Mercurial > repos > devteam > fasta_clipping_histogram
diff fasta_clipping_histogram.xml @ 1:f666895cbebd draft
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fasta_clipping_histogram commit a1517c9d22029095120643bbe2c8fa53754dd2b7
| author | devteam |
|---|---|
| date | Wed, 11 Nov 2015 12:36:37 -0500 |
| parents | f2ab5b44870d |
| children | 9db07fd39f85 |
line wrap: on
line diff
--- a/fasta_clipping_histogram.xml Wed Sep 25 14:55:11 2013 -0400 +++ b/fasta_clipping_histogram.xml Wed Nov 11 12:36:37 2015 -0500 @@ -1,19 +1,20 @@ <tool id="cshl_fasta_clipping_histogram" name="Length Distribution" version="1.0.0"> - <description>chart</description> + <description>chart</description> <requirements> <requirement type="package" version="0.0.13">fastx_toolkit</requirement> </requirements> - <command>fasta_clipping_histogram.pl $input $outfile</command> - - <inputs> - <param format="fasta" name="input" type="data" label="Library to analyze" /> - </inputs> + <command>fasta_clipping_histogram.pl $input $outfile</command> + + <inputs> + <param format="fasta" name="input" type="data" label="Library to analyze" /> + </inputs> - <outputs> - <data format="png" name="outfile" metadata_source="input" /> - </outputs> -<help> - + <outputs> + <data format="png" name="outfile" metadata_source="input" /> + </outputs> + <tests> + </tests> + <help> **What it does** This tool creates a histogram image of sequence lengths distribution in a given fasta dataset file. @@ -24,21 +25,18 @@ **Output Examples** -In the following library, most sequences are 24-mers to 27-mers. +In the following library, most sequences are 24-mers to 27-mers. This could indicate an abundance of endo-siRNAs (depending of course of what you've tried to sequence in the first place). .. image:: ${static_path}/fastx_icons/fasta_clipping_histogram_1.png - -In the following library, most sequences are 19,22 or 23-mers. +In the following library, most sequences are 19,22 or 23-mers. This could indicate an abundance of miRNAs (depending of course of what you've tried to sequence in the first place). .. image:: ${static_path}/fastx_icons/fasta_clipping_histogram_2.png - ----- - **Input Formats** This tool accepts short-reads FASTA files. The reads don't have to be short, but they do have to be on a single line, like so:: @@ -50,7 +48,6 @@ >sequence3 CCTTGAGATTAACGCTAATCAAGTAAAC - If the sequences span over multiple lines:: >sequence1 @@ -63,11 +60,8 @@ >sequence1 CAGCATCTACATAATATGATCGCTATTAAACTTAAATCTCCTTGACGGAGTCTTCGGTCATAACACAAACCCAGACCTACGTATATGACAAAGCTAATAGaactggtctttacctTTAAGTTG - ----- - - **Multiplicity counts (a.k.a reads-count)** If the sequence identifier (the text after the '>') contains a dash and a number, it is treated as a multiplicity count value (i.e. how many times that individual sequence repeated in the original FASTA file, before collapsing). @@ -85,7 +79,6 @@ .. image:: ${static_path}/fastx_icons/fasta_clipping_histogram_3.png - Example 2 - The following FASTA file have multiplicity counts:: >seq1-2 @@ -106,7 +99,5 @@ This tool is based on `FASTX-toolkit`__ by Assaf Gordon. .. __: http://hannonlab.cshl.edu/fastx_toolkit/ - -</help> -<!-- FASTA-Clipping-Histogram is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> -</tool> \ No newline at end of file + </help> +</tool>