Mercurial > repos > dereeper > sniplay

comparison AnnotationStatsFromVCF/annotationStatsFromVCF_wrapper.xml @ 10:c6640c49fd01 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload commit 475f4d7d8442a0d75e103af326ae5881c4d2a4ac
author dereeper
date Mon, 16 Apr 2018 09:00:24 -0400
parents 98c37a5d67f4
children
comparison
equal deleted inserted replaced
9:98c37a5d67f4 10:c6640c49fd01
1 <tool id="annotationStatsFromVCF" name="Get annotation statistics" version="1.0.0"> 1 <tool id="annotationStatsFromVCF" name="Get VCF annotation statistics" version="2.0.0">
2 <description> from VCF file </description> 2 <description>Get annotation fromi a VCF file annotated by snpeff</description>
3 <requirements> 3 <requirements>
4 <requirement type="binary">perl</requirement> 4 <requirement type="binary">perl</requirement>
5 <requirement type="package" version="0.1.12b">vcftools</requirement> 5 <requirement type="package" version="1.6.924">perl-bioperl</requirement>
6 <requirement type="package" version="0.1.14">vcftools</requirement>
6 </requirements> 7 </requirements>
7 <stdio> 8 <stdio>
8 <exit_code range="1:" /> 9 <exit_code range="1:" />
9 </stdio> 10 </stdio>
10 <command interpreter="perl"> 11 <command interpreter="perl">
11 AnnotationStatsFromVCF.pl -v $input -o $output_label -s $step &amp;&amp; mv ${output_label} $output_count &amp;&amp; mv ${output_label}.effect $output_stats_effect &amp;&amp; mv ${output_label}.location $output_stats_location 12 AnnotationStatsFromVCF.pl -v $input -o $output_label -s $step &amp;&amp; mv ${output_label} $output_count &amp;&amp; mv ${output_label}.effect $output_stats_effect &amp;&amp; mv ${output_label}.location $output_stats_location
12 </command> 13 </command>
13 <inputs> 14 <inputs>
14 <param type="data" name="input" format="vcf" label="VCF file" /> 15 <param type="data" name="input" format="vcf" label="VCF file" />
15 <param type="text" name="output_label" label="Output_label" value='VCF_stats' /> 16 <param name="step" type="integer" value="200000" label="Step" help="Step in bp"/>
17 <param type="text" name="output_label" label="Output_label" value='VCF_stats' optional='false' />
16 </inputs> 18 </inputs>
17 <outputs> 19 <outputs>
18 <data name="output_count" format="txt" label="${output_label}."/> 20 <data name="output_count" format="txt" label="${output_label}"/>
19 <data name="output_stats_effect" format="txt" label="${output_label}."/> 21 <data name="output_stats_effect" format="txt" label="${output_label}.effect"/>
20 <data name="output_stats_location" format="txt" label="${output_label}."/> 22 <data name="output_stats_location" format="txt" label="${output_label}.location"/>
21 </outputs> 23 </outputs>
22 <tests> 24 <tests>
23 <test> 25 <test>
24 <param name="input" value="vcf2fastaAndHapmap-sample.vcf"/> 26 <param name="input" value="annotationStatsFromVCF.vcf"/>
25 <output name="output_count" file="vcf2fastaAndHapmap-sample.vcf"/> 27 <param name="step" value="50000"/>
26 <output name="output_stats_effect" file="vcf2fastaAndHapmap-sample.vcf"/> 28 <output name="output_count" file="annotationStatsFromVCF.txt"/>
27 <output name="output_stats_location" file="vcf2fastaAndHapmap-sample.vcf"/> 29 <output name="output_stats_effect" file="annotationStatsFromVCF.effect"/>
30 <output name="output_stats_location" file="annotationStatsFromVCF.location"/>
28 </test> 31 </test>
29 </tests> 32 </tests>
30 <help><![CDATA[ 33 <help><![CDATA[
31 34
32 .. class:: infomark 35 .. class:: infomark
35 38
36 | **Please cite** "SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations", **Dereeper A. et al.**, Nucl. Acids Res. (1 july 2015) 43 (W1). 39 | **Please cite** "SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations", **Dereeper A. et al.**, Nucl. Acids Res. (1 july 2015) 43 (W1).
