Mercurial > repos > devteam > fastq_to_fasta

changeset 1:186b8d913e6c draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastq_to_fasta commit a1517c9d22029095120643bbe2c8fa53754dd2b7
author devteam
date Wed, 11 Nov 2015 12:38:08 -0500
parents 04614cf6ed39
children ce309f4ff17f
files fastq_to_fasta.xml tool_dependencies.xml
diffstat 2 files changed, 7 insertions(+), 7 deletions(-) [+]
line wrap: on
line diff
--- a/fastq_to_fasta.xml	Wed Sep 25 11:04:26 2013 -0400
+++ b/fastq_to_fasta.xml	Wed Nov 11 12:38:08 2015 -0500
@@ -1,9 +1,9 @@
-<tool id="cshl_fastq_to_fasta" name="FASTQ to FASTA">
+<tool id="cshl_fastq_to_fasta" name="FASTQ to FASTA" version="1.0.0">
 	<description>converter</description>
     <requirements>
         <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
     </requirements>
-	<command>gunzip -cf $input | fastq_to_fasta $SKIPN $RENAMESEQ -o $output -v 
+	<command>gunzip -cf $input | fastq_to_fasta $SKIPN $RENAMESEQ -o $output -v
 #if $input.ext == "fastqsanger":
 -Q 33
 #end if
@@ -61,22 +61,22 @@
     GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
     +CSHL_4_FC042GAMMII_2_1_517_596
     40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
-  
+
 Will be converted to FASTA (with 'rename sequence names' = NO)::
 
     >CSHL_4_FC042GAMMII_2_1_517_596
     GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
-    
+
 Will be converted to FASTA (with 'rename sequence names' = YES)::
 
     >1
     GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
-    
+
 ------
 
 This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
 
- .. __: http://hannonlab.cshl.edu/fastx_toolkit/    
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
 </help>
 <!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
 </tool>
--- a/tool_dependencies.xml	Wed Sep 25 11:04:26 2013 -0400
+++ b/tool_dependencies.xml	Wed Nov 11 12:38:08 2015 -0500
@@ -1,6 +1,6 @@
 <?xml version="1.0"?>
 <tool_dependency>
     <package name="fastx_toolkit" version="0.0.13">
-        <repository changeset_revision="ec66ae4c269b" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="http://toolshed.g2.bx.psu.edu" />
+        <repository changeset_revision="ec66ae4c269b" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" />
     </package>
 </tool_dependency>