Mercurial > repos > devteam > fasta_to_tabular
annotate fasta_to_tabular.xml @ 1:7e801ab2b70e draft
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/fasta_to_tabular commit a1517c9d22029095120643bbe2c8fa53754dd2b7
| author | devteam |
|---|---|
| date | Wed, 11 Nov 2015 12:14:09 -0500 |
| parents | 9d189d08f2ad |
| children | 091edad7622f |
| rev | line source |
|---|---|
| 0 | 1 <tool id="fasta2tab" name="FASTA-to-Tabular" version="1.1.0"> |
| 2 <description>converter</description> | |
| 3 <command interpreter="python">fasta_to_tabular.py $input $output $keep_first $descr_columns</command> | |
| 4 <inputs> | |
| 5 <param name="input" type="data" format="fasta" label="Convert these sequences"/> | |
|
1
7e801ab2b70e
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/fasta_to_tabular commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents:
0
diff
changeset
|
6 <param name="descr_columns" type="integer" value="1" label="How many columns to divide title string into?" help="Typically 2 to take the ID (first word) and decription (rest) as two columns, or 1 to give a single column"> |
| 0 | 7 <validator type="in_range" min="1" /> |
| 8 </param> | |
|
1
7e801ab2b70e
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/fasta_to_tabular commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents:
0
diff
changeset
|
9 <param name="keep_first" type="integer" value="0" label="How many title characters to keep?" help="Applies only to the first column taken from the title string ('0' = keep the whole thing), useful when your sequence identifiers are all the same length."> |
| 0 | 10 <validator type="in_range" min="0" /> |
| 11 </param> | |
| 12 </inputs> | |
| 13 <outputs> | |
| 14 <data name="output" format="tabular"/> | |
| 15 </outputs> | |
| 16 <tests> | |
| 17 <test> | |
| 18 <param name="input" value="454.fasta" /> | |
| 19 <param name="descr_columns" value="1"/> | |
| 20 <param name="keep_first" value="0"/> | |
| 21 <output name="output" file="fasta_to_tabular_out1.tabular" /> | |
| 22 </test> | |
| 23 | |
| 24 <test> | |
| 25 <param name="input" value="4.fasta" /> | |
| 26 <param name="descr_columns" value="1"/> | |
| 27 <param name="keep_first" value="0"/> | |
| 28 <output name="output" file="fasta_to_tabular_out2.tabular" /> | |
| 29 </test> | |
| 30 | |
| 31 <test> | |
| 32 <param name="input" value="454.fasta" /> | |
| 33 <param name="descr_columns" value="1"/> | |
| 34 <param name="keep_first" value="14"/> | |
| 35 <output name="output" file="fasta_to_tabular_out3.tabular" /> | |
| 36 </test> | |
| 37 | |
| 38 <test> | |
| 39 <param name="input" value="454.fasta" /> | |
| 40 <param name="descr_columns" value="2"/> | |
| 41 <param name="keep_first" value="0"/> | |
| 42 <output name="output" file="fasta_to_tabular_out4.tabular" /> | |
| 43 </test> | |
| 44 | |
| 45 <test> | |
| 46 <param name="input" value="454.fasta" /> | |
| 47 <param name="descr_columns" value="5"/> | |
| 48 <param name="keep_first" value="0"/> | |
| 49 <output name="output" file="fasta_to_tabular_out5.tabular" /> | |
| 50 </test> | |
| 51 | |
| 52 <test> | |
| 53 <param name="input" value="454.fasta" /> | |
| 54 <param name="descr_columns" value="5"/> | |
| 55 <param name="keep_first" value="10"/> | |
| 56 <output name="output" file="fasta_to_tabular_out6.tabular" /> | |
| 57 </test> | |
| 58 | |
| 59 </tests> | |
| 60 <help> | |
| 61 | |
| 62 **What it does** | |
| 63 | |
| 64 This tool converts FASTA formatted sequences to TAB-delimited format. | |
| 65 | |
| 66 Many tools consider the first word of the FASTA ">" title line to be an identifier, and any remaining text to be a free form description. | |
| 67 It is therefore useful to split this text into two columns in Galaxy (identifier and any description) by setting **How many columns to divide title string into?** to **2**. | |
| 68 In some cases the description can be usefully broken up into more columns -- see the examples . | |
| 69 | |
| 70 The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry. | |
| 71 With the introduction of the **How many columns to divide title string into?** option this setting is of limited use, but does still allow you to truncate the identifier. | |
| 72 | |
| 73 ----- | |
| 74 | |
| 75 **Example** | |
| 76 | |
| 77 Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run:: | |
| 78 | |
| 79 >EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ | |
| 80 TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG | |
| 81 TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG | |
| 82 >EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ | |
| 83 AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAA | |
| 84 | |
| 85 Running this tool with the default settings will produce this (2 column output): | |
| 86 | |
| 87 ========================================================================== ======================================= | |
| 88 EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG | |
| 89 EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA | |
| 90 ========================================================================== ======================================= | |
| 91 | |
| 92 Having the full title line (the FASTA ">" line text) as a column is not always ideal. | |
| 93 | |
| 94 The **How many characters to keep?** option is useful if your identifiers are all the same length. | |
| 95 In this example the identifier is 14 characters, so setting **How many characters to keep?** to **14** (and leaving **How many columns to divide title string into?** as the default, **1**) will produce this (2 column output): | |
| 96 | |
| 97 ============== ======================================= | |
| 98 EYKX4VC02EQLO5 TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG | |
| 99 EYKX4VC02D4GS2 AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA | |
| 100 ============== ======================================= | |
| 101 | |
| 102 If however your FASTA file has identifiers of variable length, it is better to split the text into at least two columns. | |
| 103 Running this tool with **How many columns to divide title string into?** to **2** will produce this (3 column output): | |
| 104 | |
| 105 ============== =========================================================== ======================================= | |
| 106 EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG | |
| 107 EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA | |
| 108 ============== =========================================================== ======================================= | |
| 109 | |
| 110 Running this tool with **How many columns to divide title string into?** to **5** will produce this (5 column output): | |
| 111 | |
| 112 ============== ========== ============ ======== ========================== ======================================= | |
| 113 EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG | |
| 114 EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA | |
| 115 ============== ========== ============ ======== ========================== ======================================= | |
| 116 | |
| 117 Running this tool with **How many columns to divide title string into?** to **5** and **How many characters to keep?** to **10** will produce this (5 column output). | |
| 118 Notice that only the first column is truncated to 10 characters -- and be careful not to trim your sequence names too much (generally they should be unique): | |
| 119 | |
| 120 ========== ========== ============ ======== ========================== ======================================= | |
| 121 EYKX4VC02E length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG | |
| 122 EYKX4VC02D length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA | |
| 123 ========== ========== ============ ======== ========================== ======================================= | |
| 124 | |
| 125 Note the sequences have been truncated for display purposes in the above tables. | |
| 126 | |
| 127 </help> | |
| 128 </tool> |