_locations = \ |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
216 match_sequence(sequence, compiledregex) |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
217 variable_nucs = subclass_vars[best_match] |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
218 if variable_nucs: |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
219 subclass_percentage = round(subclass_hits * 100 / |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
220 variable_nucs) |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
221 else: |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
222 subclass_percentage = 100 |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
223 class_percentage = round(class_hits * 100 / class_chunks[best_match]) |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
224 output.write(f"{id}\t{best_match}\t{subclass_percentage}\t" |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
225 f"{class_percentage}\t{start_locations}\n") |
| 81 | 226 |
| 227 | |
|
92
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
228 if __name__ == "__main__": |
|
cf8ad181628f
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
rhpvorderman
parents:
83
diff
changeset
|
229 main() |