37 40
38 .. class:: infomark 41 .. class:: infomark
39 42
40 **Galaxy integration** Andres Gwendoline, Institut Français de Bioinformatique. 43 **Galaxy integration** Provided by Southgreen & Andres Gwendoline (Institut Français de Bioinformatique) & Marcon Valentin (IFB & INRA)
41 44
42 .. class:: infomark 45 .. class:: infomark
43 46
44 **Support** For any questions, please send an e-mail to support.abims@sb-roscoff.fr 47 **Support** For any questions about Galaxy integration, please send an e-mail to alexis.dereeper@ird.fr
45 48
46 --------------------------------------------------- 49 ---------------------------------------------------
47 50
48 ============================== 51 =========================
49 Get Haplotypes From Phased VCF 52 Get annotation statistics
50 ============================== 53 =========================
51 54
52 ----------- 55 -----------
53 Description 56 Description
54 ----------- 57 -----------
55 58
56 | Get Haplotype from phased VCF 59 | Get annotation statistics from VCF
57 60
58 ----------------- 61 ------------
59 Workflow position 62 Dependencies
60 ----------------- 63 ------------
64 VCFtools
65 vcftools_ 0.1.14, Conda version
66 Bioperl
67 perl-bioperl_ 1.6.924, Conda version
61 68
62 **Upstream tool** 69 .. _vcftools: https://anaconda.org/bioconda/vcftools
63 70 .. _perl-bioperl: https://anaconda.org/bioconda/perl-bioperl
64 =============== ========================== =======
65 Name output file(s) format
66 =============== ========================== =======
67 Beagle Phased VCF file VCF
68 =============== ========================== =======
69
70
71 **Downstream tool**
72
73 =============== ========================== ===========
74 Name input file(s) format
75 =============== ========================== ===========
76 =============== ========================== ===========
77
78 71
79 ---------- 72 ----------
80 Input file 73 Input file
81 ---------- 74 ----------
82 75
83 VCF file 76 VCF file
84 Phased VCF file 77 VCF file
85 78
86 ---------- 79 ----------
87 Parameters 80 Parameters
88 ---------- 81 ----------
89 82
90 Output file basename 83 Step
91 Prefix for the output VCF file 84 Step in bp
85
86 Output label
87 Prefix for the ouput files
92 88
93 ------------ 89 ------------
94 Output files 90 Output files
95 ------------ 91 ------------
96 92
93 Output_name
97 94
98 Text file 95 Output_name.effect file
99 File describing haplotypes
100 96
101 Fasta file 97 Output_name.location file
102 Fasta file with haplotypes
103 98
104 --------------------------------------------------- 99 ---------------------------------------------------
105 100
106 --------------- 101 ---------------
107 Working example 102 Working example
108 --------------- 103 ---------------
109 104
110 Input files 105 Input file
111 =========== 106 ==========
112 107
113 VCF file 108 VCF file
114 --------- 109 ---------
115 110
116 :: 111 ::
124 119
125 120
126 Parameters 121 Parameters
127 ========== 122 ==========
128 123
129 Output name -> haplotypes 124 Step -> 50000
125 Output label -> VCF_stats
130 126
131 127
132 Output files 128 Output files
133 ============ 129 ============
134 130
135 haplotypes.distinct_haplotypes.txt 131 VCF_stats
136 ---------------------------------- 132 ----------------------------------
137 133
138 :: 134 ::
139 135
140 ===Chr10=== 136 Chrom Bin dN/dS ratio
141 haplo1:2:CIRAD403_1,CIRAD403_2, 137 chr1 50000 0.791666666666667
142 TTTAAGAAATTCCTATATAGGTCTTCTAAGCGTATCTATTAACAT 138 chr1 100000 0.981132075471698
143 haplo2:2:MAHAE_1,MAHAE_2, 139 chr1 150000 2.08333333333333
144 TAAATCTTGGTGCTGATCTGATATTTAATGCGT
145 140
146 141
147 haplotypes.haplo.fas 142 VCF_stats.effect
148 -------------------- 143 --------------------
149 144
150 :: 145 ::
151 146
152 >Chr10_AZUCENA_1 147 Intron 960 Intron:960
153 TTTAAGAAATTCCTATATAGGTCTTCTAAGCGTATCTATTAACAT 148 UTR 281 UTR:281
154 >Chr10_AZUCENA_2 149 Exon 3248 Synonym:124 Non-syn:120
155 TAAATCTTGGTGCTGATCTGATATTTAATGCGT 150
151 VCF_stats.location
152 --------------------
153
154 ::
155
156 Intergenic 466 Intergenic:466
157 Genic 4489 Exon:3248 Intron:960 UTR:281
158
156 159
157 ]]></help> 160 ]]></help>
158 <citations> 161 <citations>
159 <!-- [HELP] As DOI or BibTex entry --> 162 <!-- [HELP] As DOI or BibTex entry -->
160 <citation type="bibtex">@article{Dereeper03062015, 163 <citation type="bibtex">@article{Dereeper03062015,