Mercurial > repos > dereeper > sniplay

comparison VCF2Hapmap/vcf2FastaAndHapmap.xml @ 10:c6640c49fd01 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload commit 475f4d7d8442a0d75e103af326ae5881c4d2a4ac
author dereeper
date Mon, 16 Apr 2018 09:00:24 -0400
parents 98c37a5d67f4
children
comparison
equal deleted inserted replaced
9:98c37a5d67f4 10:c6640c49fd01
1 <tool id="sniplay_vcf2fastaandhapmap" name="VCF to Hapmap" version="1.1.0"> 1 <tool id="sniplay_vcf2fastaandhapmap" name="VCF to Hapmap" version="2.0.0">
2 2
3 <!-- [REQUIRED] Tool description displayed after the tool name --> 3 <!-- [REQUIRED] Tool description displayed after the tool name -->
4 <description> Convert VCF to Hapmap </description> 4 <description> Convert VCF to Hapmap </description>
5 5
6 <!-- [OPTIONAL] 3rd party tools, binaries, modules... required for the tool to work --> 6 <!-- [OPTIONAL] 3rd party tools, binaries, modules... required for the tool to work -->
84 <param name="file_opt" value="fasta_gff" /> 84 <param name="file_opt" value="fasta_gff" />
85 <param name="filefasta" value="vcf2fastaAndHapmap-reference.fa" /> 85 <param name="filefasta" value="vcf2fastaAndHapmap-reference.fa" />
86 <param name="filegff" value="vcf2fastaAndHapmap-reference.gff" /> 86 <param name="filegff" value="vcf2fastaAndHapmap-reference.gff" />
87 <output name="fileout" file="vcf2fastaAndHapmap-result3.hapmap" /> 87 <output name="fileout" file="vcf2fastaAndHapmap-result3.hapmap" />
88 <output name="fileout_seq" file="vcf2fastaAndHapmap-result3.flanking.txt" /> 88 <output name="fileout_seq" file="vcf2fastaAndHapmap-result3.flanking.txt" />
89 <output name="fileout_fa1" file="vcf2fastaAndHapmap-result3.gene_alignment.fas" /> 89 <output name="fileout_fa1" file="vcf2fastaAndHapmap-result3.gene_alignment.fas" compare="sim_size" delta="0"/>
90 </test> 90 </test>
91 </tests> 91 </tests>
92 92
93 <!-- [OPTIONAL] Help displayed in Galaxy --> 93 <!-- [OPTIONAL] Help displayed in Galaxy -->
94 <help> 94 <help><![CDATA[
95 95
96 96
97 .. class:: infomark 97 .. class:: infomark
98 98
99 **Authors** Dereeper Alexis (alexis.dereeper@ird.fr), IRD, South Green platform 99 **Authors** Dereeper Alexis (alexis.dereeper@ird.fr), IRD, South Green platform
100 100
101 | **Please cite** "SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations", **Dereeper A. et al.**, Nucl. Acids Res. (1 july 2015) 43 (W1). 101 | **Please cite** "SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations", **Dereeper A. et al.**, Nucl. Acids Res. (1 july 2015) 43 (W1).
102 102
103 .. class:: infomark 103 .. class:: infomark
104 104
105 **Galaxy integration** Andres Gwendoline, Institut Français de Bioinformatique. 105 **Galaxy integration** Provided by Southgreen & Andres Gwendoline (Institut Français de Bioinformatique) & Marcon Valentin (IFB & INRA)
106 106
107 .. class:: infomark 107 .. class:: infomark
108 108
109 **Support** For any questions, please send an e-mail to support.abims@sb-roscoff.fr 109 **Support** For any questions about Galaxy integration, please send an e-mail to alexis.dereeper@ird.fr
110 110
111 --------------------------------------------------- 111 ---------------------------------------------------
112 112
113 ======================= 113 =======================
114 VCF to Hapmap 114 VCF to Hapmap
118 Description 118 Description
119 ----------- 119 -----------
120 120
121 | Convert VCF to Hapmap. Additionnaly it creates flanking sequences of variants if fasta reference is provided. 121 | Convert VCF to Hapmap. Additionnaly it creates flanking sequences of variants if fasta reference is provided.
122 | Furthermore it also creates fasta alignment of genes if GFF annotation is provided 122 | Furthermore it also creates fasta alignment of genes if GFF annotation is provided
123
124 -----------------
125 Workflow position
126 -----------------
127
128 **Upstream tool**
129
130 =============== ========================== =======
131 Name output file(s) format
132 =============== ========================== =======
133 VCFtools Filter VCF file VCF
134 =============== ========================== =======
135
136
137 **Downstream tool**
138
139 =============== ========================== ===========
140 Name input file(s) format
141 =============== ========================== ===========
142 SNP density Hapmap file tabular
143 =============== ========================== ===========
144
145 123
146 ---------- 124 ----------
147 Input file 125 Input file
148 ---------- 126 ----------
149 127
235 213
236 >chr1_CATB1_1 214 >chr1_CATB1_1
237 TCCTCAAACTTTCTTCAGCGCCTATGAATACAGCGTGCTATAGTTACGTGGGGCGTTT 215 TCCTCAAACTTTCTTCAGCGCCTATGAATACAGCGTGCTATAGTTACGTGGGGCGTTT
238 216
239 217
240 </help> 218 ]]></help>
241 219
242 <citations> 220 <citations>
243 <!-- [HELP] As DOI or BibTex entry --> 221 <!-- [HELP] As DOI or BibTex entry -->
244 <citation type="bibtex">@article{Dereeper03062015, 222 <citation type="bibtex">@article{Dereeper03062015,
245 author = {Dereeper, Alexis and Homa, Felix and Andres, Gwendoline and Sempere, Guilhem and Sarah, Gautier and Hueber, Yann and Dufayard, Jean-François and Ruiz, Manuel}, 223 author = {Dereeper, Alexis and Homa, Felix and Andres, Gwendoline and Sempere, Guilhem and Sarah, Gautier and Hueber, Yann and Dufayard, Jean-François and Ruiz, Manuel},