--- a/VCF2Hapmap/vcf2FastaAndHapmap.xml	Wed Feb 07 22:08:47 2018 -0500
+++ b/VCF2Hapmap/vcf2FastaAndHapmap.xml	Mon Apr 16 09:00:24 2018 -0400
@@ -1,4 +1,4 @@
-<tool id="sniplay_vcf2fastaandhapmap" name="VCF to Hapmap" version="1.1.0">
+<tool id="sniplay_vcf2fastaandhapmap" name="VCF to Hapmap" version="2.0.0">
     
     <!-- [REQUIRED] Tool description displayed after the tool name -->
     <description> Convert VCF to Hapmap  </description>
@@ -86,12 +86,12 @@
          <param name="filegff" value="vcf2fastaAndHapmap-reference.gff" />
          <output name="fileout" file="vcf2fastaAndHapmap-result3.hapmap" />
          <output name="fileout_seq" file="vcf2fastaAndHapmap-result3.flanking.txt" />
-         <output name="fileout_fa1" file="vcf2fastaAndHapmap-result3.gene_alignment.fas" />
+         <output name="fileout_fa1" file="vcf2fastaAndHapmap-result3.gene_alignment.fas" compare="sim_size" delta="0"/>
         </test>
     </tests>
     
     <!-- [OPTIONAL] Help displayed in Galaxy -->
-    <help>
+    <help><![CDATA[
 
 
 .. class:: infomark
@@ -102,11 +102,11 @@
 
 .. class:: infomark
 
-**Galaxy integration** Andres Gwendoline, Institut Français de Bioinformatique. 
+**Galaxy integration** Provided by Southgreen & Andres Gwendoline (Institut Français de Bioinformatique) & Marcon Valentin (IFB & INRA)
 
 .. class:: infomark
 
-**Support** For any questions, please send an e-mail to support.abims@sb-roscoff.fr 
+**Support** For any questions about Galaxy integration, please send an e-mail to alexis.dereeper@ird.fr
 
 ---------------------------------------------------
 
@@ -121,28 +121,6 @@
   | Convert VCF to Hapmap. Additionnaly it creates flanking sequences of variants if fasta reference is provided.
   | Furthermore it also creates fasta alignment of genes if GFF annotation is provided 
 
------------------
-Workflow position
------------------
-
-**Upstream tool**
-
-=============== ========================== =======
-Name            output file(s)             format 
-=============== ========================== =======
-VCFtools Filter VCF file		   VCF
-=============== ========================== =======
-
-
-**Downstream tool**
-
-=============== ========================== ===========
-Name            input file(s)              format 
-=============== ========================== ===========
-SNP density	Hapmap file 	 	   tabular
-=============== ========================== ===========
-
-
 ----------
 Input file
 ----------
@@ -237,7 +215,7 @@
 	TCCTCAAACTTTCTTCAGCGCCTATGAATACAGCGTGCTATAGTTACGTGGGGCGTTT
 
 	
-    </help>
+    ]]></help>
 
     <citations>
         <!-- [HELP] As DOI or BibTex entry -->