Mercurial > repos > devteam > quality_filter

comparison quality_filter.xml @ 0:8d65bbc52dfe draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Imported from capsule None
author devteam
date Tue, 01 Apr 2014 10:52:42 -0400
parents
children 64f5401327e8
comparison
equal deleted inserted replaced
-1:000000000000 0:8d65bbc52dfe
1 <tool id="qualityFilter" name="Filter nucleotides" version="1.0.1">
2 <description> based on quality scores</description>
3 <requirements>
4 <requirement type="package" version="0.7.1">bx-python</requirement>
5 <requirement type="package" version="1.7.1">numpy</requirement>
6 </requirements>
7 <command interpreter="python">
8 quality_filter.py
9 $input
10 $out_file1
11 $primary_species
12 $mask_species
13 $score
14 $mask_char
15 ${mask_region.region}
16 #if $mask_region.region == "3"
17 ${mask_region.lengthr},${mask_region.lengthl}
18 #elif $mask_region.region == "0"
19 1
20 #else
21 ${mask_region.length}
22 #end if
23 ${GALAXY_DATA_INDEX_DIR}/quality_scores.loc
24 </command>
25 <inputs>
26 <param format="maf" name="input" type="data" label="Select data"/>
27 <param name="primary_species" type="select" label="Use quality scores of" display="checkboxes" multiple="true">
28 <options>
29 <filter type="data_meta" ref="input" key="species" />
30 </options>
31 </param>
32 <param name="mask_species" type="select" label="Mask Species" display="checkboxes" multiple="true">
33 <options>
34 <filter type="data_meta" ref="input" key="species" />
35 </options>
36 </param>
37 <param name="score" size="10" type="integer" value="20" label="Quality score cut-off" help="Cut-off value of 20 means mask all nucleotides having quality score less than or equal to 20"/>
38 <param name="mask_char" size="5" type="select" label="Mask character">
39 <option value="0" selected="true">#</option>
40 <option value="1">$</option>
41 <option value="2">^</option>
42 <option value="3">*</option>
43 <option value="4">?</option>
44 <option value="5">N</option>
45 </param>
46 <conditional name="mask_region">
47 <param name="region" type="select" label="Mask region">
48 <option value="0" selected="true">Only the corresponding nucleotide </option>
49 <option value="1">Corresponding column + right-side neighbors</option>
50 <option value="2">Corresponding column + left-side neighbors</option>
51 <option value="3">Corresponding column + neighbors on both sides</option>
52 </param>
53 <when value="0">
54 </when>
55 <when value="1">
56 <param name="length" size="10" type="integer" value="2" label="Number of right-side neighbors"/>
57 </when>
58 <when value="2">
59 <param name="length" size="10" type="integer" value="2" label="Number of left-side neighbors"/>
60 </when>
61 <when value="3">
62 <param name="lengthr" size="10" type="integer" value="2" label="Number of neighbors on right-side" />
63 <param name="lengthl" size="10" type="integer" value="2" label="Number of neighbors on left-side" />
64 </when>
65 </conditional>
66 </inputs>
67 <outputs>
68 <data format="maf" name="out_file1" metadata_source="input"/>
69 </outputs>
70 <requirements>
71 <requirement type="python-module">numpy</requirement>
72 </requirements>
73 <tests>
74 <test>
75 <param name="input" value="6.maf"/>
76 <param name="primary_species" value="panTro2"/>
77 <param name="mask_species" value="hg18"/>
78 <param name="score" value="50"/>
79 <param name="mask_char" value="0"/>
80 <param name="region" value="0" />
81 <output name="out_file1" file="6_quality_filter.maf"/>
82 </test>
83 </tests>
84 <help>
85
86 .. class:: infomark
87
88 **What it does**
89
90 This tool takes a MAF file as input and filters nucleotides in every alignment block of the MAF file based on their quality/PHRED scores.
91
92 -----
93
94 .. class:: warningmark
95
96 **Note**
97
98 Any block/s not containing the primary species (species whose quality scores is to be used), will be omitted.
99 Also, any primary species whose quality scores are not available in Galaxy will be considered as a non-primary species. This info will appear as a message in the job history panel.
100
101 -----
102
103 **Example**
104
105 - For the following alignment block::
106
107 a score=4050.0
108 s hg18.chrX 3719221 48 - 154913754 tattttacatttaaaataaatatgtaaatatatattttatatttaaaa
109 s panTro2.chrX 3560945 48 - 155361357 tattttatatttaaaataaagatgtaaatatatattttatatttaaaa
110
111 - running this tool with **Primary species as panTro2**, **Mask species as hg18, panTro2**, **Quality cutoff as 20**, **Mask character as #** and **Mask region as only the corresponding position** will return::
112
113 a score=4050.0
114 s hg18.chrX 3719221 48 - 154913754 ###tttac#####a###a#atatgtaaat###tattt#####ttaaaa
115 s panTro2.chrX 3560945 48 - 155361357 ###tttat#####a###a#agatgtaaat###tattt#####ttaaaa
116
117 where, the positions containing # represent panTro2 nucleotides having quality scores less than 20.
118 </help>
119 </tool>