--- a/AnnotationStatsFromVCF/annotationStatsFromVCF_wrapper.xml	Wed Feb 07 22:08:47 2018 -0500
+++ b/AnnotationStatsFromVCF/annotationStatsFromVCF_wrapper.xml	Mon Apr 16 09:00:24 2018 -0400
@@ -1,8 +1,9 @@
-<tool id="annotationStatsFromVCF" name="Get annotation statistics" version="1.0.0">
-    <description> from VCF file </description>
+<tool id="annotationStatsFromVCF" name="Get VCF annotation statistics" version="2.0.0">
+    <description>Get annotation fromi a VCF file annotated by snpeff</description>
     <requirements>
 	<requirement type="binary">perl</requirement>
-	<requirement type="package" version="0.1.12b">vcftools</requirement>
+        <requirement type="package" version="1.6.924">perl-bioperl</requirement>
+	<requirement type="package" version="0.1.14">vcftools</requirement>
     </requirements>
     <stdio>
         <exit_code range="1:" />
@@ -12,19 +13,21 @@
     </command>
     <inputs>
         <param type="data" name="input" format="vcf" label="VCF file" />
-        <param type="text" name="output_label" label="Output_label" value='VCF_stats' />
+        <param name="step" type="integer" value="200000" label="Step" help="Step in bp"/>
+        <param type="text" name="output_label" label="Output_label" value='VCF_stats' optional='false' />
     </inputs>
     <outputs>
-        <data name="output_count" format="txt" label="${output_label}."/>
-	<data name="output_stats_effect" format="txt" label="${output_label}."/>
-	<data name="output_stats_location" format="txt" label="${output_label}."/>
+        <data name="output_count" format="txt" label="${output_label}"/>
+	<data name="output_stats_effect" format="txt" label="${output_label}.effect"/>
+	<data name="output_stats_location" format="txt" label="${output_label}.location"/>
     </outputs>
     <tests>
         <test>
-            <param name="input" value="vcf2fastaAndHapmap-sample.vcf"/>
-            <output name="output_count" file="vcf2fastaAndHapmap-sample.vcf"/>
-            <output name="output_stats_effect" file="vcf2fastaAndHapmap-sample.vcf"/>
-	    <output name="output_stats_location" file="vcf2fastaAndHapmap-sample.vcf"/>
+            <param name="input" value="annotationStatsFromVCF.vcf"/>
+            <param name="step" value="50000"/>
+            <output name="output_count" file="annotationStatsFromVCF.txt"/>
+            <output name="output_stats_effect" file="annotationStatsFromVCF.effect"/>
+	    <output name="output_stats_location" file="annotationStatsFromVCF.location"/>
         </test>
     </tests>
     <help><![CDATA[
@@ -37,69 +40,61 @@
 
 .. class:: infomark
 
-**Galaxy integration** Andres Gwendoline, Institut Français de Bioinformatique.
+**Galaxy integration** Provided by Southgreen & Andres Gwendoline (Institut Français de Bioinformatique) & Marcon Valentin (IFB & INRA)
 
 .. class:: infomark
 
-**Support** For any questions, please send an e-mail to support.abims@sb-roscoff.fr
+**Support** For any questions about Galaxy integration, please send an e-mail to alexis.dereeper@ird.fr
 
 ---------------------------------------------------
 
-==============================
-Get Haplotypes From Phased VCF
-==============================
+=========================
+Get annotation statistics
+=========================
 
 -----------
 Description
 -----------
 
-    | Get Haplotype from phased VCF
-
------------------
-Workflow position
------------------
-
-**Upstream tool**
+    | Get annotation statistics from VCF
 
-=============== ========================== =======
-Name            output file(s)             format
-=============== ========================== =======
-Beagle          Phased VCF file            VCF
-=============== ========================== =======
-
+------------
+Dependencies
+------------
+VCFtools
+        vcftools_ 0.1.14, Conda version
+Bioperl
+        perl-bioperl_ 1.6.924, Conda version
 
-**Downstream tool**
-
-=============== ========================== ===========
-Name            input file(s)              format
-=============== ========================== ===========
-=============== ========================== ===========
-
+.. _vcftools: https://anaconda.org/bioconda/vcftools
+.. _perl-bioperl: https://anaconda.org/bioconda/perl-bioperl
 
 ----------
 Input file
 ----------
 
 VCF file
-        Phased VCF file
+        VCF file
 
 ----------
 Parameters
 ----------
 
-Output file basename
-        Prefix for the output VCF file
+Step
+        Step in bp 
+
+Output label
+        Prefix for the ouput files
 
 ------------
 Output files
 ------------
 
+Output_name
 
-Text file
-        File describing haplotypes
+Output_name.effect file
 
-Fasta file
-        Fasta file with haplotypes
+Output_name.location file
 
 ---------------------------------------------------
 
@@ -107,8 +102,8 @@
 Working example
 ---------------
 
-Input files
-===========
+Input file
+==========
 
 VCF file
 ---------
@@ -126,33 +121,41 @@
 Parameters
 ==========
 
-Output name -> haplotypes
+Step -> 50000
+Output label -> VCF_stats
 
 
 Output files
 ============
 
-haplotypes.distinct_haplotypes.txt
+VCF_stats
 ----------------------------------
 
 ::
 
-	===Chr10===
-	haplo1:2:CIRAD403_1,CIRAD403_2,
-	TTTAAGAAATTCCTATATAGGTCTTCTAAGCGTATCTATTAACAT
-	haplo2:2:MAHAE_1,MAHAE_2,
-	TAAATCTTGGTGCTGATCTGATATTTAATGCGT
+        Chrom	Bin	dN/dS ratio
+        chr1	50000	0.791666666666667
+        chr1	100000	0.981132075471698
+        chr1	150000	2.08333333333333
 
 
-haplotypes.haplo.fas
+VCF_stats.effect
 --------------------
 
 ::
 
-	>Chr10_AZUCENA_1
-	TTTAAGAAATTCCTATATAGGTCTTCTAAGCGTATCTATTAACAT
-	>Chr10_AZUCENA_2
-	TAAATCTTGGTGCTGATCTGATATTTAATGCGT
+        Intron	960	Intron:960
+        UTR	281	UTR:281
+        Exon	3248	Synonym:124	Non-syn:120
+
+VCF_stats.location
+--------------------
+
+::
+
+        Intergenic	466	Intergenic:466
+        Genic	4489	Exon:3248	Intron:960	UTR:281
+
 
     ]]></help>
     <citations>