<tool id="cshl_fasta_clipping_histogram" name="Length Distribution" version="1.0.0">
    <description>chart</description>
    <requirements>
        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
    </requirements>
    <command>fasta_clipping_histogram.pl $input $outfile</command>

    <inputs>
        <param format="fasta" name="input" type="data" label="Library to analyze" />
    </inputs>

    <outputs>
        <data format="png" name="outfile" metadata_source="input" />
    </outputs>
    <tests>
    </tests>
    <help>
**What it does**

This tool creates a histogram image of sequence lengths distribution in a given fasta dataset file.

**TIP:** Use this tool after clipping your library (with **FASTX Clipper tool**), to visualize the clipping results.

-----

**Output Examples**

In the following library, most sequences are 24-mers to 27-mers.
This could indicate an abundance of endo-siRNAs (depending of course of what you've tried to sequence in the first place).

.. image:: ${static_path}/fastx_icons/fasta_clipping_histogram_1.png

In the following library, most sequences are 19,22 or 23-mers.
This could indicate an abundance of miRNAs (depending of course of what you've tried to sequence in the first place).

.. image:: ${static_path}/fastx_icons/fasta_clipping_histogram_2.png

-----

**Input Formats**

This tool accepts short-reads FASTA files. The reads don't have to be short, but they do have to be on a single line, like so::

   >sequence1
   AGTAGTAGGTGATGTAGAGAGAGAGAGAGTAG
   >sequence2
   GTGTGTGTGGGAAGTTGACACAGTA
   >sequence3
   CCTTGAGATTAACGCTAATCAAGTAAAC

If the sequences span over multiple lines::

   >sequence1
   CAGCATCTACATAATATGATCGCTATTAAACTTAAATCTCCTTGACGGAG
   TCTTCGGTCATAACACAAACCCAGACCTACGTATATGACAAAGCTAATAG
   aactggtctttacctTTAAGTTG

Use the **FASTA Width Formatter** tool to re-format the FASTA into a single-lined sequences::

   >sequence1
   CAGCATCTACATAATATGATCGCTATTAAACTTAAATCTCCTTGACGGAGTCTTCGGTCATAACACAAACCCAGACCTACGTATATGACAAAGCTAATAGaactggtctttacctTTAAGTTG

-----

**Multiplicity counts (a.k.a reads-count)**

If the sequence identifier (the text after the '>') contains a dash and a number, it is treated as a multiplicity count value (i.e. how many times that individual sequence repeated in the original FASTA file, before collapsing).

Example 1 - The following FASTA file *does not* have multiplicity counts::

    >seq1
    GGATCC
    >seq2
    GGTCATGGGTTTAAA
    >seq3
    GGGATATATCCCCACACACACACAC

Each sequence is counts as one, to produce the following chart:

.. image:: ${static_path}/fastx_icons/fasta_clipping_histogram_3.png

Example 2 - The following FASTA file have multiplicity counts::

    >seq1-2
    GGATCC
    >seq2-10
    GGTCATGGGTTTAAA
    >seq3-3
    GGGATATATCCCCACACACACACAC

The first sequence counts as 2, the second as 10, the third as 3, to produce the following chart:

.. image:: ${static_path}/fastx_icons/fasta_clipping_histogram_4.png

Use the **FASTA Collapser** tool to create FASTA files with multiplicity counts.

------

This tool is based on `FASTX-toolkit`__ by Assaf Gordon.

 .. __: http://hannonlab.cshl.edu/fastx_toolkit/
    </help>
</tool>